In Vitro Characterization of an Rgg-Family Regulator from Fish-Derived Streptococcus parauberis and Its Modulation by Cyclosporin A
Round 1
Reviewer 1 Report
Comments and Suggestions for AuthorsThe manuscript entitled “Functional Characterization of an Rgg-Family Quorum-Sensing Regulator in Fish-Derived Streptococcus parauberis and Its In Vitro Modulation by Cyclosporin A " was reviewed. The study dealt with QS regulator Rgg in S. parauberis and evaluate its potential as a target for QS interference with e cyclosporin A. Overall, this is well-structured and informative article. Here are some suggestions/revisions:
Please, explain the meaning of Rgg as (Regulator gene of glucosyltransferases).
Revise the title of table one to be more informative.
Increase the resolution of Figure 1 and Figure 3b.
Author Response
Comment 1:
Please, explain the meaning of Rgg as (Regulator gene of glucosyltransferases).
Response:
Thank you for this helpful suggestion. We have added an explanation of the term “Rgg” (Regulator gene of glucosyltransferases) in the Introduction section (Lines 74-75).
Comment 2:
Revise the title of table one to be more informative.
Response:
The title of Table 1 has been revised to improve clarity. Now it reads: “Primers used for gene cloning, mutagenesis, and probe preparation in this study” (Line 129).
Comment 3:
Increase the resolution of Figure 1 and Figure 3b.
Response:
The resolution of Figure 1 and Figure 3b has been improved to meet publication standards.
Reviewer 2 Report
Comments and Suggestions for AuthorsThis is a review for the scientific article "Functional Characterization of an Rgg-Family Quorum-Sensing Regulator in Fish-Derived Streptococcus parauberis and Its In Vitro Modulation by Cyclosporin A" by Chuandeng Tu et al..
The manuscript tackles a highly relevant topic: identifying novel targets for quorum sensing interference (QSI) in Streptococcus parauberis, a major pathogen responsible for streptococcosis and severe economic losses in aquaculture.
The bioinformatic identification, gene cloning, and protein purification methodologies are well-executed. Furthermore, the use of electrophoretic mobility shift assays (EMSA) and site-directed mutagenesis to confirm the DNA-binding activity of the Rgg regulator (and its critical arginine residues R12 and R15) provides a solid biochemical foundation.
The paper is generally well-written and scientifically interesting, though it requires revisions to properly contextualize the practical applicability of the QSI claims and address the limitations of the purely in vitro characterization. With these adjustments, it will be a solid contribution to the field.
However, the paper suffers from some flaws, which I will address in the following point-by-point list.
Major
1) In Vivo Functional Validation. The title claims a "Functional Characterization" of the Rgg regulator. However, the study relies entirely on in vitro EMSA assays to demonstrate Rgg's binding to its own promoter. While the authors appropriately acknowledge the lack of in vivo functional studies as a limitation , claiming Rgg is a key "quorum-sensing regulator" without demonstrating its control over downstream virulence factors or showing in vivo phenotypic changes (such as altered biofilm formation or host colonization) overstates the current findings. The text and title should be revised to temper these claims, emphasizing that this is primarily an in vitro biochemical and structural characterization.
2) Cyclosporin A (CsA) Applicability. The authors propose CsA as a basis for exploring QSI strategies to control S. parauberis infections in aquaculture. However, CsA is a well-known and potent immunosuppressant. Treating fish with an immunosuppressant to combat a bacterial infection could compromise the host's immune system, which seems highly counterproductive. The authors must address this fundamental biological contradiction in the discussion. Furthermore, the complete inhibition of Rgg-promoter binding required a high concentration of 100 µM CsA. The authors need to contextualize whether this concentration is biologically relevant or realistically achievable in an aquaculture setting.
3) Autoregulation vs. Target Gene Binding. The study tests the binding of Rgg exclusively to its own predicted promoter via the P1 probe. While autoregulatory circuits are common among QS regulators , characterizing a protein as a master QS regulator usually requires demonstrating its interaction with the broader regulon. The authors should explicitly note that binding to the autoregulatory promoter does not definitively prove its regulatory scope over the entire QS network.
Minor
4) Typographical error in Figure 1. The phylogenetic tree contains a typo in the top label for Streptococcus thermophilus, identifying it as a "helix-turu-helis" domain-containing protein instead of "helix-turn-helix".
