Next Article in Journal
Leuconostoc mesenteroides AA001: A High-Efficiency Nitrite Degrader Facilitating Controlled and Safe Traditional Vegetable Fermentation
Next Article in Special Issue
Effects of Tannic Acid on Immune Function and Gut Microbiota in Brandt’s Voles (Lasiopodomys brandtii)
Previous Article in Journal
A Division-Associated Envelope Protein, MAB_2363, Drives Intrinsic Resistance and Virulence in Mycobacterium abscessus
Previous Article in Special Issue
Heat-Killed Enterococcus faecalis EF-2001 Promotes Systemic Th1-Skewed Immune Activation Without Detectable Reduction of Influenza Viral Load in Mice
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Microorganisms
Volume 14
Issue 2
10.3390/microorganisms14020410
microorganisms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Lactobacillus rhamnosus GG Alleviates Post-Weaning Stress-Induced Intestinal Barrier Damage and Inflammation by Promoting Intestinal Health and Modulating the Gut Microbiota in Piglets

by
Gaohuan Hou
1,2,†,
Hongbin Deng
1,2,†,
Lingliang Zhou
1,
Yang Liu
1,
Weiqin Li
1,2,
Weifen Li
3,* and
Qi Wang
1,2,*
1
School of Medicine, Southeast University, Nanjing 210000, China
2
Jinling Hospital, Affiliated Hospital of Medical School, Jinling Clinical Medical College, Nanjing University, Nanjing 210002, China
3
Key Laboratory of Animal Molecular Nutrition of Education of Ministry, National Engineering Laboratory of Biological Feed Safety and Pollution Prevention and Control, Key Laboratory of Animal Feed and Nutrition of Zhejiang Province, Institute of Animal Nutrition and Feed Sciences, College of Animal Sciences, Zhejiang University, Hangzhou 310058, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Microorganisms 2026, 14(2), 410; https://doi.org/10.3390/microorganisms14020410
Submission received: 20 November 2025 / Revised: 21 January 2026 / Accepted: 27 January 2026 / Published: 9 February 2026
(This article belongs to the Special Issue Gut Microbes and Probiotics)
Browse Figures
Versions Notes

Abstract

The aim of this study is to investigate oral administration of L. rhamnosus GG (LGG) in early life on the growth performance, diarrhea, intestinal health, and microbiota of post-weaning piglets. Ninety-six newborn piglets were randomly divided into two groups. Piglets were orally administered with 2 mL of 10% sterile skim milk or 2 mL of 10% sterile skim milk suspended with viable LGG (1 × 108 CFU/mL). Results showed that compared with the control group, oral administration of LGG in early life slightly decreased diarrhea incidence. Furthermore, LGG supplementation maintained the intestinal barrier integrity (HE, DAO) and reduced the generation of the inflammatory response. 16S rRNA sequencing showed that LGG modulated the colon microbiota composition of piglets by increasing the relative abundance of Bifidobacterium, Helicobacter, Mucispirillum, and Dorea. Metabolomic study suggested that LGG substantially influenced the intestinal metabolic profile, particularly compounds associated with the biosynthesis of unsaturated fatty acids. The metabolic alterations were closely linked to the enhancement of the microbial community makeup. The analysis of jejunum RNA sequencing indicated that, in comparison to the CON group, LGG significantly downregulated various immune-related signaling pathways, especially the PI3K/AKT pathways. Correlation analysis of microbiota, metabolism, and genes uncovered a substantial association between the taxa enhanced by LGG and the critical genes in the PI3K/AKT signaling pathways. The coculture system of LGG and intestinal organoids revealed that LGG alleviated TNF-α induced injury through inhibiting the PI3K/AKT signaling pathway. Overall, the integrated analysis of multiple omics approaches revealed that LGG reduced post-weaning induced intestinal injury through the regulation of gut microbiota, modification of metabolic profiles, reinforcement of the intestinal barrier, and downregulation of the PI3K/AKT signaling pathway.

1. Introduction

Diarrhea is one of the most typical diseases in weaning piglets, which typically occurs in the first weeks after weaning, and it can compromise the growth performance and overall health by decreasing feed intake of piglets, causing substantial morbidity and mortality, and consequently resulting in severe economic losses to animal husbandry [1]. It was reported that impaired intestinal microbiota of piglets after weaning contributed to an extraordinary permissiveness to pathogen colonization and induction of pro-inflammatory status [2]. Increasing evidence suggests that a relationship exists between diarrhea and intestinal dysbiosis of piglets [3]. As such, it is vital and essential to explore potential ways to attenuate diarrhea by improving intestinal microbiota and health.
Increasing evidence showed that early dietary interventions in animals were promising ways to improve the maturation of gastrointestinal microbiota [4]. Traditionally, dietary supplementation with antibiotic growth promoters (AGP) was the most effective strategy for preventing diarrhea [2,5]. However, with the public increasing concern about serious antibiotic resistance problems, prohibiting the use of antibiotics as growth promoting agent has been proposed in many countries [6]. Therefore, it is of great significance to find healthy and eco-friendly alternatives to antibiotics for the weaning piglets against early-weaning-induced stress and diarrhea.
As live microorganisms, probiotics are often used to regulate gut microbial colonization and can be regarded as an effective and promising potential alternative to aAGP [7]. As a typical type of lactic acid bacteria, Lactobacillus rhamnosus (L. rhamnosus) GG isolated from a fecal sample of a healthy adult is biologically resistant to acids and bile salt, and commonly used for prevention or treatment of various diarrhea, rotavirus infections, and allergic diseases in humans [8]. Previous studies have found that L. rhamnosus GG regulates apoptotic signaling to shield intestinal epithelial cells from damage and necrotizing apoptosis, and it suppresses inflammation [9,10,11]. Overall, Numerous studies have reported that L. rhamnosus GG has a beneficial effect on reducing pathogen-induced inflammatory response and diarrhea in pigs, but few studies investigated the protective effect of oral administration of L. rhamnosus GG in the early life of newborn piglets on post-weaning piglets.
Therefore, the current study aims to investigate the effect of oral administration of L. rhamnosus GG in the early life of newborn piglets on the growth performance, diarrhea occurrence, intestinal health, and intestinal microbiota in post-weaning piglets, which may provide a powerful basis for the application of L. rhamnosus GG in the swine industry. Intestinal organoids are consistent with the crypt-villus structure and can reproduce various types of intestinal epithelium cells [12]. Previous studies have revealed that TNF-α is a pro-inflammatory mediator that plays a key role in the pathogenesis of weaning stress [13]. Therefore, we created in vitro models of intestinal organoids that had been treated with TNF-α and then co-cultured them with L. rhamnosus GG in order to investigate the bacteria’s direct or indirect impact on intestinal cells.

2. Materials and Methods

2.1. Bacterial Preparation

The L. rhamnosus GG (ATCC 53103) was purchased from the Chinese Center of Industrial Culture Collection (CICC) and cultured in de Mann-Rogosa-Sharpe (MRS) medium (Oxoid, Basingstoke, UK) at 37 °C for 30 h. Then the bacterial strain at the logarithmic phase was collected by centrifugation at 3500× g for 10 min at 4 °C and washed twice with sterile phosphate-buffered saline (pH 7.4). Thereafter, the bacteria were resuspended in 10% of sterilized skim milk for required concentration (1 × 108 CFU/mL).

2.2. Animal Experiment

The Animal Care and Use Committee of Zhejiang University approved our research (Ethical Code License No. ZJU 17471). 96 healthy neonatal piglets (Duroc × Landrace × Yorkshire) with similar initial weights were obtained from 12 sows with a similar parity. In order to avoid maternal differences, the piglets from 12 litters were randomly divided into two groups: the control group (nsows = 6, npiglets = 48) and the L. rhamnosus group (nsows = 6, npiglets = 48). All piglets were housed in weaning rooms with controlled temperature and ventilation. Piglets in the control group orally received 2 mL of 10% sterilized skimmed milk, while piglets in the L. rhamnosus group were orally administered with 2 mL of 10% sterilized skimmed milk suspended with viable L. rhamnosus (1 × 108 CFU/mL) by gavage at Days 1, 3, and 5 of age after birth. Piglets were weaned at the age of 25d. From the 12th day, piglets were started to feed pre-starter feed. All sows and piglets were maintained under standardized commercial management conditions throughout the study period. Sows were fed a nutritionally balanced commercial diet formulated to meet NRC requirements, and piglets had ad libitum access to age-appropriate commercial feed following birth/weaning. Fresh drinking water was provided ad libitum via an adequate number of drinking troughs or nipple drinkers to avoid competition and ensure unrestricted access. Piglets were housed in groups of uniform size with homogeneous composition in terms of age and body weight to minimize social stress and variability. Stocking density was maintained according to industry guidelines. The housing environment was controlled with respect to macro- and microclimatic conditions, including temperature, humidity, ventilation, and air quality, which were monitored daily to ensure optimal conditions for piglet health. General hygiene practices were strictly implemented, including regular cleaning and disinfection of pens and equipment. Piglets remained with the sow during a standardized nursing period prior to weaning. An all-in–all-out management system was applied at the pen/room level to reduce pathogen carryover and environmental contamination. No additional management interventions were introduced during the experimental period. Experimental protocol design is shown in Figure 1, and composition and nutrient levels in the diets of sows and the pre-starter feed are listed in Tables S1 and S2, respectively. Body weights were recorded during the weaning period. Diarrhea was observed every day; the diarrhea rate was calculated as described previously [14]. The daily weight gain within one week after weaning (g/d) = (D32 weight-D25 weight)/7. Diarrhea rate (%) = Number of diarrhea piglets within 7 days/(number of piglets in the same group × 7) × 100%.
Intestinal samples were collected from six randomly selected piglets from each group on the 32nd day. Briefly, each piglet was euthanized via intraperitoneal injection of sodium pentobarbital and then exsanguinated [15]. Subsequently, the mid-jejunum segments were dissected and rinsed with sterilized saline, and then the scraped mucosae were put in liquid nitrogen at once and stored at −80 °C for further analysis. Meanwhile, the pH values of the stomach contents were measured by the pH meter (PHS-3CB, Shanghai Yueping Scientific Instrument Co., Ltd., Shanghai, China).