5) Figure 2 Caption Formatting. The caption for Figure 2 appears significantly corrupted. The text abruptly breaks into a string of DNA sequences and fragments ("Fi TTGCGACGACTTATGAAAAACATTTAGAAAAAATTTTAAAGGAGGAAGTC AGGAGGAAGTCTAA robe (P1).") before resuming the standard description. This formatting error must be corrected prior to publication.
6) Spelling Error in text. In section 2.6 (Electrophoretic Mobility Shift Assay), the word "specific" is misspelled as "specifc" when describing the negative control probe.
Author Response
Comment 1:
In Vivo Functional Validation. The title claims a "Functional Characterization" of the Rgg regulator. However, the study relies entirely on in vitro EMSA assays to demonstrate Rgg's binding to its own promoter. While the authors appropriately acknowledge the lack of in vivo functional studies as a limitation , claiming Rgg is a key "quorum-sensing regulator" without demonstrating its control over downstream virulence factors or showing in vivo phenotypic changes (such as altered biofilm formation or host colonization) overstates the current findings. The text and title should be revised to temper these claims, emphasizing that this is primarily an in vitro biochemical and structural characterization.
Response:
We thank the reviewer for this important comment. We agree that the current study is primarily based on in vitro biochemical assays. To address this concern, we have revised the title to emphasize “in vitro characterization”, now it reads: “In Vitro Characterization of an Rgg-Family Regulator from Fish-Derived Streptococcus parauberis and Its Modulation by Cyclosporin A” (Lines 2-4) and revised overstatements regarding functional validation in text (Lines 21-23, Lines 39-44, Lines 102-105, Lines 342-345, Lines 369-370, Lines 460-462). These changes better reflect the scope and limitations of the present study.
Comment 2:
Cyclosporin A (CsA) Applicability. The authors propose CsA as a basis for exploring QSI strategies to control S. parauberis infections in aquaculture. However, CsA is a well-known and potent immunosuppressant. Treating fish with an immunosuppressant to combat a bacterial infection could compromise the host's immune system, which seems highly counterproductive. The authors must address this fundamental biological contradiction in the discussion. Furthermore, the complete inhibition of Rgg-promoter binding required a high concentration of 100 µM CsA. The authors need to contextualize whether this concentration is biologically relevant or realistically achievable in an aquaculture setting.
Response:
We thank the reviewer for this insightful and important comment. We agree that the immunosuppressive nature of CsA limits its direct application in aquaculture. In the revised manuscript (Discussion, Lines 419-423), we clarify that CsA is used here only as an in vitro chemical probe, rather than a practical therapeutic agent.
We have also added discussion noting that the relatively high concentration (100 µM) required for complete inhibition is unlikely to be physiologically achievable in aquaculture systems (Lines 404-407). Therefore, CsA should be considered as a proof-of-concept molecule demonstrating that Rgg activity can be modulated by small compounds.
Future studies will focus on identifying safer and more potent analogs suitable for practical applications (Discussion, Lines 423-426).
Comment 3:
Autoregulation vs. Target Gene Binding. The study tests the binding of Rgg exclusively to its own predicted promoter via the P1 probe. While autoregulatory circuits are common among QS regulators , characterizing a protein as a master QS regulator usually requires demonstrating its interaction with the broader regulon. The authors should explicitly note that binding to the autoregulatory promoter does not definitively prove its regulatory scope over the entire QS network.
Response:
We thank the reviewer for this important comment. We agree that binding to the autoregulatory promoter alone is insufficient to establish the full regulatory scope of Rgg. In the revised manuscript (Discussion, Lines 379-383), we have explicitly clarified this limitation and emphasized that the broader regulon and role of Rgg within the QS network remain to be determined through future studies.
Comment 4:
Typographical error in Figure 1. The phylogenetic tree contains a typo in the top label for Streptococcus thermophilus, identifying it as a "helix-turu-helis" domain-containing protein instead of "helix-turn-helix".
Response:
We thank the reviewer for pointing out this error. The typographical mistake in Figure 1 has been corrected to “helix-turn-helix” in the revised manuscript.
Comment 5:
Figure 2 Caption Formatting. The caption for Figure 2 appears significantly corrupted. The text abruptly breaks into a string of DNA sequences and fragments ("Fi TTGCGACGACTTATGAAAAACATTTAGAAAAAATTTTAAAGGAGGAAGTC AGGAGGAAGTCTAA robe (P1).") before resuming the standard description. This formatting error must be corrected prior to publication.
Response:
We thank the reviewer for pointing out this formatting issue. The caption of Figure 2 has been carefully revised, and the corrupted text has been removed to ensure clarity and correctness in the revised manuscript.
Comment 6:
Spelling Error in text. In section 2.6 (Electrophoretic Mobility Shift Assay), the word "specific" is misspelled as "specifc" when describing the negative control probe.
Response:
We thank the reviewer for pointing out this error. The spelling mistake has been corrected in Section 2.6 of the revised manuscript.
Reviewer 3 Report
Comments and Suggestions for AuthorsThe article Functional Characterization of an Rgg-Family Quorum-Sensing Regulator in Fish-Derived Streptococcus parauberis and Its In Vitro Modulation by Cyclosporin A that is being submitted to be published in Microorganisms is a good article concerning the management of Streptococcus infection in aquaculture. These are some of the aspects that should be discussed.
- Present some details on the potential effect of this pathogen on fish-consuming clients.
- Recommend the reasons why Quorum-Sensing Regulators are a good alternative to using antibiotics over other methods, such as vaccines, phage therapy,
- The penultimate paragraph of the introduction should include references to support what you are saying.
- Add a few words regarding the current applications of this method of suppressing the pathogens of aquaculture in other areas.
- Give a bit of description on the origin and the nature of the functions of the S. parauberis strain KRS02083 and the reasons why this particular strain has been chosen to be used in this particular study. Could be this strain is MDR, or has a variety of virulence markers etc.,
- Why were you not using an ATCC strain?
- Cloning, Expression, and Purification section should be reinforced with the relevant citations.
- This applies to the case of Western Blot Analysis.
- Such systems, "chemiluminescence (ECL) detection system," need to be specified.
- Give details regarding both positive and negative controls in every assay.
- Compare the findings of the current study and other aquaculture-related pathogens.
- Discuss in the discussion section how such in vitro studies can be used to justify the use of these techniques in vivo in aquaculture.
- The conclusion should also be changed, taking into consideration the potential influence of the application of such methods to control aquatic pathogens.
Author Response
Comment 1:
Present some details on the potential effect of this pathogen on fish-consuming clients.
Response:
We thank the reviewer for this valuable suggestion. Relevant information has been added in the Introduction (Lines 55-56).
Comment 2:
Recommend the reasons why Quorum-Sensing Regulators are a good alternative to using antibiotics over other methods, such as vaccines, phage therapy.
Response:
We thank the reviewer for this valuable suggestion. In the revised manuscript (Introduction, Lines 60-65), we have expanded the advantages of targeting quorum-sensing regulators, including reduced selective pressure for resistance, broader applicability across strains, and the ability to attenuate virulence without inhibiting bacterial growth. We also added a brief comparison with vaccines and phage therapy to better contextualize the potential benefits of quorum-sensing-based strategies.
Comment 3:
The penultimate paragraph of the introduction should include references to support what you are saying.
Response:
We thank the reviewer for this helpful suggestion. In the revised manuscript (Introduction, Line 93), appropriate references have been added to support the statements in the penultimate paragraph.
Comment 4:
Add a few words regarding the current applications of this method of suppressing the pathogens of aquaculture in other areas.
Response:
We thank the reviewer for this valuable suggestion. We have added the applications of quorum sensing interference based pathogen control strategies beyond aquaculture in introduction (Lines 83-88). These additions have been incorporated into the revised manuscript and are highlighted in yellow for clarity. We believe this revision improves the broader relevance and contextual significance of our study.
Comment 5:
Give a bit of description on the origin and the nature of the functions of the S. parauberis strain KRS02083 and the reasons why this particular strain has been chosen to be used in this particular study. Could be this strain is MDR, or has a variety of virulence markers etc.,
Response:
Thank you for this valuable suggestion. We have added a brief description of the origin and characteristics of S. parauberis strain KRS02083 in the Materials and Methods section.
Specifically, this strain was isolated from diseased Japanese flounder and was selected due to its clinical relevance, as well as the presence of multiple antimicrobial resistance-associated genes and virulence factors revealed by genomic analysis.
Comment 6:
Why were you not using an ATCC strain?
Response:
Thank you for this important question. We chose not to use an ATCC reference strain because this study aimed to investigate a clinically relevant, fish-derived isolate. Strain KRS02083 was obtained from diseased Japanese flounder and better reflects the pathogenic characteristics encountered in aquaculture settings, including the presence of antimicrobial resistance-associated genes and virulence factors. Therefore, it was considered more suitable for studying quorum sensing-related regulatory mechanisms in real-world conditions.