2.3. H&E Staining

After fixed in 4% paraformaldehyde, jejunum tissues were then dehydrated, paraffin-embedded, sectioned (6 μm thick), stained with hematoxylin and eosin (H & E), and sealed. Finally, images were captured using an Olympus microsystem (Tokyo, Japan) to measure the villus height and crypt depth of piglets. Villus height was measured from the villus tip to the crypt mouth, and the crypt depth was measured from the crypt mouth to the top of the crypt valley [16].

2.4. ELISA

The jejunal mucosa samples were homogenized with ice-cold sterile saline solution (1:2, w/v) and then centrifuged at 3000× g for 15 min at 4 °C. Supernatants were collected for the determination of the concentrations of interleukin-1β (IL-1β), IL-6, tumor necrosis factor-α (TNF-α) and interferon-γ (IFN-γ) by porcine enzyme-linked immunosorbent assay kit (ELISA kit; R&D Systems, Inc., Minneapolis, MN, USA) as per the manufacturer’s instructions.

2.5. DAO Analysis

Serumwas collected for the determination of the activity of diamine oxidase (DAO) according to the manufacturer’s instructions (Nanjing Jiancheng Biotechnology Research Institute, Nanjing, China).

2.6. RNA Extraction and RT-qPCR

Total RNA was extracted from jejunum and organoid tissues using TRIZOL reagent (TaKaRa, Kyoto, Japan). RNA purity and integrity were assessed by spectrophotometry (SpectraMax M5, Molecular Devices, CA USA), with A260/A280 ratios maintained at 1.8–2.0. cDNA synthesis employed the PrimeScript II 1st Strand cDNA Synthesis Kit (Vazyme, Nanjing, China). For RT-qPCR analysis, reactions were run in triplicate on 96-well plates, using the StepOne Plus Real-Time PCR System (Applied Biosystems, Carlsbad, CA, USA) and the HiScript II One Step RT-qPCR SYBR Green Kit (Vazyme, Nanjing, China). Primers designed via NCBI Primer-Blast are listed in Table 1. Gene expression was normalized to β-actin and quantified using the 2−ΔΔCt method.

2.7. Intestinal Microbial DNA Extraction and High-Throughput Sequencing

Using the TIANamp Stool DNA Kit (Tiangen, Beijing, China), microbial genomic DNA was extracted from the colon contents of piglets. The V3 to V4 region of the 16S rRNA gene was amplified using the 341F/805R primer pairs, and sequencing was performed on an Illumina MiSeq platform (Illumina Inc., San Diego, CA, USA). The QIIME program (version 1.9.1) clustered input sequences with 97% similarity into operational taxonomy units (OTUs). Alpha diversity, containing Shannon, Simpson, Ace, and Chao were calculated to reflect the bacterial diversity and richness. On unweighted UniFrac, OTU-level beta diversity was calculated. Utilize UniFrac-based principal coordinate analysis (PCoA) to acquire principal coordinates and display complex data. Using Partial Least-Squares Discriminant Analysis (PLSDA), differences in community structure between samples were calculated. The relative abundance of significant differences at the phylum, genus, and OTU levels was calculated.

2.8. Untargeted Metabolomic Analysis

Serum samples (~100 μL) underwent processing per established methods [17]: mixed with 400 μL 80% methanol in EP tubes, vortexed, and centrifuged (4 °C, 15,000× g, 20 min). Untargeted metabolomic analysis was performed using an ultra-high-performance liquid chromatography system coupled to a high-resolution mass spectrometer. Chromatographic separation was achieved on a reversed-phase C18 column maintained at 40 °C. The mobile phases consisted of solvent A (water with 0.1% formic acid) and solvent B (acetonitrile with 0.1% formic acid). A gradient elution program was applied as follows: 0–2 min, 5% B; 2–12 min, linear increase to 95% B; 12–14 min, maintained at 95% B; 14–14.5 min, returned to 5% B; followed by a 5 min re-equilibration at 5% B prior to the next injection. The flow rate was set at 0.3 mL/min, and the injection volume was 20 µL. Mass spectrometry was performed in both positive and negative electrospray ionization modes under standard source conditions.

2.9. RNA-seq and Analysis

Total RNA was extracted from jejunum tissues with TRIzol reagent (Invitrogen) following the manufacturer’s instructions. RNA sequencing was outsourced to Genomics Co., Ltd. (Illumina HiSeq 2000 platform). Transcript quantification used Cufflinks v2.2.1 for Fragments Per Kilobase Million (FPKM) calculation, with CuffDiff-based differential expression analysis (p < 0.01, fold-change > 2). Gene expression ratios employed FPKM+1 normalization to avoid infinite value artifacts. Functional annotation via DAVID v6.8 included KEGG pathway enrichment.

2.10. Western Blotting

Jejunum tissue lysates prepared with RIPA buffer underwent BCA protein quantification (Sigma, Saint Louis, MO, USA). Equal protein concentrations were separated via 12% SDS-PAGE and electrotransferred onto PVDF membranes (Millipore, MA, USA). Membranes were blocked with 5% skim milk (2 h, 26 °C) and subsequently incubated with primary antibodies overnight at 4 °C against PI3K, AKT1/2/3, and β-actin (Cell Signaling Technology, MA, USA). After five TBST washes, HRP-conjugated secondary antibodies were applied (2 h, 26 °C). Protein bands were visualized using a Millipore chemiluminescent HRP substrate kit (MA, USA), imaged on a Tanon system (Shanghai, China). Band intensities quantified by ImageJ software normalized protein levels to β-actin.

2.11. Crypt Isolation and Intestinal Organoid Culture

Small intestines were dissected and chopped into pieces, then washed twenty times with DPBS until the supernatant was clear. The pieces were incubated for 30 min on ice in DPBS containing 2.5 mM EDTA. The crypt fractions were then separated by centrifugation at 290× g for 5 min, after the combination of intestinal pieces was vortexed and passed through a 70 µm cell strainer. To eliminate single cells, the resulting crude crypts were obtained at 200× g for 3 min. The crypts were then plated on 24-well plates with equal amounts of Matrigel (BD Bioscience/Corning, New York, NY, USA) and IntestiCultTM Organoid Growth Medium (Stemcell Technologies, Vancouver, BC, Canada). The culture plate was placed in an incubator at 37 °C in a 5% CO2 atmosphere for 15 min. After Matrigel had solidified, IntestiCultTM Organoid Growth Medium was applied. The following is a thorough explanation of the processes involved in organoid passaging. Before adding 1 mL of cold PBS to each well and putting the plate on ice to defrost the medium, the medium was aspirated. Pipetting was repeated until the cells were completely free of Matrigel clumps. After centrifuging the organoids at 290× g for 5 min at 4 °C, the PBS was discarded. The organoids were resuspended in an equal volume of Matrigel/medium, washed with DMEM/F12 (HyClone, Logan, UT, USA), clarified by centrifugation at 200× g for 3 min, and then resuspended. After incubating the organoid mixture at 37 °Cuntil the Matrigel polymerized, 50 μL was plated into each well of a 24-well plate and then covered with IntestiCultTM Organoid Growth Medium. Isolated intestinal crypts were cultivated in Matrigel, similar to prior work, with one small alteration made specifically for coculture investigations [18].
The organoids were measured according to a previous description [19]. Briefly, several distinct and unrelated areas were selected from each well using light microscopy. The area of the organoids was measured manually using ImageJ software (V1.8.0, NIH, Bethesda, MD, USA) after calibrating the scale bar. Throughout the counting process, organoids in contact with the edges of the image were excluded. In addition, developmental efficiency was evaluated by manually counting the total number of organoids per graph and the number of organoid buds.

2.12. Statistical Analysis

All statistical analyses were performed using SPSS version 20.0 (IBM, NYC, USA). Data are presented as mean ± standard deviation (SD), unless otherwise stated. Prior to statistical testing, data distributions were assessed for normality using the Shapiro–Wilk test, and homogeneity of variances was evaluated using Levene’s test. For normally distributed data with homogeneous variances, comparisons among multiple groups were performed using one-way or two-way analysis of variance (ANOVA), as appropriate, followed by Tukey’s post hoc test. When data did not meet the assumptions of normality or homoscedasticity, non-parametric tests were applied. Multivariate analyses of metabolomic and microbiota datasets were conducted using principal component analysis (PCA) and partial least squares discriminant analysis (PLS-DA) with appropriate scaling methods. Model robustness was evaluated using permutation testing and cross-validation where applicable. Correlation analyses between microbial taxa, metabolites, and host parameters were performed using Spearman’s rank correlation coefficients. Correlation results were visualized using heatmaps, and statistical significance was determined with correction for multiple testing using the false discovery rate (FDR) method. Data expressed as mean ± SEM; p < 0.05 considered significant. Graphs generated in GraphPad Prism 8.4.2.

3. Results

3.1. Dietary L. Rhamnosus Decreased the Diarrhea Rate, Improved Jejunal Barrier Function, and Morphology of Post-Weaning Piglets

Compared with the CON group, supplementation with 1 × 108 CFU/kg LGG in the diets significantly (p < 0.05) decreased the diarrhea rate of weaned piglets. There were no significant differences (p > 0.05) between the two groups in daily weight gain (Figure 2A,B). Furthermore, we also found that L. rhamnosus significantly increased (p < 0.05) the intestinal villus height and villus height to crypt depth ratio, while significantly decreasing (p < 0.05) the crypt depth of post-weaning piglets (Figure 2C,D). In addition, we found that L. rhamnosus remarkably (p < 0.05) declined the activities of DAO, and concentration of TNF-α, IL-1β, IL-6, and IFN-γ (Figure 2E,F).

3.2. Colon Bacterial Analysis

3.2.1. Microbiota Diversity in Intestinal Contents

Venn chart indicated that the LGG group comprised 1130 distinct OTUs (Figure 3A–C). In addition, the PCoA and NMDS plots of colon microbiota (Figure 3D,E) confirmed that there were significant changes in the microbial communities among all groups. Alpha diversity analysis (Figure 3F) demonstrated that the LGG stimulation decreased the alpha diversity index (Feature, ACE, Chao1, and Shannon). This finding demonstrated that LGG affected the enteric microorganism community structure within the colon.

3.2.2. Cluster Analysis

LEfSe analysis and LDA score at the species level identified differential biomarkers. Among them, LGG not only upregulated the relative abundance of Bifidobacterium, Helicobacter, Mucispirillum, and Dorea, but also downregulated the levels of Desulfovibrio, Escherichia-Shigella, and Ileibacterium (Figure 4A,C).

3.3. LGG Modulated Colon Content Metabolic Profiles in Post-Weaning Piglets

Next, we analyzed LGG-induced changes in the metabolites of colon content. We performed LC–MS to compare colon content metabolite changes among the CON and LGG pigletgroups. This was performed to obtain a better understanding of the alterations that occur in the colon content of post-weaning piglets. PCA and PLS-DA score plots showed that colon content metabolome clustered separately (p < 0.05) among three groups, and volcano plots further revealed the significantly (p < 0.05) different metabolites between groups (Figure 5A,B). As demonstrated in Figure 5C,D, the levels of Tryptamine, 9-Hydroxyoctadecan, Hydrocortisone, Polyporusterone B, and Sarmentoic acid in LGG group were much higher (p < 0.05) than those in CON group.
The discovered biomarkers were subjected to pathway analysis using MetaboAnalyst (Figure 6). Metabolic network pathways represent the KEGG database, which is utilized to annotate potential biomarkers, identify the metabolic pathways associated with them, and establish potential relationships among them. As shown in Figure 6A,B, the results indicated that these biomarkers affected multiple metabolic pathways, including Biosynthesis of unsaturated fatty acids, Porphyrin metabolism, Glycerophospholipid metabolism, Linoleic acid metabolism, and Sphingolipid metabolism. The intensity of Biosynthesis of unsaturated fatty acids-related substances (palmityl trifluoromethyl ketone, cis-9,10-epoxystearic acid, linoleic acid, stearic acid, arachidic acid, and linoleic acid amide) in the LGG group was significantly higher than that in the CON group (Figure 6D). These results suggested that LGG had the potential to alleviate post weaning-induced intestinal injury by regulating the biosynthesis of unsaturated fatty acids. The analysis results of the correlation between gut microbiota and metabolites indicated that the relative abundance of Escherichia, Shigella, and Fusobacterium was positively correlated with content of cis-9,10-Epoxystranic Acid. In addition, we also found that Acidaminococcus, Phascolarctobacterium, Olsenella, and Ruminococcus were positively correlated with Linoleic acid, Stearic acid, 12-hydroxystearic acid, Conjugated linoleic acids (CLA), and negatively correlated with cis-9,10-Epoxystearic Acid (Figure 6E).

3.4. Effects of LGG Treatments on the Jejunum Transcriptome

To better elucidate the molecular underpinnings behind the LGG’s protective benefits in post-weaning, we performed RNA sequencing (RNA-Seq) to identify key pathways involved in its therapeutic action (Figure 7A). The abundance levels of each gene were computed and expressed as FPKM. PCA and PLSDA analysis of the global transcriptomic data indicated that the CON and LGG groups were unique (Figure 7B,C). Venn diagram showed that 10,643 genes overlapped in all groups, while 463 genes appeared in CON group, 1603 genes appeared in LGG groups (Figure 7D,E). Furthermore, we employed a volcano and MA plot to visually represent the quantity of genes that exhibited differential expression between the CON and LGG groups (p < 0.05, fold change > 2). When the CON group was compared to theLGG group (Figure 7F,G), 4329 genes were found to be differentially expressed (2507 up-regulated and 1822 down-regulated).
All DEGs were subjected to KEGG pathway analyses in order to examine their biological functions (Figure 8). For each cluster, KEGG pathway enrichment analysis was conducted in order to identify significant pathways that were disrupted by intestinal injury induced by post-weaning but were subsequently restored by LGG. Based on the differential gene enrichment bubble chart (Figure 8A,B), it was evident that pathways associated with inflammation comprised the majority of the top 20 with the most significant differential gene expression. There were 5 mechanisms directly linked to inflammation, including the PI3K/AKT pathway, NF-κB pathway, cell adhesion molecules pathway, Rap1 pathway, MAPK pathway, and the Hippo signaling pathway. Moreover, the annotation outcomes of the differentially expressed gene KEGG results revealed that the PI3K/AKT signaling pathways contained the differentially expressed genes of the LGG group that were most significantly expressed. The results suggested that LGG supplementation primarily inhibited the PI3K/AKT signaling pathways. We sought to determine whether the therapeutic effect of LGG in post weaning-induced intestinal damage is associated with PI3K/AKT down-regulation, given that the PI3K/AKT pathway was significantly decreased, which was downregulated in the CON group and down-regulated by administration with LGG. Expression changes for genes involved in the PI3K/AKT pathway predominantly shifted toward the LGG group based on RNA-seq analysis (Figure 8C). The protein and gene expression levels of PI3K and AKT1/2/3 were increased (p < 0.05) in post weaning-induced colon tissues as determined by western blot analysis, while supplementation with LGG attenuated these elevated expression levels in the colon tissue of post weaning-challenged piglets (Figure 8D,E).

3.5. Correlation Analysis Between Bacterial Community, Metabolites, and Functional Gene Abundance

To explore the potential interactions between gut microbiota and key colonic genes, we compared the symbiotic networks among relevant bacterial genera, metabolites, and their associations with PI3K/AKT signaling pathway genes (Figure 9). We also analyzed the correlation between the microbial community, serum metabolism, and key genes of the PI3K/AKT/NF-κB signaling pathway. The analysis revealed Fusobacterium, Prevotellaceae NK3B31 group, and Escherichia Shigella were significantly negatively correlated with PI3K/AKT pathway-related genes. Olsenella, Mitsuokella, Acidaminococcus, and Phascolarctobacterium significantly positively correlated with PI3K/AKT pathway-related genes (Figure 9A). In addition, we also found that 12-hydroxystearic acid, conjugated linoleic acids (CLA), Linoleic acid, Linoleic acid amide, and Palmityl Trifluoromethyl Ketone were negatively correlated with PI3K/AKT pathway-related genes. While cis-9,10-Epoxystearic Acid and Arachidic acid were positively correlated with PI3K/AKT pathway-related genes (Figure 9B). Overall, these findings highlight the intricate and differential relationships between specific bacterial genera and key colonic genes involved in the PI3K/AKT signaling pathway, suggesting that gut microbiota and its metabolisms may play a significant role in modulating these molecular mechanisms.

3.6. LGG Accelerates Intestinal Cells Proliferation in TNF-α-Challenged Organoid

In the previous experiments, we found that LGG reduced the intestinal barrier dysfunction and inflammatory response in post weaning piglets. To determine whether LGG directly reduced post-weaning induced inflammatory response and barrier dysfunction, we cocultured LGG with intestinal organoids (Figure 10A). After continuous administration of TNF-α (100 ng/mL) for 24 h, the area of the organoids decreased significantly (p < 0.05) compared to the control group. However, pretreatment with LGG reversed this trend (Figure 10B,C). In addition, LGG pretreatment also significantly (p < 0.05) increased the PCNA and C-myc gene expression in TNF-α challenge intestinal organoid (Figure 10D).

3.7. LGG Inhibited Apoptosis and the PI3K/AKT Signaling Pathway in TNF-α-Challenged Organoid

The results of the cell flow experiments proved that LGG significantly (p < 0.05) decreased the organoid apoptosis induced by TNF-α (Figure 11A). Furthermore, qPCR results demonstrated that TNF-α significantly (p < 0.05) increased the mRNA expression of Pik3ca, Pik3cd, Pik3r1, and Akt1 compared with CON group, while LGG pretreatment reversed this tendency (Figure 11B). Western blot results also demonstrated that TNF-α challenge significantly (p < 0.05) increased the protein expression of PI3K, while LGG pretreatment restored the PI3K protein expression after TNF-α-induced organoid damage (Figure 11C).