Comment 7:
Cloning, Expression, and Purification section should be reinforced with the relevant citations.
Response:
Thank you for your suggestion. Relevant references (30,31) have now been added to the Cloning, Expression, and Purification section to support the methodology.
Comment 8:
This applies to the case of Western Blot Analysis.
Response:
Thank you for your suggestion. Relevant reference (32) have also been added to the Western Blot Analysis section to support the methodology.
Comment 9:
Such systems, "chemiluminescence (ECL) detection system," need to be specified.
Response:
Thank you for your suggestion. We have now specified the chemiluminescence (ECL) detection system used (Clarity™ Western ECL Substrate, Bio-Rad, USA) in the Western Blot Analysis section to improve methodological clarity (Line 72).
Comment 10:
Give details regarding both positive and negative controls in every assay.
Response:
Thank you for this valuable suggestion. We have now provided explicit descriptions of both positive and negative controls for each assay in the Materials and Methods section to improve experimental clarity (Lines 154-155, Lines 169-170, Lines 180-181, Lines 183-184, Line 196, Lines 209-210).
Comment 11:
Compare the findings of the current study and other aquaculture-related pathogens.
Response:
Thank you for this insightful suggestion. We have added a brief comparative discussion highlighting that, similar to other aquaculture pathogens such as Vibrio harveyi and Aeromonas hydrophila, quorum sensing plays a critical role in regulating virulence, biofilm formation, and environmental adaptation. Our findings on the Rgg regulator in S. parauberis are consistent with these studies, supporting the concept that targeting quorum sensing systems represents a broadly applicable strategy for controlling bacterial pathogens in aquaculture (Lines 338-345).
Comment 12:
Discuss in the discussion section how such in vitro studies can be used to justify the use of these techniques in vivo in aquaculture.
Response:
Thank you for this valuable suggestion. We have incorporated a brief discussion linking our in vitro findings to their potential in vivo applications, emphasizing that the observed modulation of Rgg activity by small molecules supports the feasibility of targeting quorum sensing systems as an anti-virulence strategy in aquaculture. We further clarified that CsA serves as a proof-of-concept compound, highlighting the need for developing more suitable analogs for practical in vivo use (Lines 421-426).
Comment 13:
The conclusion should also be changed, taking into consideration the potential influence of the application of such methods to control aquatic pathogens.
Response:
Thank you for this helpful suggestion. We have revised the conclusion accordingly, acknowledging the immunosuppressive nature of CsA and its limitations for aquaculture application. The revised text now emphasizes the need to identify safe, biologically relevant modulators of Rgg for future disease control strategies in aquaculture (Lines 456-460).
Reviewer 4 Report
Comments and Suggestions for AuthorsTITLE-Functional Characterization of an Rgg-Family Quorum-Sensing 2 Regulator in Fish-Derived Streptococcus parauberis and Its In 3 Vitro Modulation by Cyclosporin A
REVIEW:
The article is well written with a clear introduction that focuses on the research gap.
The strength of this study is that it has comprehensive methodological approach and novel demonstration of CsA as a quorum-sensing inhibitor in aquatic streptococci.
However, the manuscript can be strengthened with few suggestions.
- The authors are requested to clarify the novelty explicitly with the biological relevance at the end of the discussion.
- Clear hypothesis statement can be mentioned early in the discussion section.
Overall the manuscript can be accepted with the above minor corrections.
Comments for author File: 
Comments.pdf
Author Response
Comment 1:
The authors are requested to clarify the novelty explicitly with the biological relevance at the end of the discussion.
Response:
Thank you for this constructive comment. We have revised the end of the Discussion to more explicitly state the novelty and biological relevance of our findings. The revised text now highlights that this is the first in vitro biochemical characterization of an Rgg-family regulator from fish-derived S. parauberis, and clarifies that the observed promoter binding and modulation by CsA provide initial, though indirect, evidence for a potential role in quorum sensing-associated gene regulation. We also emphasize that these findings lay a foundation for future studies linking Rgg to infection-relevant phenotypes in aquaculture hosts (Lines 441-450).
Comment 2:
Clear hypothesis statement can be mentioned early in the discussion section.
Response:
Thank you for the valuable suggestion. We have added a clear hypothesis statement at the beginning of the Discussion section (Lines 328-332). In addition, we have also included the same hypothesis in the Abstract (Lines 24-26) to improve clarity and framing of the study.