4. Discussion

Weaning is one of the most stressful challenges to piglets, and it is well known that early weaning-induced stress may result in diarrhea and intestinal microbiota disturbances because of changes in gut environment and morphology [20]. The weight gain during feeding trials is a commonly used parameter to evaluate the beneficial health effects of bacterial feed supplements, and some studies demonstrated that probiotics supplementation could improve growth performance and decrease the incidence of diarrhea in weaning piglets by promoting gut health [11,21,22,23]. However, in the current study, oral administration of L. rhamnosus GG to newborn piglets showed a potential role in improving the growth performance of the post-weaning piglets, which was consistent with some earlier studies [24,25,26]. These differences might be correlated with some factors such as the health status and age of the host, environmental stress, and the length of the feeding trial. We surmise that the possible reason for the result in our study was that the beneficial effect of LGG on weaning piglets was partly neutralized by weaning stress.
The development of the integrity of intestinal villi can directly reflect the health status of the intestine [27]. The results of this study showed that oral administration of L. rhamnosus GG in the early life of newborn piglets improved the integrity of intestinal villi in post-weaning piglets, promoting the development of intestinal health. An impaired intestinal barrier is a major cause of diarrhea in piglets after weaning [28]. When intestinal epithelial cells and barriers are damaged, DAO will be released into the blood. The present study showed that piglets administered with L. rhamnosus had much lower DAO activity, indicating that L. rhamnosus was beneficial to reduce intestinal permeability, contributing to building a much better state of intestinal integrity [28,29]. Moreover, the gastrointestinal (GI) tract is one of the most important immune organs in the host [30]. Under normal conditions, intestinal pro-inflammatory and anti-inflammatory cytokines are normally in equilibrium to maintain the health of host [31]. Therefore, under weaning-induced stress, the downregulation of pro-inflammatory cytokines can reduce the occurrence and development of intestinal diseases [32]. Geng et al. [33] found that co-administration of L. rhamnosus GG (ATCC53103) and L. plantarum JL01 increased the transcription of IL-10 and TGF-β1, decreased the secretion of IL-1β, IFN-γ, IL-6, and TNF-α, and finally increased the growth performance of weaned piglets, which aligns with our results. Overall, our results indicated that oral administration of L. rhamnosus in the early life of newborn piglets improved the intestinal health by enhancing the immune response of post-weaning piglets.
Microbiota, existing in the gastrointestinal tract, plays an essential role in promoting the health of animals, as it has evolutionarily conserved roles in the metabolism, immunity, and development of the host [1]. The intestinal microbiota consists of over 1000 different species and constitutes a complex microbial ecosystem, which acts as a pivotal part in multiple physiologic processes [34]. Probiotics contribute to the healthy growth of animals by regulating intestinal microbiota effectively. In the present study, the observed increase in alpha diversity following LGG supplementation did not represent a general loss of microbial richness. Importantly, LGG treatment was accompanied by a restructuring of the microbial community toward a composition enriched in taxa associated with barrier protection and beneficial metabolic functions, including butyrate-related pathways. Therefore, the biological relevance of the observed diversity change lies not in the numerical reduction of alpha diversity per se, but in the qualitative and functional reorganization of the microbial ecosystem. The phylum Firmicutes is the dominant microbiota in the gut [35], which plays an important part in host health [36]. It is well known that several members of Firmicutes, such as Clostridium and Ruminococcus, can produce short-chain fatty acids (SCFAs), which play key roles in inhibiting opportunistic pathogens, modulating intestinal motility, and protecting the host against excessive intestinal inflammation, and further regulate systemic immune responses [37,38]. Furthermore, some evidence suggested that the decreased abundance of Clostridiaceae and Ruminococcaceae could reduce the ability of digestion and absorption of carbohydrates and metabolism of the intestinal tract in diarrheic piglets and led to intestinal inflammation and diarrhea [37,39]. Enrichment of Bacteroides is involved in colonic mucosal inflammation, which can trigger colitis upon disruption of the barrier function of colonic epithelial cells [40,41]. Prevotella species (of the Bacteroidetes phylum) are anaerobic Gram-negative bacteria [42] and play essential roles in restraining sudden diarrhea [43]. In this study, we observed that L. rhamnosus increased the alpha diversity of intestinal microbiota and the relative abundance of Firmicutes, Bifidobacterium, Helicobacter, Mucispirillum, and Dorea of post-weaning piglets, decreased the abundance of Desulfovibrio, Escherichia-Shigella, and Ileibacterium, which was similar to the previous study of Angelakis and Raoult [44]. It should be noted that the functional interpretation of specific microbial taxa requires careful contextualization. Certain genera identified in this study, including Helicobacter and Mucispirillum, have been reported to exert diverse and context-dependent effects on host physiology. While these taxa are often associated with mucosal inflammation or disease under specific conditions, emerging evidence suggests that some members may also participate in mucosal immune modulation or niche-specific colonization without necessarily inducing pathology. Thus, we suggested that oral administration of L. rhamnosus in early life contributed to piglets’ health via regulating the bacterial composition, especially the abundance of Firmicutes and Fusobacteria. In the current study, Administration of L. rhamnosus increased the interaction among the intestinal microbes, indicated by the increased values of nodes, edges, average degree, and modularity, indicating that oral administration of L.rhamnosus increased the abundance of beneficial bacteria. Therefore, we emphasize that functional conclusions in this study are primarily supported by integrated microbial composition, metabolic, and host-response data, rather than by the classification of individual taxa as universally beneficial or harmful.
Metabolomics is a common method to reveal the interaction between host and gut microbiota under disease conditions or different living environments [45,46]. Weaning stress is a critical period in pig production, characterized by intestinal dysfunction, immune activation, and growth performance [47]. Our results indicated that biomarkers affected multiple metabolic pathways, including Biosynthesis of unsaturated fatty acids, Porphyrin metabolism, Glycerophospholipid metabolism, Linoleic acid metabolism, and Sphingolipid metabolism. We found that the intensity of Biosynthesis of unsaturated fatty acids-related substances, including linoleic acid (LA), α-linolenic acid (ALA), and their elongated/desaturated products like arachidonic acid (AA) and eicosapentaenoic acid (EPA), modulates gut homeostasis and inflammatory processes in post-weaning induced intestinal injury. The incorporation of LA, ALA, and other UFAs into enterocyte membranes enhances membrane fluidity and integrity. This is particularly crucial during weaning, when the gut barrier is compromised. The changes in gut microbial metabolites were led by gut microbial alterations [48]. 16S rRNA sequencing and metabolomic analyses revealed a significant correlation between the abundance of specific beneficial bacteria, such as Lactobacillus and Faecalibacterium, and the levels of key unsaturated fatty acids (UFAs), including linoleic acid (LA), α-linolenic acid (ALA), and their elongated/desaturated products like arachidonic acid (AA) and eicosapentaenoic acid (EPA). Overall, our findings suggest that LGG can increase beneficial bacteria and inhibit the growth of harmful bacteria by regulating the balance of the gut microbiota, thereby promoting the production of metabolites associated with the biosynthesis of unsaturated fatty acids and alleviating post-weaning-induced intestinal barrier dysfunction.
Understanding how LGG regulates niche signaling pathways under inflammatory conditions may provide new insights into the treatment of post weaning induce intestine injury. The results of RNA sequencing and KEGG analysis suggested that LGG might regulate inflammatory response through PI3K/AKT signaling pathway. Related studies have proven that PI3K/AKT signaling plays an essential role in recovering from inflammatory response and intestinal injury [49,50]. In this study, we found that PI3K/AKT signal pathway-related genes were significantly suppressed in the jejunum of post weaning piglets or TNF-α-challenge organoids by LGG supplementation, which might partly explain the molecular mechanism of the barrier-protective effects exerted by LGG. Previous studies have confirmed that adverse factors, such as deoxynivalenol, heat-stable enterotoxin, and heat exposure, can downregulate the canonical PI3K/AKT signaling pathway and porcine expansion [51,52]. Therefore, we speculated that LGG regulated the inflammatory response to enhanced intestinal physical barrier by inhibiting PI3K/AKT pathway.
The correlation analyses reveal that beneficial gut bacteria negatively associate with the expression of PI3K/AKT pathway. A comparative analysis of the top 30 most abundant microbial genera demonstrated strong positive correlations among beneficial bacterial genera, while potentially pathogens (Bacteroides and Escherichia Shigella) exhibited strong negative correlations. Aligning with previous reports, probiotic microbes competitively exclude pathogenic bacteria [53]. Specifically, our results showed that Bacteroides abundance positively correlated with pro-inflammatory pathway activation. Conversely, Lactobacillus was negatively associated with these pathways. Importantly, Lactobacillus strongly correlated with ATM, a negative regulator of PI3K/AKT signaling. Diet and exogenous substrates play a crucial role in regulating the gut microbiota. They interact dynamically with the microbiome, influencing mucosal and systemic immunity, thereby modulating inflammation and host health [54,55]. In the present study, the observed associations between microbial compositional shifts, altered metabolite levels, and changes in host inflammatory and barrier-related gene expression primarily serve to highlight coordinated patterns and potential mechanistic axes, rather than to demonstrate causality. These findings should therefore be viewed as hypothesis-generating. Definitive causal relationships will require targeted functional validation, such as microbial depletion or mono-colonization strategies, direct metabolite supplementation or inhibition, and receptor-level or signaling pathway–specific interventions. By explicitly acknowledging this limitation, we aim to provide a balanced interpretation of the multi-omics data while underscoring the value of integrative analyses in identifying biologically relevant interactions that warrant further mechanistic investigation. To imitate the morphological properties of intestinal mucosa in vivo, the co-culture model of intestinal organoids was created, concentrating on LGG’s impact on intestinal epithelial barrier. When cocultured with LGG, intestinal organoids developed well under physiological circumstances, and under a light microscope, clear stimulatory effects were seen on the organoid surfaces. Increased C-myc and PCNA mRNA expression in organoids further suggested that LGG promoted intestinal epithelial proliferation under TNF-α-induced damaged epithelia under pathological circumstances. Through enhanced gene expression of Pik3ca, Pik3cd, Pik3r1, and Akt1, and protein expression of PI3K in this investigation, we also discovered that LGG has the capacity to inhibit the PI3K/AKT signal pathway and therefore boost cell proliferation. Our findings show that LGG has a therapeutic function in alleviating post weaning or TNF-α induced intestinal colitis in piglets by inhibiting PI3K/AKT signal pathway. Accordingly, we emphasize that the link between microbiota-derived metabolites and PI3K/AKT signaling in this study is hypothesis-generating and correlative, rather than causal. Future studies employing targeted pathway manipulation, metabolite supplementation, or receptor-specific inhibition will be required to determine whether PI3K/AKT signaling plays a direct mechanistic role in mediating microbiota-driven intestinal protection.
Several limitations of the present study should be acknowledged. First, although Lactobacillus rhamnosus GG supplementation was associated with improved intestinal barrier integrity and reduced inflammation, the study design was primarily associative, and direct causal mechanisms linking specific microbial taxa or metabolites to the observed protective effects were not fully elucidated. Second, the intervention was administered prior to or during post-weaning stress, which reflects a preventive rather than a strictly therapeutic model, and thus the efficacy of LGG in reversing established intestinal injury remains to be determined. Finally, the present study focused mainly on intestinal outcomes, and potential systemic or long-term effects of LGG supplementation were not explored. Future studies incorporating mechanistic interventions, post-injury treatment models, and multi-organ analyses will be required to further define the therapeutic potential and translational relevance of LGG in weaning-associated intestinal dysfunction.

5. Conclusions

In conclusion, Lactobacillus rhamnosus GG supplementation mitigates post-weaning stress–associated intestinal barrier damage and inflammation in piglets, primarily through modulation of gut microbial composition and metabolic profiles linked to epithelial integrity. The observed protective effects are accompanied by enrichment of beneficial bacterial taxa and alterations in lipid-associated metabolic pathways, consistent with improved intestinal health. Importantly, the present findings support a microbiota-centered, barrier-protective role for LGG under weaning stress conditions, without implying equivalence to antibiotic growth promoters or invoking unverified metabolic mechanisms. Together, this study highlights the potential of LGG as a nutritional strategy to support intestinal homeostasis during the critical post-weaning period.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/microorganisms14020410/s1, Table S1: Composition and Nutrient levels of sows diet.; Table S2: Composition and Nutrient levels of starting diet of piglets; Table S3: Composition of qRT-PCR system; Table S4: Program settings of qRT-PCR; Table S5: Sequences of the oligonucleotide primers used for quantitative real-time PCR.

Author Contributions

Conceptualization, G.H., H.D., L.Z., Y.L., W.L. (Weiqin Li), W.L. (Weifen Li) and Q.W.; Methodology, G.H., H.D., L.Z., Y.L., W.L. (Weiqin Li), W.L. (Weifen Li) and Q.W.; Software, G.H., H.D., L.Z., Y.L., W.L. (Weiqin Li), W.L. (Weifen Li) and Q.W.; Validation, G.H., Y.L., W.L. (Weiqin Li) and Q.W.; Formal analysis, G.H., H.D., L.Z., W.L. (Weiqin Li) and Q.W.; Investigation, H.D., L.Z., Y.L. and W.L. (Weiqin Li); Resources, Y.L. and W.L. (Weiqin Li); Data curation, G.H., H.D., Y.L. and W.L. (Weifen Li); Writing—original draft, G.H., H.D., W.L. (Weifen Li) and Q.W.; Writing—review & editing, G.H., H.D., W.L. (Weifen Li) and Q.W.; Visualization, L.Z., Y.L., W.L. (Weiqin Li) and Q.W.; Project administration, W.L. (Weifen Li); Funding acquisition, W.L. (Weifen Li). All authors have read and agreed to the published version of the manuscript.

Funding

This study is supported by the National Natural Science Foundation of China (No.32072766).

Institutional Review Board Statement

The animal experiments in this study were allowed by Laboratory Animal Welfare and Ethics Committee of Zhejiang University (Ethical Code License No. ZJU 17471), 2024-03-15.

Informed Consent Statement

Not applicable.

Data Availability Statement

The authors confirm that the data supporting the findings of this study are available within the article.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Han, X.B.; Hu, X.D.; Jin, W.; Liu, G. Dietary nutrition, intestinal microbiota dysbiosis and post-weaning diarrhea in piglets. Anim. Nutr. 2024, 17, 188–207. [Google Scholar] [CrossRef] [PubMed]
  2. Lu, X.; Zhang, M.; Zhao, L.; Ge, K.; Wang, Z.; Jun, L.; Ren, F. Growth Performance and Post-Weaning Diarrhea in Piglets Fed a Diet Supplemented with Probiotic Complexes. J. Microbiol. Biotechnol. 2018, 28, 1791–1799. [Google Scholar] [CrossRef]
  3. Dou, S.; Gadonna-Widehem, P.; Rome, V.; Hamoudi, D.; Rhazi, L.; Lakhal, L.; Larcher, T.; Bahi-Jaber, N.; Pinon-Quintana, A.; Guyonvarch, A.; et al. Characterisation of Early-Life Fecal Microbiota in Susceptible and Healthy Pigs to Post-Weaning Diarrhoea. PLoS ONE 2017, 12, e0169851. [Google Scholar] [CrossRef] [PubMed]
  4. Liu, M.Q.; Ma, J.X.; Xu, J.Y.; Huangfu, W.K.; Zhang, Y.; Ali, Q.; Liu, B.S.; Li, D.F.; Cui, Y.L.; Wang, Z.C.; et al. Fecal microbiota transplantation alleviates intestinal inflammatory diarrhea caused by oxidative stress and pyroptosis via reducing gut microbiota-derived lipopolysaccharides. Int. J. Biol. Macromol. 2024, 261, 129696. [Google Scholar] [CrossRef] [PubMed]
  5. Hermann-Bank, M.L.; Skovgaard, K.; Stockmarr, A.; Strube, M.L.; Boye, M. Characterization of the bacterial gut microbiota of piglets suffering from new neonatal porcine diarrhoea. BMC Vet. Res. 2015, 11, 139. [Google Scholar] [CrossRef] [PubMed]
  6. Liu, Y.; Cao, L.; Yu, C.H.; Zhou, Q.; Li, H.; Zhang, R.A.; Tang, J.Y.; Zhang, Z.M.; Luo, Z.; Jiang, X.M.; et al. Dietary supplementation with Bacillus subtilis PB6 alleviates diarrhea and improves growth performance and immune function in weaned piglets fed a high-protein diet. Front. Vet. Sci. 2025, 12, 1525354. [Google Scholar] [CrossRef]
  7. Shin, I.; Kang, Y.; Ahn, J.; Kim, Y.; Nam, J.; Kim, K.; Kim, J.M.; Kim, H.W.; Yang, J.; Kim, Y.; et al. The potential probiotic role of Lacticaseibacillus rhamnosus on growth performance, gut health, and immune responses of weaned pigs. J. Anim. Sci. 2025, 103, skaf089. [Google Scholar] [CrossRef]
  8. Xu, Z.Y.; Zhang, Q.; Wu, M.J.; Zhang, Y.Y.; Li, Z.H.; Li, H.X.; Yu, C.M.; Zhang, X.H.; Zhao, D.; Wang, L.; et al. Lactobacillus rhamnosus GG powder supplementation alleviates intestinal injury in piglets challenged by porcine epidemic diarrhea virus. Front. Cell. Infect. Microbiol. 2024, 14, 1371916. [Google Scholar] [CrossRef]
  9. Mao, J.; Qi, S.; Cui, Y.; Dou, X.; Luo, X.M.; Liu, J.; Zhu, T.; Ma, Y.; Wang, H. Lactobacillus rhamnosus GG Attenuates Lipopolysaccharide-Induced Inflammation and Barrier Dysfunction by Regulating MAPK/NF-κB Signaling and Modulating Metabolome in the Piglet Intestine. J. Nutr. 2020, 150, 1313–1323. [Google Scholar] [CrossRef]
  10. Splichalova, A.; Jenistova, V.; Splichalova, Z.; Splichal, I. Colonization of preterm gnotobiotic piglets with probiotic Lactobacillus rhamnosus GG and its interference with Salmonella Typhimurium. Clin. Exp. Immunol. 2019, 195, 381–394. [Google Scholar] [CrossRef]
  11. Yang, G.Y.; Yu, J.; Su, J.H.; Jiao, L.G.; Liu, X.; Zhu, Y.H. Oral Administration of Lactobacillus rhamnosus GG Ameliorates Salmonella Infantis-Induced Inflammation in a Pig Model via Activation of the IL-22BP/IL-22/STAT3 Pathway. Front. Cell. Infect. Microbiol. 2017, 7, 323. [Google Scholar] [CrossRef] [PubMed]
  12. Sun, J.X.; Borowska, D.; Furniss, J.J.; Sutton, K.; Macqueen, D.J.; Vervelde, L. Cellular landscape of avian intestinal organoids revealed by single cell transcriptomics. Sci. Rep. 2025, 15, 11362. [Google Scholar] [CrossRef] [PubMed]
  13. Jiang, S.; Yang, Z.B.; Huang, L.B.; Yang, W.R.; Song, D.P.; Liu, F.X.; Ge, J.S.; Wang, Y.X.; Jiang, S.Z. Effect ofIllicium verumorEucommia ulmoidesleaf extracts on the anti-stress ability, and mRNA and protein expression ofNrf2andTNF-αin Duroc x Landrace x Yorkshire and Chinese native Licha-blacknurserypiglets. J. Anim. Physiol. Anim. Nutr. 2020, 104, 1085–1095. [Google Scholar] [CrossRef] [PubMed]
  14. Xie, Q.; Xiuye, Q.I.; Chen, Z.; Jiamin, Y.U.; Haiyan, X.U.; Wei, G.U. Effects of Compound Probiotics on Growth Performance, Diarrhea Rate, Immunity Performance and Intestinal Microflora of Weaned Piglets. Chin. J. Anim. Nutr. 2017, 29, 850–858. [Google Scholar]
  15. Hayakawa, T.; Masuda, T.; Kurosawa, D.; Tsukahara, T. Dietary administration of probiotics to sows and/or their neonates improves the reproductive performance, incidence of post-weaning diarrhea and histopathological parameters in the intestine of weaned piglets. Anim. Ence J. 2016, 87, 1501–1510. [Google Scholar] [CrossRef]
  16. Casas, G.A.; Laia, B.; Cross, T.L.; Lee, A.H.; Swanson, K.S.; Stein, H.H. Inclusion of the direct-fed microbial Clostridium butyricum in diets for weanling pigs increases growth performance and tends to increase villus height and crypt depth, but does not change intestinal microbial abundance. J. Anim. Sci. 2019, 98, skz372. [Google Scholar] [CrossRef]
  17. Rakusanova, S.; Cajka, T. Tips and tricks for LC-MS-based metabolomics and lipidomics analysis. Trac-Trends Anal. Chem. 2024, 180, 117940. [Google Scholar] [CrossRef]
  18. Wu, H.; Xie, S.; Miao, J.; Li, Y.; Wang, Z.; Wang, M.; Yu, Q. Lactobacillus reuteri maintains intestinal epithelial regeneration and repairs damaged intestinal mucosa. Gut Microbes 2020, 11, 997–1014. [Google Scholar] [CrossRef]
  19. Sato, T.; Vries, R.G.; Snippert, H.J.; van de Wetering, M.; Barker, N.; Stange, D.E.; van Es, J.H.; Abo, A.; Kujala, P.; Peters, P.J.; et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature 2009, 459, 262–265. [Google Scholar] [CrossRef]
  20. Hu, Y.; Dun, Y.; Li, S.; Zhao, S.; Peng, N.; Liang, Y. Effects of Bacillus subtilis KN-42 on Growth Performance, Diarrhea and Faecal Bacterial Flora of Weaned Piglets. Asian-Australas. J. Anim. Sci. 2014, 27, 1131–1140. [Google Scholar] [CrossRef]
  21. Hou, Q.; Jia, J.; Lin, J.; Zhu, L.; Xie, S.; Yu, Q.; Li, Y. Bacillus subtilis programs the differentiation of intestinal secretory lineages to inhibit Salmonella infection. Cell Rep. 2022, 40, 111416. [Google Scholar] [CrossRef] [PubMed]
  22. Yang, J.; Wang, C.; Huang, K.; Zhang, M.; Pan, X. Compound Lactobacillus sp. administration ameliorates stress and body growth through gut microbiota optimization on weaning piglets. Appl. Microbiol. Biotechnol. 2020, 104, 6749–6765. [Google Scholar] [CrossRef] [PubMed]
  23. Wang, Y.; Gong, L.; Wu, Y.P.; Cui, Z.W.; Wang, Y.Q.; Huang, Y.; Zhang, X.P.; Li, W.F. Oral administration of Lactobacillus rhamnosus GG to newborn piglets augments gut barrier function in pre-weaning piglets. J. Zhejiang Univ. Sci. B 2019, 20, 180–192. [Google Scholar] [CrossRef] [PubMed]
  24. Gebert, S.; Davis, E.; Rehberger, T.; Maxwell, C. Lactobacillus brevis strain 1E1 administered to piglets through milk supplementation prior to weaning maintains intestinal integrity after the weaning event. Benef. Microbes 2011, 2, 35–45. [Google Scholar] [CrossRef]
  25. Lhteinen, T.; Lindholm, A.; Rinttil, T.; Junnikkala, S.; Palva, A. Effect of Lactobacillus brevis ATCC 8287 as a feeding supplement on the performance and immune function of piglets. Vet. Immunol. Immunopathol. 2013, 158, 14–25. [Google Scholar] [CrossRef]
  26. Trevisi, P.; Casini, L.; Coloretti, F.; Mazzoni, M.; Merialdi, G.; Bosi, P. Dietary addition of Lactobacillus rhamnosus GG impairs the health of Escherichia coli F4-challenged piglets. Animal 2011, 5, 1354–1360. [Google Scholar] [CrossRef]
  27. Weiss, G.A.; Hennet, T. Mechanisms and consequences of intestinal dysbiosis. Cell. Mol. Life Ences CMLS 2017, 74, 2959–2977. [Google Scholar] [CrossRef]
  28. Yu, J.; Song, Y.; Yu, B.; He, J.; Zheng, P.; Mao, X.; Huang, Z.; Luo, Y.; Luo, J.; Yan, H.; et al. Tannic acid prevents post-weaning diarrhea by improving intestinal barrier integrity and function in weaned piglets. J. Anim. Sci. Biotechnol. 2020, 11, 87. [Google Scholar] [CrossRef]
  29. Hu, S.; Cao, X.; Wu, Y.; Mei, X.; Xu, H.; Wang, Y.; Zhang, X.; Gong, L.; Li, W. Effects of Probiotic Bacillus as an Alternative of Antibiotics on Digestive Enzymes Activity and Intestinal Integrity of Piglets. Front. Microbiol. 2018, 9, 2427. [Google Scholar] [CrossRef]
  30. Battersby, A.J.; Gibbons, D.L. The gut mucosal immune system in the neonatal period. Pediatr. Allergy Immunol. 2013, 24, 414–421. [Google Scholar] [CrossRef]
  31. Cicchese, J.M.; Evans, S.; Hult, C.; Joslyn, L.R.; Wessler, T.; Millar, J.A.; Marino, S.; Cilfone, N.A.; Mattila, J.T.; Linderman, J.J.; et al. Dynamic balance of pro- and anti-inflammatory signals controls disease and limits pathology. Immunol. Rev. 2018, 285, 147–167. [Google Scholar] [CrossRef]
  32. Li, X.; Hu, D.; Tian, Y.; Song, Y.; Hou, Y.; Sun, L.; Zhang, Y.; Man, C.; Zhang, W.; Jiang, Y. Protective effects of a novel Lactobacillus rhamnosus strain with probiotic characteristics against lipopolysaccharide-induced intestinal inflammation in vitro and in vivo. Food Funct. 2020, 11, 5799–5814. [Google Scholar] [CrossRef]
  33. Geng, T.; He, F.; Su, S.; Sun, K.; Zhao, L.; Zhao, Y.; Bao, N.; Pan, L.; Sun, H. Probiotics Lactobacillus rhamnosus GG ATCC53103 and Lactobacillus plantarum JL01 induce cytokine alterations by the production of TCDA, DHA, and succinic and palmitic acids, and enhance immunity of weaned piglets. Res. Vet. Sci. 2021, 137, 56–67. [Google Scholar] [CrossRef]
  34. Mazmanian, S.K.; Liu, C.H.; Tzianabos, A.O.; Kasper, D.L. An immunomodulatory molecule of symbiotic bacteria directs maturation of the host immune system. Cell 2005, 122, 107–118. [Google Scholar] [CrossRef] [PubMed]
  35. Eckburg, P.B.; Bik, E.M.; Bernstein, C.N.; Purdom, E.; Dethlefsen, L.; Sargent, M.; Gill, S.R.; Nelson, K.E.; Relman, D.A. Diversity of the human intestinal microbial flora. Science 2005, 308, 1635–1638. [Google Scholar] [CrossRef] [PubMed]
  36. Wang, X.F.; Tsai, T.C.; Deng, F.L.; Wei, X.Y.; Chai, J.M.; Knapp, J.; Apple, J.; Maxwell, C.V.; Lee, J.A.; Li, Y.; et al. Longitudinal investigation of the swine gut microbiome from birth to market reveals stage and growth performance associated bacteria. Microbiome 2019, 7, 109. [Google Scholar] [CrossRef] [PubMed]
  37. Lopetuso, L.R.; Scaldaferri, F.; Petito, V.; Gasbarrini, A. Commensal Clostridia: Leading players in the maintenance of gut homeostasis. Gut Pathog. 2013, 5, 23. [Google Scholar] [CrossRef]
  38. Slifierz, M.J.; Friendship, R.M.; Weese, J.S. Longitudinal study of the early-life fecal and nasal microbiotas of the domestic pig. BMC Microbiol. 2015, 15, 184. [Google Scholar] [CrossRef]
  39. Tan, Z.; Yang, T.; Wang, Y.; Xing, K.; Zhang, F.; Zhao, X.; Ao, H.; Chen, S.; Liu, J.; Wang, C. Metagenomic Analysis of Cecal Microbiome Identified Microbiota and Functional Capacities Associated with Feed Efficiency in Landrace Finishing Pigs. Front. Microbiol. 2017, 8, 1546. [Google Scholar] [CrossRef]
  40. Nakanishi, Y.; Sato, T.; Ohteki, T. Commensal Gram-positive bacteria initiates colitis by inducing monocyte/macrophage mobilization. Mucosal Immunol. 2015, 8, 152–160. [Google Scholar] [CrossRef]
  41. Clemente, J.C.; Manasson, J.; Scher, J.U. The role of the gut microbiome in systemic inflammatory disease. BMJ (Clin. Res. Ed.) 2018, 360, j5145. [Google Scholar] [CrossRef] [PubMed]
  42. Larsen, J.M. The immune response to Prevotella bacteria in chronic inflammatory disease. Immunology 2017, 151, 363–374. [Google Scholar] [CrossRef] [PubMed]
  43. Yue, S.J.; Liu, J.; Wang, W.X.; Wang, A.T.; Yang, X.Y.; Guan, H.S.; Wang, C.Y.; Yan, D. Berberine treatment-emergent mild diarrhea associated with gut microbiota dysbiosis. Biomed. Pharmacother. 2019, 116, 109002. [Google Scholar] [CrossRef] [PubMed]
  44. Emmanouil, A.; Didier, R.; Stefan, B. The Increase of Lactobacillus Species in the Gut Flora of Newborn Broiler Chicks and Ducks Is Associated with Weight Gain. PLoS ONE 2010, 5, e10463. [Google Scholar]
  45. Pang, Z.Q.; Xu, L.; Viau, C.; Lu, Y.; Salavati, R.; Basu, N.; Xia, J.G. MetaboAnalystR 4.0: A unified LC-MS workflow for global metabolomics. Nat. Commun. 2024, 15, 3675. [Google Scholar] [CrossRef]
  46. Vila, A.V.; Zhang, J.W.; Liu, M.T.; Faber, K.N.; Weersma, R.K. Untargeted faecal metabolomics for the discovery of biomarkers and treatment targets for inflammatory bowel diseases. Gut 2024, 73, 1909–1920. [Google Scholar] [CrossRef]
  47. Zheng, X.R.; Xu, L.M.; Tang, Q.Q.; Shi, K.P.; Wang, Z.Y.; Shi, L.S.; Ding, Y.Y.; Yin, Z.J.; Zhang, X.D. Integrated Metagenomic and Metabolomics Profiling Reveals Key Gut Microbiota and Metabolites Associated with Weaning Stress in Piglets. Genes 2024, 15, 970. [Google Scholar] [CrossRef]
  48. Jiang, C.S.; Chen, W.Y.; Yang, Y.N.; Li, X.J.; Jin, M.M.; Ghonaim, A.H.; Li, S.H.; Ren, M. Regulation of Isoleucine on Colonic Barrier Function in Rotavirus-Infected Weanling Piglets and Analysis of Gut Microbiota and Metabolomics. Microorganisms 2024, 12, 2396. [Google Scholar] [CrossRef]
  49. Li, Q.F.; Zheng, S.Y.; Niu, K.; Qiao, Y.; Liu, Y.; Zhang, Y.; Li, B.B.; Zheng, C.L.; Yu, B. Paeoniflorin improves ulcerative colitis via regulation of PI3K-AKT based on network pharmacology analysis. Exp. Ther. Med. 2024, 27, 125. [Google Scholar] [CrossRef]
  50. Liu, S.; Yang, D.; Li, W.; Chen, Q.P.; Lu, D.N.; Xiong, L.; Wu, J.J.; Ao, H.; Huang, L.H. Magnolia Officinalis Alcohol Extract Alleviates the Intestinal Injury Induced by Polygala Tenuifolia Through Regulating the PI3K/AKT/NF-κB Signaling Pathway and Intestinal Flora. Drug Des. Dev. Ther. 2024, 18, 1695–1710. [Google Scholar] [CrossRef]
  51. Tang, L.; Ye, Y.; Ji, J.; Wang, J.S.; Huang, Z.; Sun, J.; Sheng, L.; Sun, X. PI3K/Akt/FoxO Pathway Mediates Antagonistic Toxicity in HepG2 Cells Coexposed to Deoxynivalenol and Enniatins. J. Agric. Food Chem. 2024, 72, 8214–8224. [Google Scholar] [CrossRef] [PubMed]
  52. Li, L.; Liu, Z.; Zhao, G.; Quan, J.; Sun, J.; Lu, J. Nano-selenium Antagonizes Heat Stress-Induced Apoptosis of Rainbow Trout (Oncorhynchus mykiss) Hepatocytes by Activating the PI3K/AKT Pathway. Biol. Trace Elem. Res. 2023, 201, 5805–5815. [Google Scholar] [CrossRef] [PubMed]
  53. Do, H.; Li, Z.R.; Tripathi, P.K.; Mitra, S.; Guerra, S.; Dash, A.; Weerasekera, D.; Makthal, N.; Shams, S.; Aggarwal, S.; et al. Engineered probiotic overcomes pathogen defences using signal interference and antibiotic production to treat infection in mice. Nat. Microbiol. 2024, 9, 502–513. [Google Scholar] [CrossRef] [PubMed]
  54. Foppa, C.; Rizkala, T.; Repici, A.; Hassan, C.; Spinelli, A. Microbiota and IBD: Current knowledge and future perspectives. Dig. Liver Dis. 2024, 56, 911–922. [Google Scholar] [CrossRef]
  55. Rygula, I.; Pikiewicz, W.; Kaminiów, K. Impact of Diet and Nutrition in Patients with Acne Vulgaris. Nutrients 2024, 16, 1476. [Google Scholar] [CrossRef]
Microorganisms 14 00410 g001
Figure 1. Experimental protocol design. Control = orally administered with 2 mL of 10% sterile skim milk; L. rhamnosus = orally received 2 mL of 10% sterile skim milk suspended with viable L. rhamnosus (1 × 108 CFU/mL).
Figure 1. Experimental protocol design. Control = orally administered with 2 mL of 10% sterile skim milk; L. rhamnosus = orally received 2 mL of 10% sterile skim milk suspended with viable L. rhamnosus (1 × 108 CFU/mL).
Microorganisms 14 00410 g001
Microorganisms 14 00410 g002
Figure 2. Effect of L. rhamnosus GG on growth performance, jejunum morphology, and biochemical indices in piglets. (A) Daily weight gain. (B) Diarrhea rate. (C,D) Representative images of the jejunum stained with H&E. (E) Serum DAO activity. (F) TNF-α, IL-1β, IL-6 and IFN-γ in serum. Data are presented as means ± SD (n = 6). ** p < 0.01, *** p < 0.001.
Figure 2. Effect of L. rhamnosus GG on growth performance, jejunum morphology, and biochemical indices in piglets. (A) Daily weight gain. (B) Diarrhea rate. (C,D) Representative images of the jejunum stained with H&E. (E) Serum DAO activity. (F) TNF-α, IL-1β, IL-6 and IFN-γ in serum. Data are presented as means ± SD (n = 6). ** p < 0.01, *** p < 0.001.
Microorganisms 14 00410 g002
Microorganisms 14 00410 g003
Figure 3. Effect of Lactobacillus rhamnosus GG on gut microbiota diversities of piglets. (A) Veen diagram. (B) Intra-group Correlation Analysis Chart. (C) Species Cumulative Curve. (D) PCoA of unweighted Unifrac distance, (E) PLSDA of unweighted Unifrac distance. (F): ACE, Chao1, Simpson index, and Shannon index. ** p < 0.01.
Figure 3. Effect of Lactobacillus rhamnosus GG on gut microbiota diversities of piglets. (A) Veen diagram. (B) Intra-group Correlation Analysis Chart. (C) Species Cumulative Curve. (D) PCoA of unweighted Unifrac distance, (E) PLSDA of unweighted Unifrac distance. (F): ACE, Chao1, Simpson index, and Shannon index. ** p < 0.01.
Microorganisms 14 00410 g003
Microorganisms 14 00410 g004
Figure 4. Bacterial taxonomic composition of LGG-treated post-weaning piglets. (A) Relative abundance top 10 phyla. (B) Relative abundance top 30 genera. (C) LEfSe cladogram of the four groups.
Figure 4. Bacterial taxonomic composition of LGG-treated post-weaning piglets. (A) Relative abundance top 10 phyla. (B) Relative abundance top 30 genera. (C) LEfSe cladogram of the four groups.
Microorganisms 14 00410 g004
Microorganisms 14 00410 g005
Figure 5. Effects of dietary supplementation with LGG on colon contents metabolites diversities of post-weaning piglets. (A) Principal analysis (PCA)analysis of weighted UniFrac distance; (B) Partial Least Squares-Discriminant Analysis (PLSDA). (C) Volcano and fold change map between different groups. (D) Heat map and different metabolites in colon content.
Figure 5. Effects of dietary supplementation with LGG on colon contents metabolites diversities of post-weaning piglets. (A) Principal analysis (PCA)analysis of weighted UniFrac distance; (B) Partial Least Squares-Discriminant Analysis (PLSDA). (C) Volcano and fold change map between different groups. (D) Heat map and different metabolites in colon content.
Microorganisms 14 00410 g005
Microorganisms 14 00410 g006
Figure 6. Metabolic pathway analysis of differential metabolites. (A–C) Pathway analysis between CON and LGG groups. (D) Biosynthesis of unsaturated fatty acids and related metabolites between CON and LGG groups. (E) Correlation Analysis Chart of Gut Microbiota and Metabolites. * p < 0.05, ** p < 0.01.
Figure 6. Metabolic pathway analysis of differential metabolites. (A–C) Pathway analysis between CON and LGG groups. (D) Biosynthesis of unsaturated fatty acids and related metabolites between CON and LGG groups. (E) Correlation Analysis Chart of Gut Microbiota and Metabolites. * p < 0.05, ** p < 0.01.
Microorganisms 14 00410 g006
Microorganisms 14 00410 g007
Figure 7. Transcriptomic analysis of piglets with post weaning-induced intestinal damage exposed to LGG. (A) The workflow for differential expression analysis based on the RNA-seq data. (B,C) PCA and PLSDA were performed for each sample. (D) Veen plot. (E) COG function classification of consensus sequence. (F) MA plots. (G) Volcano plots.
Figure 7. Transcriptomic analysis of piglets with post weaning-induced intestinal damage exposed to LGG. (A) The workflow for differential expression analysis based on the RNA-seq data. (B,C) PCA and PLSDA were performed for each sample. (D) Veen plot. (E) COG function classification of consensus sequence. (F) MA plots. (G) Volcano plots.
Microorganisms 14 00410 g007
Microorganisms 14 00410 g008
Figure 8. Transcriptomic analysis of mice between different groups. (A,B) KEGG enrichment and pathways analysis of DEGs between different groups. (C) Heatmap of genes known to be involved in the PI3K-Akt signaling, and signaling from RNA-seq data. Red indicates upregulated genes, while blue indicates downregulated genes. (D) the gene expression of Pik3ca, Pik3cd, Pik3r1, Akt1 and C-myc. (E) Western blot results of PI3K and AKT1/2/3. Data represent mean ± SD (n = 3). *** p < 0.001.
Figure 8. Transcriptomic analysis of mice between different groups. (A,B) KEGG enrichment and pathways analysis of DEGs between different groups. (C) Heatmap of genes known to be involved in the PI3K-Akt signaling, and signaling from RNA-seq data. Red indicates upregulated genes, while blue indicates downregulated genes. (D) the gene expression of Pik3ca, Pik3cd, Pik3r1, Akt1 and C-myc. (E) Western blot results of PI3K and AKT1/2/3. Data represent mean ± SD (n = 3). *** p < 0.001.
Microorganisms 14 00410 g008
Microorganisms 14 00410 g009
Figure 9. Patterns of organismal and functional gene abundance for the mice intestinal microbiota. (A) Heatmap of the correlation coefficients between fecal bacterial abundance and gene expression levels of PI3K/AKT signaling pathway. (B) Heatmap of the correlation coefficients between Biosynthesis of unsaturated fatty acids related metabolite gene expression levels and PI3K/AKT signaling pathway. The lines represent positive correlation (red) or negative correlation (green) between two points, with line thickness indicating the strength of the correlation coefficient. * p < 0.05, ** p < 0.01.
Figure 9. Patterns of organismal and functional gene abundance for the mice intestinal microbiota. (A) Heatmap of the correlation coefficients between fecal bacterial abundance and gene expression levels of PI3K/AKT signaling pathway. (B) Heatmap of the correlation coefficients between Biosynthesis of unsaturated fatty acids related metabolite gene expression levels and PI3K/AKT signaling pathway. The lines represent positive correlation (red) or negative correlation (green) between two points, with line thickness indicating the strength of the correlation coefficient. * p < 0.05, ** p < 0.01.
Microorganisms 14 00410 g009
Microorganisms 14 00410 g010
Figure 10. LGG upregulated intestinal organoid proliferation under TNF-α-challenge. (A) Crypts from small intestines were seeded onto Matrigel and cultured for 5 days to obtain well-developed organoids. (B) Co-culture model of LGG and TNF-α-challenge organoids. Organoids were treated with or without LGG (108 cfu per well) for 24 h, and TNF-α (100 ng/mL) was utilized to create an inflammatory model for 24 h. (C) The surface area of organoids was calculated. Scale bars, 50 μm; n = 6. (D) Relative mRNA of C-myc and PCNA. Data are presented as means ± SD (n = 4). a,b,c Means within a row with different superscripts differ significantly (p < 0.05).
Figure 10. LGG upregulated intestinal organoid proliferation under TNF-α-challenge. (A) Crypts from small intestines were seeded onto Matrigel and cultured for 5 days to obtain well-developed organoids. (B) Co-culture model of LGG and TNF-α-challenge organoids. Organoids were treated with or without LGG (108 cfu per well) for 24 h, and TNF-α (100 ng/mL) was utilized to create an inflammatory model for 24 h. (C) The surface area of organoids was calculated. Scale bars, 50 μm; n = 6. (D) Relative mRNA of C-myc and PCNA. Data are presented as means ± SD (n = 4). a,b,c Means within a row with different superscripts differ significantly (p < 0.05).
Microorganisms 14 00410 g010
Microorganisms 14 00410 g011
Figure 11. LGG inhibited apoptosis and the PI3K/AKT signal pathway related genes expression in intestinal organoids of piglets. (A) Annexin V-PI double staining was performed to distinguish apoptotic cells. (B) Relative mRNA of Pik3ca, Pik3cd, Pik3r1 and Akt1. (C) Relative protein of PI3K. Data are presented as means ± SD (n = 6). a,b,c Means within a row with different superscripts differ significantly (p < 0.05).
Figure 11. LGG inhibited apoptosis and the PI3K/AKT signal pathway related genes expression in intestinal organoids of piglets. (A) Annexin V-PI double staining was performed to distinguish apoptotic cells. (B) Relative mRNA of Pik3ca, Pik3cd, Pik3r1 and Akt1. (C) Relative protein of PI3K. Data are presented as means ± SD (n = 6). a,b,c Means within a row with different superscripts differ significantly (p < 0.05).
Microorganisms 14 00410 g011
Table 1. Sequences of the oligonucleotide primers used for quantitative real-time PCR.
Table 1. Sequences of the oligonucleotide primers used for quantitative real-time PCR.
Gene NameAccession NumberSequence (5′-3′)
β-actinXM_021086047.1F: GCAAATGCTTCTAGGCGGAC
R: GCGTCCATCACAGCTTCTCA
PIK3CAXM_021069859.1F: AGCCAATTTTTCTGTCCCGT
R: CTGGTCATCAACTGACTTGGGA
PIK3R1XM_021076847.1F: GGTCGGAATCGGTTAGGGAC
R: TCGTCTGATTTGACCGTGGC
PIK3CDXM_005664978.3F: GACCTGTTGTTTTTCCTGTTGC
R: CTGACAGTCCGCACACTCC
AKT1XM_021081500.1F: TTCAAGCCTCAGGTCACGTC
R: CGAGTAGGAGAACTGGGGGA
PCNANM_001291925.1F: GCCACTCCACTCTCTCCTAC
R: GCATCACCGAAGCAGTTCTC
C-MYCNM_001005154.1F: TCCACGCACCAGCACAATTA
R: ATTGTGTGTCCGCCTCTTGT
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Hou, G.; Deng, H.; Zhou, L.; Liu, Y.; Li, W.; Li, W.; Wang, Q. Lactobacillus rhamnosus GG Alleviates Post-Weaning Stress-Induced Intestinal Barrier Damage and Inflammation by Promoting Intestinal Health and Modulating the Gut Microbiota in Piglets. Microorganisms 2026, 14, 410. https://doi.org/10.3390/microorganisms14020410

AMA Style

Hou G, Deng H, Zhou L, Liu Y, Li W, Li W, Wang Q. Lactobacillus rhamnosus GG Alleviates Post-Weaning Stress-Induced Intestinal Barrier Damage and Inflammation by Promoting Intestinal Health and Modulating the Gut Microbiota in Piglets. Microorganisms. 2026; 14(2):410. https://doi.org/10.3390/microorganisms14020410

Chicago/Turabian Style

Hou, Gaohuan, Hongbin Deng, Lingliang Zhou, Yang Liu, Weiqin Li, Weifen Li, and Qi Wang. 2026. "Lactobacillus rhamnosus GG Alleviates Post-Weaning Stress-Induced Intestinal Barrier Damage and Inflammation by Promoting Intestinal Health and Modulating the Gut Microbiota in Piglets" Microorganisms 14, no. 2: 410. https://doi.org/10.3390/microorganisms14020410

APA Style

Hou, G., Deng, H., Zhou, L., Liu, Y., Li, W., Li, W., & Wang, Q. (2026). Lactobacillus rhamnosus GG Alleviates Post-Weaning Stress-Induced Intestinal Barrier Damage and Inflammation by Promoting Intestinal Health and Modulating the Gut Microbiota in Piglets. Microorganisms, 14(2), 410. https://doi.org/10.3390/microorganisms14020410

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop