Next Article in Journal
Isolation and Characterisation of Plant Growth-Promoting Rhizobacteria for Improving Growth and Water/Salt Stress Resilience in Lettuce
Previous Article in Journal
Microcin C7 Prevents Cyclophosphamide-Induced Immunosuppression and Intestinal Injury by Modulating T-Cell Differentiation and Gut Microbiota Composition in Mice
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Microorganisms
Volume 14
Issue 2
10.3390/microorganisms14020352
microorganisms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effect of Two Selected Probiotic Leuconostoc mesenteroides Bacteriocin-Producing Strains on Biopreservation and Organic Volatile Compounds in Model Cheese During Ripening and Storage

by
Feyza Halima Mokdad
1,
Zineb Benmechernene
1,
Aldo Todaro
2,
Cinzia Caggia
2,*,
Cinzia L. Randazzo
2 and
Nunziatina Russo
2
1
Laboratory of Applied Microbiology, Department of Biology, Faculty of Natural Sciences and Life, University of Oran 1, Ahmed Ben Bella, Oran 31100, Algeria
2
Department of Agriculture, Food and Environment (Di3A), University of Catania, 95124 Catania, Italy
*
Author to whom correspondence should be addressed.
Microorganisms 2026, 14(2), 352; https://doi.org/10.3390/microorganisms14020352
Submission received: 16 December 2025 / Revised: 27 January 2026 / Accepted: 27 January 2026 / Published: 3 February 2026
(This article belongs to the Section Food Microbiology)
Browse Figures
Versions Notes

Abstract

Lactic acid bacteria (LAB) are widely used in food systems; among them, bacteriocin-producing strains have attracted attention for their potential in the biopreservation of dairy products. This study started from the detection of bacteriocin-encoding genes in eight probiotic Leuconostoc mesenteroides subsp. mesenteroides strains, previously isolated, identified, and characterized for antimicrobial activity. Results confirmed the presence of bacteriocin genes across the strains, with Ln.F5 harboring both mesB and lcnA genes, and three other strains, including the Ln.M14 strain, exclusively carrying the lcnA gene. The two strains, Ln.F5 and Ln.M14, were used, in single and mixed cultures, for the first time, as adjunct cultures in a model cheese. Their impact against Listeria spp., Staphylococcus aureus, Escherichia coli, Micrococcus luteus, and Brochothrix thermosphacta, and on volatile organic compounds (VOCs), during ripening and storage, was evaluated. Results showed high viability (9.2 Log CFU/g) of Leuconostoc spp. in model cheese, up to 60 days of storage, and Pulsed-Field Gel Electrophoresis (PFGE) profiles of the re-isolated bacteria confirmed the survival of the added strains. Furthermore, results indicated the inhibition of E. coli and Listeria spp. started from the 15th day of ripening in samples differently inoculated with the two Leuconostoc strains. Listeria spp. was completely inhibited starting from 15 days by Ln.M14, in single culture. The complete inhibition of S. aureus, M. luteus, and B. thermosphacta was detected after 30 days of ripening in samples differently inoculated with Ln.F5 and Ln.M14. The VOC analyses revealed more complex aromatic profiles in samples inoculated with Leuconostoc strains, which, along with the development of cheese eyes, confirmed the effect of the Leuconostoc strains in enhancing quality traits of cheeses.

1. Introduction

Consuming raw-milk cheese can pose serious health risks because unpasteurized products may contain harmful microorganisms [1,2]. Additionally, both the food industry and consumers are worried about the use of synthetic chemical preservatives, which can pose health risks such as allergic reactions, cancer, asthma, behavioral issues in children, and increased antibiotic resistance. Therefore, researchers continually seek natural and effective alternatives to extend food shelf life and prevent safety issues and spoilage—without changing taste and flavor [3,4]. In this context, lactic acid bacteria (LAB) and their metabolites, such as bacteriocins, show promising potential in food biopreservation. They offer a healthier, more environmentally friendly alternative to chemical preservatives [5,6]. Moreover, LAB are widely recognized for their role in food fermentation, which enhances nutrient content, improves sensory qualities, and promotes food safety, potentially offering health benefits [7,8]. To realize their full potential, it is important to optimize processes, discover new bacteriocin-producing strains, and expand their use in various products [6,9]. The LAB mainly involved in cheese production belongs to three genera: Lactobacillus, Lactococcus, and Streptococcus, each with different acidification abilities [10]. Although Leuconostoc species are part of dairy starter cultures, they are generally classified as non-starter LAB (NSLAB), belonging to mesophilic lactobacilli [11,12]. Mesophilic starter cultures include citrate-fermenting bacteria like Leuconostoc species, Leuconostoc mesenteroides subsp. cremoris, Leuconostoc lactis, and Leuconostoc pseudomesenteroides, which are commonly found in cheese [12]. Leuconostoc can play a key role in developing sensory qualities through metabolic activities—proteolysis, lipolysis, and glycolysis—producing aromatic compounds and exopolysaccharides (EPS) [13,14], which influence cheese taste, aroma, and texture depending on ripening and storage conditions [15,16,17]. Some strains, under specific conditions, contribute to eye formation in cheese by producing CO2 and diacetyl from citrate. They are intentionally added to many semi-hard cheeses like Gouda and soft cheeses such as Camembert [10]. Cultures that produce EPSs have been successfully used in mozzarella and soft cheese production to improve texture, reduce syneresis, and replace stabilizers [18]. Several studies have investigated the survival of probiotic LAB during cheese production and ripening, though not throughout the entire storage period, with physico-chemical traits used to assess how probiotic strains influence the perceived quality of final products [19]. Although research on bacteriocins in the food industry is extensive—whether purified, semi-purified, or produced using starter cultures—the application of bacteriocin-producing Leuconostoc strains in dairy products remains limited and underexplored [20,21]. Traditional methods for screening bacteriocins are time-consuming and labor-intensive. Rapid screening techniques [22], mainly based on specific primers capable of detecting bacteriocin-encoding or related regulatory genes, have been developed and successfully applied [23,24,25]. Therefore, incorporating Leuconostoc strains that produce bacteriocins or using bacteriocins as fermentation modulators or food biopreservatives presents a new future challenge for the food industry, which could help improve food safety and extend shelf life across various foods [26,27].
This study aimed to detect bacteriocin-producing genes in probiotic Ln. mesenteroides subsp. mesenteroides strains isolated from Algerian raw camel and goat milks and previously identified as bacteriocin producers, with notable inhibitory activity against several pathogenic and spoilage bacteria. Furthermore, for the first time, selected bacteriocin-producing strains were applied as bioprotective cultures in a model cheese, and their impact on safety and technological traits was evaluated using microbiological, physico-chemical, and volatile organic compound profiling during both ripening and storage.

2. Materials and Methods

2.1. Bacterial Strains and Growth Conditions

The Ln. mesenteroides subsp. mesenteroides Ln.B6, Ln.C24, Ln.F5, Ln.G24, Ln.H10, Ln.M14, Ln.N7, and Ln.O6, previously isolated from Algerian camels’ and goats’ milk, and previously characterized for probiotic and technological traits [28], were used in the present study. The strains were stored on de Man–Rogosa–Sharpe (MRS; Liofilchem, Teramo, Italy) broth with 20% (w/v) glycerol (VWR Prolabo Chemicals, Louvain, Belgium) at −80 °C. Before using, from frozen stock, bacteria were streaked onto MRS agar plates (pH 6.8), supplemented with 30 μg/mL of vancomycin (MRSv), and incubated overnight at 30 °C. A single colony was then inoculated into 10 mL of MRS broth and incubated overnight at 30 °C.

2.2. Detection and Sequencing of Bacteriocin Coding Genes

To detect the gene encoding bacteriocin, genomic DNA was extracted as follows: 2 mL of a fresh culture, in the late exponential growth phase, was centrifuged at 8000 rpm for 10 min, washed and re-suspended in 500 μL of TE buffer (10 mM Tris–HCl, 1 mM EDTA, pH 8.0) with 0.3 g glass beads (diameter 0.106 mm; Sigma, Milan, Italy), centrifuged in a bead beater at maximum speed, and cooled on ice (twice, each for 3 min), for the mechanical lysis of cells. The obtained homogenate was centrifuged at 13,000 rpm for 5 min, and the supernatant was used as a template for PCR analysis. The quality and quantity of extracted DNA were assessed using the Qubit 4.0 (Invitrogen, Carlsbad, CA, USA) and amplified in a 2720 thermocycler (Applied Biosystems, Norwalk, CT, USA). The amplification was performed using specific primers for genes encoding mesenterocin (Y105 and B) and leucocin (A and B), as reported in Table 1. The reaction mixture contained 12.5 μL of the master mix (10 mM Tris-HCl: pH 8.3), 50 mM KCl, 1.5 mM MgCl2, 0.2 mM dNTP), 1.25 μL of Taq polymerase (Applied Biosystems, Milan, Italy), 0.2 μL of each oligonucleotide primer, 100 ng of the previously obtained DNA and pure double distilled water (Sigma, Aldrich) to reach a final volume of 25 μL. The PCR program was as follows: after an initial denaturation at 95 °C for 5 min, the amplification was performed by 30 cycles of denaturation at 95 °C for 1 min, followed by 45 s at 45 °C, and extension for 1 min at 72 °C. Amplification was completed by final extension of incomplete products at 72 °C for 7 min [25]. Then, 5 μL of the PCR products, previously mixed with SBE (10% sucrose, 0.025% bromophenol blue, and 0.85 mM EDTA) loading buffer, were gently transferred into an agarose gel in TBE 0.5× (45 mM Tris-borate, 45 mM boric acid, 1 mM EDTA; pH 8.0). In total, 1 kbp molecular size marker (Invitrogen-Life Technologies, Waltham, MA, USA) was used as a molecular weight marker. Electrophoresis was performed at 100 volts, using a Power Universal® generator (Biorad, Hercules, CA, USA) for 60 min. Gel was visualized after staining with 4 μL of Gel Red X3 (Biotium, Fremont, CA, USA), and images were captured and digitized under UV light using ChemiDoc™ MP Imaging System (Bio-Rad Laboratories Inc., Chef Mapper™, Hercules, CA, USA). Positive PCR products at the expected molecular weight were sent for sequencing to Eurofins Genomics (Eurofins, Ebersberg, Germany).

2.3. Adjunct Culture Preparation

The Ln. mesenteroides subsp. mesenteroides Ln.F5 and Ln.M14 strains, with accession numbers, in the GenBank NCBI, of MW111540 and MW136448, respectively, were selected as adjunct cultures [28]. The two strains, isolated from Algerian raw camel and goat milks and known to produce bacteriocins (leucocin A and mesentericin B105), were previously tested for their inhibitory activity against several pathogenic and spoilage bacteria, commonly present in milk and dairy products, and for their technological performances and safety criteria [28]. The two selected Leuconostoc (Ln.F5 and Ln.M14) strains were incubated overnight in 10 mL of MRS broth at 30 °C. Subcultures were incubated in fresh MRS broth at 30 °C until the end of the exponential phase, measured using a spectrophotometer (Bibby, Anandèo 1, Milan, Italy). For cheese inoculation, the method described by Papadopoulou and colleagues [29] was followed. In detail, bacterial cells were harvested by centrifugation at 10,000 rpm for 5 min at 4 °C, washed twice with ¼ Ringer’s solution (Oxoid, Hampshire, UK), and resuspended in the same buffer to a final cell density in the model cheese of approximately 109 CFU/g. Cell suspensions were stored at −20 °C until use.

2.4. Culture Preparation of Target Pathogenic Bacteria

The pathogenic bacteria, used as target strains, were revived from stock cultures stored at −80 °C, in 10 mL of appropriate broth medium, and incubated overnight. In detail, Staphylococcus aureus ATCC25923 was grown in 10 mL of Brain Heart Infusion broth (BHI, Liofilchem, Roseto degli Abruzzi, Italy), while Brochothrix thermosphacta ATCC11509, Micrococcus luteus NCBI8166, and Escherichia coli ATCC25922 were grown in 10 mL of Tryptone Soy Broth (TSB, Conda, Madrid, Spain). All strains were incubated at 37 °C, except B. thermosphacta, which was incubated at 28 °C. The cultures were harvested by centrifugation at 10,000 rpm for 5 min at 4 °C, washed twice with ¼ Ringer’s solution, and resuspended in 10 mL of Ringer’s solution. The subcultures of Listeria innocua ATCC33090 and Listeria ivanovii ATCC19119 were grown in 10 mL of BHI broth, and the two strain cultures were mixed in equal volumes and used to inoculate the model cheese. The final cell density for Listeria spp. and B. thermosphacta was 102 CFU/g, while for S. aureus, M. luteus, and E. coli was 104 CFU/g. The cell densities at the initial time were confirmed by counting on selective media: BHI agar for S. aureus; Chromatic EC X-Gluc agar medium (Liofilchem, Abruzzi, Italy) for E. coli; Streptomycin Thallous Acetate Agar (STAA) containing 250 mg of streptomycin and 25 mg of thallium acetate in 500 mL of medium (Oxoid, Hampshire, UK) for B. thermosphacta; Palcam Agar medium (VWR Prolabo Chemicals, Louvain, Belgium) for M. luteus, and; Tryptic Soy Agar (TSA) medium (Conda, Madrid, Spain) for Listeria spp.

2.5. Inoculation of Leuconostoc Cultures and Target Bacteria in Model Cheese

The model cheese used in the present study was purchased from Berglandmilch eGen (Gaiberg, Germany). The cheese, a “pasta-filata” cheese type, was produced from pasteurized cow’s milk using rennet paste and salt. Two hundred grams of model cheese was packed into sterile bags and incubated at 42 °C for 30 min until a soft, malleable texture was obtained. Cheese samples were inoculated with 2% (v/w) of cell cultures, including simultaneously both Leuconostoc cultures and target bacteria, at the final concentrations mentioned above. The inoculated samples were gently homogenized, sealed with a vacuum machine (Delta 30, Delta, Brindisi, Italy), and ripened at 16 ± 1 °C for 60 days (ripening time). After ripening, the cheese samples were stored at 4 ± 1 °C for a further 60 days (storage time) [30]. Samples without inoculum and samples inoculated with target bacteria but without Leuconostoc cultures served as negative controls. All cheese samples were prepared in triplicate. Samples were collected at different ripening intervals (0, 15, 30, and 60 days: T0, T15, T30, and T60), as well as after 30 and 60 days of storage (S30, S60), and subjected to physico-chemical and microbiological analyses.

2.6. pH and Titratable Acidity

During both the ripening and storage period, pH measurements were carried out using a 50 XS® pH meter, Mettler-Toledo, Milan, Italy. The titratable acidity (Dornic acidity, °D) was measured by homogenizing 10 g of cheese into a 100 mL volumetric flask. After filtering, 25 mL of suspension was titrated with N/9 NaOH using phenolphthalein as an indicator. The results were expressed as a percentage (%) of lactic acid.

2.7. Isolation of Leuconostoc and Pathogenic Bacteria

The cheese samples at T0, T15, T30, T60, S30, and S60 were subjected to microbiological analyses and bacterial isolation. In detail, 10 g of cheese samples, in triplicate, were added to 90 mL of sterile physiological solution (0.9% NaCl) and homogenized in a Stomacher® Lab-Blender 400 (Seward Medical, London, UK) for 5 min. Decimal dilutions were subjected to microbiological enumeration in selective media. About 20% of colonies were randomly picked from the highest dilution plates of MRSv agar and selective media for isolation of Leuconostoc and pathogenic bacteria, respectively. For Listeria, when counts were below the detection limit of the enumeration method, colonies were isolated from the Palcam Petri by the enrichment procedure. Presumptive Leuconostoc isolates were stored at −80 °C in MRS broth supplemented with 20% (v/v) glycerol. Each isolate of presumptive Leuconostoc was cultured twice in MRS broth at 30 °C for 24 h. The purity of the culture was always checked before use.

2.8. Pulsed-Field Gel Electrophoresis (PFGE) Analysis

To verify the dominance of the added Leuconostoc cultures in cheese samples, the PGFE analysis was performed on the re-isolate presumptive Leuconostoc and their profile compared to those obtained from Ln.F5 and Ln.M14 cultures, following the method described by Mokdad and colleagues [28]. Briefly, high-molecular-weight DNA extraction was performed as described by Bou and colleagues [31] and Tenover and colleagues [32] from 1 mL of overnight cultures. The SmaI-digested plugs were subjected to electrophoresis, using a CHEF-DR III system (Bio-Rad Laboratories, Hercules, CA, USA), in a 1.2% agarose gel at 6 V/cm, with linear switching interval ramps from 35 s to 25 s for 25 h at 14 °C for the first block. Lambda ladder (New England BioLabs, Beverly, MA, UK) was run as a molecular weight marker. After staining with gel red (Biotium), DNA bands were visualized under UV. The image acquisition was performed using the ChemiDoc™ MP Imaging System (Bio-Rad Laboratories Inc., Hercules, CA, USA). The Dice correlation coefficient was used to detect the similarities of banding patterns [33]. The obtained restriction profiles were compared to the PFGE fingerprints of the inoculated strains.

2.9. Volatile Organic Compound (VOC) Detection

The volatile organic compound (VOC) profiles of cheese samples inoculated with Ln.F5 and Ln.M14 strains after 30 and 60 days of ripening were obtained using SPME extraction. The SUPELCO SPME fiber backing (Bellefonte, PA, USA) and the fiber used were coated with divinylbenzene/polydimethylsiloxane (DV/PDMS) at 65 µm. Before the first extraction, the fiber was conditioned in the GC injector port at 300 °C for 1 h, according to the manufacturer’s recommendation. Ten grams of cheese sample was added to a 35 mL vial. The headspace extraction temperature and time were 40 °C and 20 min, respectively. One gram of NaCl was added to increase the rate of extraction of volatile organic compounds, and the samples were gently vortexed using a magnetic stirrer. The exposure of the fibers was prolonged for 20 min at 40 °C, followed by a thermal desorption phase, which was carried out in the injector at 230 °C for 1 min [34]. The identification of the extracted VOCs was carried out using a GC-MS instrument (HP GC6890, HP MS5973 Hewlett Packard, Palo Alto, CA, USA) [35]. The gas chromatograph was equipped with a 30 m × 0.25 mm i.d. The fused silica capillary column had a 0.25 µm film thickness (DB-WAX J&W Scientific, Santa Clara, CA, USA), and the injector temperature was 230 °C. The conditions applied were the same as previously described [36]. The quantification of VOCs was determined using the internal standard spiking method of propionic acid, ethanol, and ethyl acetate in all samples analyzed. All analyses were performed in duplicate, and the results were expressed in µg/kg of sample.

2.10. Statistical Analysis

All tests were carried out in triplicate, and the physico-chemical and microbiological data were analyzed by ANOVA (One-way Analysis of Variance) to assess the difference among the average pH, acidity, and microbial load represented by logN and μmax. The differences were considered significant when the p-level ≤ 0.05 in all assays. All statistical analyses and range tests were performed using MATLAB software (MathWorks, version 8.5.0). To facilitate the VOC profile interpretation, a principal component analysis (PCA) and a heatmap were performed using GraphPad Prism 10 software.

3. Results

3.1. Detection of mesB and lcnA Genes

The results revealed the presence of the mesB gene, involved in mesenterocin B production, in two strains: Ln.F5 and Ln.H10. Furthermore, the gene lcnA, involved in the production of leucocin, was detected in four Leuconostoc strains: Ln.C24, Ln.F5, Ln.M14, and Ln.O6. However, the Ln.N7, Ln.B6, and Ln.G24 strains were negative for all the tested genes. Finally, no gene encoding leucocin B or mesenterocin Y105 was detected in any tested strain.
BLAST (fastq2fasta-Pro) searches revealed a query coverage of 98–100% relative to sequences encoding class IIa bacteriocins deposited in the GenBank database. The alignments in GenBank confirmed that the amplicon obtained from the Ln.M14 strain using the lcnA primers matched the leucocin A gene encoding in the Leuconostoc gelidum P34034 strain, with a homology of 98.33%, whereas the amplicon of the Ln.F5 strain showed 100% homology with the gene encoding leucocin A in Ln. mesenteroides TA33a strain. In addition, the amplicon of the Ln.F5 strain obtained with the mesB primer shares a 98.51% homology with the gene encoding mesenterocin B105 in the Ln. gelidum JB7 strain.
The amplicon sequences of the strains were deposited in GenBank: the lcnA gene of the Ln.M14 strain under the GenBank accession number MW118445; the lcnA gene of the Ln.F5 strain under the GenBank accession number MW118446; and the mesB gene encoding mesenterocin B105 of the Ln.F5 strain under the GenBank accession number MW118447.
The 16S rRNA gene sequences of the strains have been previously registered in the GenBank NCBI, under the following accession numbers: Ln.C24 as MW136449; Ln.F5 as MW111540; Ln.H10 as MW136450; Ln.M14 as MW136448; and Ln.O6 as MW158781.

3.2. Physico-Chemical Analyses of Cheese Samples Differently Inoculated

During the ripening and storage period, pH and Dornic acidity (°D) of the cheese samples were monitored, and the results are reported in Table 2. Overall, significant differences in pH and acidity were observed among samples after 15 days of ripening and 30 days of storage. In detail, unlike the control cheese, samples both inoculated with single (Ln.F5 or Ln.M14) and mixed (Ln.F5 plus Ln.M14) cultures showed a significant decrease in pH, with the lowest value (5.2) detected in samples inoculated with the mixed culture (Ln.F5 plus Ln.M14), after 60 days of storage, followed by samples inoculated with the Ln.M14 strain, which, at the same time, reached the value of 5.3. Focusing on titrable acidity kinetics, results revealed variability among samples, with the highest value (162 °D) detected in samples inoculated with mixed cultures (Ln.F5 plus Ln.M14) after 60 days of storage, followed (159 °D) by samples inoculated with the Ln.M14 strain at the same sampling time.
Regarding visual observations, the model cheese samples inoculated with the mixed cultures (Ln.F5 plus Ln.M14) after 60 days of ripening, highlighted a higher presence of holes (or eyes) compared to the control samples (Figure S1).

3.3. Leuconostoc Survival in Cheese Samples During Ripening and Storage Period

The results of the counting of Ln.F5 and Ln.M14 strains, added in single and mixed cultures, in model cheese samples, revealed viable counts higher than 9.2 Log CFU/g during the whole experimental period (Figure 1). In addition, from each sample, the randomly re-isolated LAB, considered as presumptive Leuconostoc, were subjected to molecular characterization and PFGE profiling. Results confirmed species membership, as demonstrated by the restriction profiles equal to those obtained by the inoculated Ln.F5 and Ln.M14 strains.

3.4. Antagonistic Activity of Leuconostoc Adjunct Cultures Against the Target Bacteria

Looking at the antagonistic effect, an overall inhibitory effect against all the target bacteria was observed in samples inoculated with Leuconostoc strains, both in single and in mixed cultures (Figure 2). As a matter of fact, inoculated pathogenic target bacteria were never detected after 30 days of ripening, nor after 30 or 60 days of storage in model cheese samples differently treated with Leuconostoc strains.
As reported in Figure 2, all target bacteria were able to grow in untreated cheese samples. In particular, Listeria spp. (as a mix of L. innocua ATCC33090 and L. ivanovii ATCC19119) and B. thermosphacta ATCC11509, starting from an inoculated cell density of 2 Log CFU/g, reached final values of 6.0 Log CFU/g, during storage, whereas S. aureus ATCC25923, E. coli ATCC25922, and M. luteus NCBI 8166, from initial values of about 4.0 Log CFU/g, reached 6.9 Log CFU/g, 6.6 Log CFU/g, and 8.0 Log CFU/g, respectively, after 60 days of storage.
Specifically, a 100% inhibition of E. coli ATCC25922, after 15 days of ripening, was observed in cheese added with Leuconostoc strains, both in single and mixed culture (Figure 2c). Regarding S. aureus, M. luteus, and B. thermosphacta, their disappearance was detected after 30 days of ripening in cheese samples inoculated with the combinations of Leuconostoc cultures (Figure 2b,d,e). Regarding Listeria spp., in samples inoculated with the Ln. M14 strain, in single culture, a prompt inhibition was observed starting from the 15th day of ripening (Figure 2a). In cheese samples inoculated with Ln.F5 and the Leuconostoc mix, a 33% and a nearest 36% of Listeria spp. decrease, respectively, was detected after 15 days of ripening. However, after 30 days of ripening, Listeria spp. was not detected in any treated cheese samples (Figure 2a).
A similar trend was observed in cheese samples inoculated with S. aureus ATCC25923. In detail, after 15 days of ripening, inhibitions of approximately 33%, 34%, and 43% were detected in samples inoculated with Ln.F5, Ln.M14, and Ln.M14 plus Ln.F5 cultures, respectively (Figure 2b).
For M. luteus, the highest decrease (about 52%) was observed after 15 days of ripening in samples inoculated with the Ln.F5 in single culture and in samples inoculated with the mixed culture (Figure 2d), while for B. thermosphacta, the decrease did not exceed 11% when the Leuconostoc strains were added either in single or mixed cultures (Figure 2e).

3.5. Analysis of Volatile Organic Compounds (VOCs) by Solid-Phase Micro-Extraction–Gas Chromatography–Mass Spectrometry (SPME-GC-MS)

The detection of VOCs in different cheese samples after 30 and 60 days of ripening was performed using SPME-GC-MS. Cheese samples inoculated with both single cultures and mixed cultures of Ln.M14 and Ln.F5 strains were compared with the control sample without any adjunct culture. As shown in Table 3, the analysis identified 32 different compounds, including alcohols, ketones, acids, and esters. In particular, compared to the 6 compounds identified in the control sample, after 60 days of ripening, 24 compounds were identified in the samples treated with Ln.M14, and 17 in both samples treated with Ln.F5 or with the mix of the two strains. Overall, VOC levels ranged from 521.12 µg/kg, observed in the uninoculated sample (control) C-T60, to 3315.47 µg/kg detected in the Ln.M14-T60 cheese sample. Alcohols were highly dominant in the MIX-T60 samples (856.72 µg/kg), followed by Ln.F5-T60 (692.42 µg/kg), MIX-T30, and Ln.M14-T30 (633.23 µg/kg) samples. In detail, MIX-T60 samples were characterized by high levels of ethanol (398.13 µg/kg), whereas Ln.F5-T30 samples were characterized by high levels of 2-butanol (419.57 µg/kg). Ketones were the main VOCs detected in C-T60 samples, mainly 3-hydroxy-2-butanone (252.22 µg/kg). Acids were the predominant VOCs in samples Ln.F5-T60 (1622.74 µg/kg), Ln.M14-T60 (1522.80 µg/kg), and Ln.F5-T30 (1046.43 µg/kg). Among them, the higher butyric acid levels were detected in Ln.F5-T60 (540.34 µg/kg) and in MIX-T60 (401.11 µg/kg) samples, while hexanoic acid was detected only in Ln.M14-T60 (726.02 µg/kg), in Ln.F5-T30 (530.68 µg/kg), and in Ln.F5-T60 (229.77 µg/kg) samples. Among the esters, the highest levels were observed for the ethyl ester of octanoic acid in Ln.M14-T60 (265.04 µg/kg) and in Ln.M14-T30 (198.64 µg/kg) samples. In the MIX samples, ester levels appeared lower than in the Ln.M14 samples but higher than in the Ln.F5 samples. The Ln.F5 cheese samples showed the lowest levels of esters and the highest levels of thioethers, mainly represented by dimethyl disulfide, with values of 259.00 µg/kg and 428.04 µg/kg, after 30 and 60 days of ripening, respectively.
To improve result visualization, the classes of VOCs were quantified and represented using a color gradient, where darker colors indicated lower VOC concentrations and lighter colors indicated higher concentrations. The resulting heatmap (Figure 3) reiterated the distinct patterns of VOC production across samples differently inoculated with the Leuconostoc strains and during the ripening period. Notably, after 60 days of ripening, both Ln.F5 and Ln.M14 samples showed the highest acid-related signal intensities in the heat-map, as indicated by the shift toward lighter yellow coloration. In the Ln.M14 samples, ester compounds displayed the highest relative abundance. Thioethers were detected exclusively in the Ln.F5 samples, whereas ketones were only in the C-T60 sample.
Furthermore, a principal component analysis (PCA) was performed. As shown in the PCA plot (Figure 4), the two principal components, which together accounted for approximately 71.53% of the total variance, allowed a good clustering of cheese samples, indicating a stronger influence of VOCs on the placement of samples within the quadrants, mainly depending on strain and ripening period. PC1 explained 50.45% of the variance and clearly separated the cheese samples treated with the MIX (both T30 and T60) and with Ln.M14-T30 from samples treated with Ln.F5 strain, which clustered on the positive and negative sides of PC1, respectively, indicating different VOC profiles. The samples treated with the Leuconostoc mix and treated with Ln.M14 after 30 days shared similar metabolic traits, featuring butyric acid and ethanol, while the Ln. F5-treated samples after 60 days, situated in an intermediate position, were associated with 2-butanol production. The Ln.F5-T30 and Ln.M14-T60 samples, which were metabolically similar, were linked to hexanoic acid. Oppositely, the control sample after 60 days of ripening shifted downward along PC2 (which explained 21.08% of the variance), suggesting a different metabolism with the highest levels of 2-butanone and 3-hydroxy. Overall, PCA demonstrated that both strain and ripening time significantly influenced VOC composition, with Ln.M14-T30 and the MIX samples behaving similarly, and Ln.F5 following a different metabolic path; together sharing a distinct metabolic trajectory from C-T60.

4. Discussion

This study aimed to explore the use of bacteriocin-producing Leuconostoc strains as adjunct cultures, in single and mixed cultures, in a “pasta-filata”-type cheese, used as a model cheese. Their effect on biopreservation and volatile organic compound profiles during both ripening and storage periods was monitored. First, eight strains of Ln. mesenteroides subsp. mesenteroides, previously selected for the criteria reported by Hassan & Frank [37], and for their probiotic properties [28], were screened for harboring a conserved sequence motif common to all anti-listerial bacteriocin genes [24]. Results revealed that Ln.F5 and Ln.H10 strains were positive for genes encoding mesenterocin B and leucocin A, confirming well-documented findings [38,39,40]. Furthermore, the leucocin A gene was detected in Ln.C24, Ln.F5, Ln.M14, and Ln.O6. Additionally, the amplified fragments exhibited high GenBank similarity, matching the mesenterocin B gene in Ln.F5 and the leucocin A gene in both Ln.F5 and Ln.M14 strains. Subsequently, in line with these findings, the two Leuconostoc strains were selected to be used as adjunct cultures in a model cheese to test their biopreservative activity against the most common bacteria found in dairy products, used as target bacteria. Results indicated that the Leuconostoc strains maintained high viable counts till the end of storage, when they exhibited cell densities (~109 CFU/g) similar to the initial inoculum. Our findings aligned with previous studies, emphasizing the importance of viable probiotic bacteria and their resilience during ripening, retail, and storage [19]. The persistence of the inoculated strains was further confirmed by molecular characterization performed on re-isolated Ln. mesenteroides from cheese samples. Results showed that the re-isolates exhibited the same PFGE profiles as the inoculated Ln.F5 and Ln.M14 strains. These findings are consistent with results reported from Papadopoulou and colleagues [29]. Moreover, the addition of the two selected Ln. mesenteroides strains led to a significant decrease in the pH of cheese samples (about 13% lower than that recorded in the control sample) during ripening and storage, whether inoculated as single or mixed cultures (Ln.F5 plus Ln.M14). Although the production of high levels of acids can modify cheese sensory traits [41], LAB used as adjunct cultures should possess strong acidification capacity, because organic acids, especially those produced by LAB, enhance flavor, increase consumer acceptance, and inhibit pathogenic microorganisms [41,42]. In the present study, for both strains, no substantial changes in the final product’s appearance or flavor, except for a higher presence of holes, were observed. In this respect, the presence of holes indicates CO2 production, which is desirable for certain cheese varieties, like Swiss (Emmental), Gouda, Ragusano, and Edam. Conversely, in other cheese types, such as cheddar, the holes are considered defects [43,44,45]. After 60 days of ripening, samples inoculated with the two strains showed a compact, semi-hard, soft, and buttery texture, generally appreciated by consumers and influencing their preferences. Furthermore, color, flavor, and maturity were consistent across samples [43]. Regarding microbiological traits, in cheese samples treated with the Leuconostoc cultures, the disappearance of pathogenic target bacteria was always detected after 30 days of ripening. These results confirmed previous observations of a faster pathogen inactivation in cheeses with added probiotic cultures [46,47]. Besides L. monocytogenes, other pathogens such as Salmonella spp., S. aureus (enterotoxin producers), verocytotoxin-producing E. coli, and thermotolerant Campylobacter spp. pose risks to consumers [48,49]. The use of bacteriocin-producing LAB as starters, adjuncts, co-cultures, or protective cultures provides a valuable strategy for the dairy industry to add value, ensure microbiological safety, and maintain product quality [50], by supporting proper fermentation [51]. Furthermore, adjunct cultures are increasingly valued for enhancing and refining flavor development in a controlled manner, especially in low-fat cheeses, due to the release of endogenous enzymes involved in flavor development via autolysis [43,52]. Analyzing the volatilome of the cheese samples, the poorest profile was exhibited by untreated cheese samples, while the richest by the samples inoculated with the Leuconostoc Ln.M14, followed by the other treated samples. The VOC profiles were enriched in acids, esters, and, to a minor extent, alcohols, reminiscent of the findings of Carpino and colleagues [53]. Principal component analysis and heatmap of VOCs demonstrated that cheese samples clustered according to both the metabolic activity of the Leuconostoc strains and the ripening period. The close clustering of inoculated samples along PC1 indicated consistent production of VOCs associated with esterification and alcohol formation. This aligns with the known metabolic profile of heterofermentative Leuconostoc strains, which produce ethanol and acetate as primary metabolites and efficiently generate ethyl esters through alcohol–acid condensation during ripening [52]. However, the varied positioning across the graph could be explained by the combination of Leuconostoc’s metabolic pathways and complex microbial interactions that drive their dominance in cheese and influence volatile compound formation [54,55]. The acids, key contributors to cheese aroma, were the most influential variables, with butyric acid being most abundant in samples inoculated with Leuconostoc strains at any ripening times, and hexanoic acid, defining the classic “aged cheese” VOC profile, predominating in samples treated with Ln.M14 after 60 days, and in samples treated with Ln.F5 after 30 and 60 days of ripening. Alcohols, mainly produced during fermentation via NADH-dependent enzymes, were also present, with ethanol—the most abundant VOC—being higher in samples treated with the two Leuconostoc strains in mixed culture, both after 30 and 60 days of repining, unlike in other cases. While ethanol presents a mild sensory impact, it serves as a precursor for ester formation, imparting fruity, floral, and sweet notes through compounds like ethyl octanoate capable of impacting sensory complexity, even at low concentrations, thanks to its high volatility at room temperature [52,56,57] and helping mask undesirable odors during storage [58]. In the present study, all cheese samples treated with Leuconostoc strains, except samples treated with Ln.F5 after 30 days, exhibited ethyl octanoate, with the highest levels in Ln. M14-treated samples. Moreover, dimethyl disulfide, responsible for buttery, creamy, and caramel-like notes, characteristic of cheeses obtained with citrate-fermenting starter cultures, notably distinguishes cheeses treated with the Ln.F5 Leuconostoc strain. Diacetyl, derived from fatty acid β-oxidation, was also prominent in Ln.M14-T30 and Ln.M14-T60 samples, consistent with the metabolic traits of heterofermentative Leuconostoc, which produce ethanol and acetate as primary metabolites and efficiently generate ethyl esters during ripening. Contrastingly, 3-hydroxy-2-butanone (acetoin), a precursor to diacetyl with a low perception threshold [55] and related to pyruvate, lactose, or citrate metabolism in certain LAB [59,60], was detected in the control cheese, lacking the influence of Leuconostoc metabolism.

5. Conclusions

The two bacteriocin-producing Ln. mesenteroides subsp. mesenteroides strains, used as bioprotective cultures in a model cheese, demonstrated significant effects. They effectively reduced the pH without negatively affecting the main properties of the final cheese and exhibited strong inhibitory effects against the target bacteria early in the ripening process. Therefore, Ln.F5 and Ln.M14 may be promising candidates for further use in functional foods, especially in the biopreservation of dairy products. Additionally, their effects on the VOC profile confirmed the strains’ role in developing specific strategies to enhance both the safety and aroma profiles of the final cheese. Further studies, including sensory analysis, could be conducted to correlate VOC profiles with consumer preferences, providing a comprehensive approach to optimizing cheese flavor enhancement.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/microorganisms14020352/s1. Figure S1: Appearance of model cheese samples inoculated with Ln. mesenteroides subsp. mesenteroides strains after 60 days of ripening. (a) Model cheese inoculated with a single culture of the Ln.M14 strain. (b) Model cheese inoculated with a single culture of the Ln.F5 strain. (c) Model cheese inoculated with mixed cultures of Ln.M14 and Ln.F5.

Author Contributions

Conceptualization, C.C., Z.B. and C.L.R.; methodology, N.R. and A.T.; software, N.R. and F.H.M.; validation, C.C., Z.B. and C.L.R.; formal analysis, F.H.M. and A.T.; investigation, F.H.M. and A.T., resources, C.C.; data curation, N.R.; writing—original draft preparation, F.H.M.; writing—review and editing, C.C.; visualization, N.R.; supervision, Z.B., C.C. and C.L.R.; project administration, Z.B.; funding acquisition, C.C. All authors have read and agreed to the published version of the manuscript.

Funding

The research project (PRFU) entitled “The application of bioactive lactic acid bacteria in the dairy industry”, “Project N. D00L01UN310120180001”.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article/Supplementary Material. Further inquiries can be directed to the corresponding author.

Acknowledgments

This study was conducted within a research program by Feyza Halima MOKDAD, who received a short scholarship from the Algerian Ministry of Higher Education, Research and Innovation, University of Oran 1, Ahmed BEN BELLA, carried out at the University of Catania, Department of Agriculture, Food and Environment (under Cinzia Caggia and Cinzia L. Randazzo).

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Antoszewska, A.; Maćkiw, E.; Kowalska, J.; Patoleta, M.; Ławrynowicz-Paciorek, M.; Postupolski, J. Microbiological risks of traditional raw cow’s milk cheese (Koryciński Cheeses). Foods 2024, 13, 1364. [Google Scholar] [CrossRef] [PubMed]
  2. Mendonça, R.; Furtado, R.; Coelho, A.; Correia, C.B.; Suyarko, E.; Borges, V.; Gomes, J.P.; Pista, A.; Batista, R. Raw milk cheeses from Beira Baixa, Portugal—A contributive study for the microbiological hygiene and safety assessment. Braz. J. Microbiol. 2024, 55, 1759–1772. [Google Scholar] [CrossRef]
  3. Kho, K.; Kadar, A.D.; Bani, M.D.; Pramanda, I.T.; Martin, L.; Chrisdianto, M.; Pratama, F.; Devanthi, P.V.P. The potential of Pediococcus acidilactici cell-free supernatant as a preservative in food packaging materials. Foods 2024, 13, 644. [Google Scholar] [CrossRef]
  4. Ukwo, S.P.; Udo, I.I.; Ndaeyo, N. Food additives: Overview of related safety concerns. Food Sci. Nutr. Res. 2022, 5, 1–10. [Google Scholar] [CrossRef]
  5. Foti, P.; Romeo, F.V.; Sciuto, G.; Strano, M.C.; Allegra, M.; Russo, N.; Caggia, C. Postbiotic potential of lactic acid bacteria strains in Functional Minimally Processed Oranges. Appl. Sci. 2025, 15, 6736. [Google Scholar] [CrossRef]
  6. Aguirre-Garcia, Y.L.; Nery-Flores, S.D.; Campos-Muzquiz, L.G.; Flores-Gallegos, A.C.; Palomo-Ligas, L.; Ascacio-Valdés, J.A.; Sepúlveda-Torres, L.; Rodríguez-Herrera, R. Lactic acid fermentation in the food industry and bio-preservation of food. Fermentation 2024, 10, 168. [Google Scholar] [CrossRef]
  7. Wang, Y.; Zhang, C.; Liu, F.; Jin, Z.; Xia, X. Ecological succession and functional characteristics of lactic acid bacteria in traditional fermented foods. Crit. Rev. Food Sci. Nutr. 2023, 63, 5841–5855. [Google Scholar] [CrossRef]
  8. Mani-López, E.; Arrioja-Bretón, D.; López-Malo, A. The impacts of antimicrobial and antifungal activity of cell-free supernatants from lactic acid bacteria in vitro and foods. Compr. Rev. Food Sci. Food Saf. 2022, 21, 604–641. [Google Scholar]
  9. Meruvu, H.; Harsa, S.T. Lactic acid bacteria: Isolation–characterization approaches and industrial applications. Crit. Rev. Food Sci. Nutr. 2023, 63, 8337–8356. [Google Scholar] [PubMed]
  10. Law, B.A.; Tamime, A.Y. Technology of Cheesemaking; John Wiley & Sons: Chichester, UK, 2011; pp. 483–484. [Google Scholar]
  11. Parente, E.; Cogan, T.M.; Powell, I.B. Starter cultures: General aspects. In Cheese; Elsevier: Amsterdam, The Netherlands, 2017; pp. 201–226. [Google Scholar]
  12. Olsen, K.N.; Brockmann, E.; Molin, S. Quantification of Leuconostoc populations in mixed dairy starter cultures using fluorescence in situ hybridization. J. Appl. Microbiol. 2007, 103, 855–863. [Google Scholar] [CrossRef] [PubMed]
  13. Liu, W.; Pang, H.; Zhang, H.; Cai, Y. Biodiversity of lactic acid bacteria. In Lactic Acid Bacteria; Springer: Berlin/Heidelberg, Germany, 2014; pp. 103–203. [Google Scholar]
  14. Albenzio, M.; Santillo, A.; Caroprese, M.; Ruggieri, D.; Napolitano, F.; Sevi, A. Physicochemical properties of Scamorza ewe milk cheese manufactured with different probiotic cultures. J. Dairy Sci. 2013, 96, 2781–2791. [Google Scholar] [CrossRef]
  15. Patrignani, F.; Siroli, L.; Parolin, C.; Serrazanetti, D.I.; Vitali, B.; Lanciotti, R. Use of Lactobacillus crispatus to produce a probiotic cheese as potential gender food for preventing gynaecological infections. PLoS ONE 2019, 14, e0208906. [Google Scholar] [CrossRef]
  16. Marco, M.L.; Heeney, D.; Binda, S.; Cifelli, C.J.; Cotter, P.D.; Foligné, B.; Gänzle, M.; Kort, R.; Pasin, G.; Pihlanto, A. Health benefits of fermented foods: Microbiota and beyond. Curr. Opin. Biotechnol. 2017, 44, 94–102. [Google Scholar] [CrossRef] [PubMed]
  17. Dantas, A.B.; Jesus, V.F.; Silva, R.; Almada, C.N.; Esmerino, E.A.; Cappato, L.P.; Silva, M.C.; Raices, R.S.L.; Cavalcanti, R.N.; Carvalho, C.C. Manufacture of probiotic Minas Frescal cheese with Lactobacillus casei Zhang. J. Dairy Sci. 2016, 99, 18–30. [Google Scholar] [CrossRef]
  18. Hassan, A.N.; Corredig, M.; Frank, J.F.; Elsoda, M. Microstructure and rheology of an acid-coagulated cheese (Karish) made with an exopolysaccharide-producing Streptococcus thermophilus strain and its exopolysaccharide non-producing genetic variant. J. Dairy Res. 2004, 71, 116. [Google Scholar] [CrossRef]
  19. Trevisiol, F.; Renoldi, N.; Rossi, A.; Di Filippo, G.; Marino, M.; Innocente, N. Lacticaseibacillus casei as Anti-blowing Agents: Impact on the Evolution of Ripening and Sensory Profile of Montasio Cheese. Food Bioprocess Technol. 2025, 18, 1764–1776. [Google Scholar] [CrossRef]
  20. Silva, C.C.G.; Silva, S.P.M.; Ribeiro, S.C. Application of Bacteriocins and Protective Cultures in Dairy Food Preservation. Front. Microbiol. 2018, 9, 594. [Google Scholar] [CrossRef]
  21. Ng, Z.J.; Zarin, M.A.; Lee, C.K.; Tan, J.S. Application of bacteriocins in food preservation and infectious disease treatment for humans and livestock: A review. RSC Adv. 2020, 10, 38937–38964. [Google Scholar] [CrossRef] [PubMed]
  22. Refay, R.M.; Abushady, H.M.; Amer, S.A.; Mailam, M.A. Determination of bacteriocin-encoding genes of lactic acid bacteria isolated from traditional dairy products of Luxor province, Egypt. Future J. Pharm. Sci. 2020, 6, 22. [Google Scholar] [CrossRef]
  23. Macwana, S.J.; Muriana, P.M. A ‘bacteriocin PCR array’for identification of bacteriocin-related structural genes in lactic acid bacteria. J. Microbiol. Met. 2012, 88, 197–204. [Google Scholar] [CrossRef]
  24. Więckowicz, M.; Schmidt, M.; Sip, A.; Grajek, W. Development of a PCR-based assay for rapid detection of class IIa bacteriocin genes. Lett. Appl. Microbiol. 2011, 52, 281–289. [Google Scholar] [CrossRef]
  25. Xiraphi, N.; Georgalaki, M.; Rantsiou, K.; Cocolin, L.; Tsakalidou, E.; Drosinos, E.H. Purification and characterization of a bacteriocin produced by Leuconostoc mesenteroides E131. Meat Sci. 2008, 80, 194–203. [Google Scholar] [CrossRef]
  26. Hasiqimuge; Hano, C.; Arakawa, K.; Yoshida, S.; Zhao, J.; Toh, H.; Morita, H.; Miyamoto, T. A Novel C-terminal truncated bacteriocin found by comparison between Leuconostoc mesenteroides 406 and 213M0 isolated from Mongolian traditional fermented milk. Airag. Microorganisms 2024, 12, 1781. [Google Scholar]
  27. Ahn, H.; Lee, D.; Lee, S.; Lee, K.G. Isolation and characterisation of the bacteriocin-producing Leuconostoc citreum HW02 from malts. Int. J. Food Sci. Technol. 2023, 58, 83–93. [Google Scholar] [CrossRef]
  28. Mokdad, F.H.; Benmechernene, Z.; Benyoucef, A.; Russo, N.; Randazzo, C.L.; Caggia, C.; Kihal, M. Characterization of bioactive Leuconostoc mesenteroides producing bacteriocin strains isolated from camel’s and goat’s Algerian raw milks. PONTE Int. J. Sci. Res. 2020, 76, 32–61. [Google Scholar]
  29. Papadopoulou, O.S.; Argyri, A.A.; Varzakis, E.E.; Tassou, C.C.; Chorianopoulos, N.G. Greek functional Feta cheese: Enhancing quality and safety using a Lactobacillus plantarum strain with probiotic potential. Food Microbiol. 2018, 74, 21–33. [Google Scholar] [CrossRef]
  30. Randazzo, C.L.; De Luca, S.; Todaro, A.; Restuccia, C.; Lanza, C.M.; Spagna, G.; Caggia, C. Preliminary characterization of wild lactic acid bacteria and their abilities to produce flavour compounds in ripened model cheese system. J. Appl. Microbiol. 2007, 103, 427–435. [Google Scholar] [CrossRef] [PubMed]
  31. Bou, G.; Saleta, J.L.; Nieto, J.A.S.; Tomás, M.; Valdezate, S.; Sousa, D.; Lueiro, F.; Villanueva, R.; Pereira, M.J.; Llinares, P. Nosocomial outbreaks caused by Leuconostoc mesenteroides subsp. mesenteroides. Emerg. Infect. Dis. 2008, 14, 968–971. [Google Scholar] [PubMed]
  32. Tenover, F.C.; Arbeit, R.D.; Goering, R.V.; Mickelsen, P.A.; Murray, B.E.; Persing, D.H.; Swaminathan, B. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: Criteria for bacterial strain typing. J. Clin. Microbiol. 1995, 33, 2233–2239. [Google Scholar] [CrossRef]
  33. Russo, N.; Caggia, C.; Pino, A.; Coque, T.M.; Arioli, S.; Randazzo, C.L. Enterococcus spp. in Ragusano PDO and Pecorino Siciliano cheese types: A snapshot of their antibiotic resistance distribution. Food Chem. Toxicol. 2018, 120, 277–286. [Google Scholar] [CrossRef]
  34. Pino, A.; Liotta, L.; Randazzo, C.L.; Todaro, A.; Mazzaglia, A.; De Nardo, F.; Chiofalo, V.; Caggia, C. Polyphasic approach to study physico-chemical, microbiological and sensorial characteristics of artisanal Nicastrese goat’s cheese. Food Microbiol. 2018, 70, 143–154. [Google Scholar] [CrossRef]
  35. Panagou, E.Z.; Tassou, C.C. Changes in volatile compounds and related biochemical profile during controlled fermentation of cv. Conservolea green olives. Food Microbiol. 2006, 23, 738–746. [Google Scholar] [CrossRef]
  36. Randazzo, C.L.; Todaro, A.; Pino, A.; Pitino, I.; Corona, O.; Mazzaglia, A.; Caggia, C. Giarraffa and Grossa di Spagna naturally fermented table olives: Effect of starter and probiotic cultures on chemical, microbiological and sensory traits. Food Res. Int. 2014, 62, 1154–1164. [Google Scholar] [CrossRef]
  37. Hassan, A.N.; Frank, J.F. Starter cultures and their use. In Food Science and Technology; Marcel Dekker: New York, NY, USA, 2001; pp. 151–206. [Google Scholar]
  38. Papathanasopoulos, M.A.; Krier, F.; Revol-Junelles, A.M.; Lefebvre, G.; Le Caer, J.P.; Von Holy, A.; Hastings, J.W. Multiple bacteriocin production by Leuconostoc mesenteroides TA33a and other Leuconostoc/Weissella strains. Curr. Microbiol. 1997, 35, 331–335. [Google Scholar] [CrossRef]
  39. Revol-Junelles, A.; Mathis, R.; Krier, F.; Fleury, Y.; Delfour, A.; Leebvre, G. Leuconostoc mesenteroides subsp. mesenteroides FR52 synthesizes two distinct bacteriocins. Lett. Appl. Microbiol. 1996, 23, 120–124. [Google Scholar] [CrossRef]
  40. Héchard, Y.; Dérijard, B.; Letellier, F.; Cenatiempo, Y. Characterization and purification of mesentericin Y105, an anti-Listeria bacteriocin from Leuconostoc mesenteroides. Microbiology 1992, 138, 2725–2731. [Google Scholar] [CrossRef]
  41. Scatassa, M.L.; Gaglio, R.; Macaluso, G.; Francesca, N.; Randazzo, W.; Cardamone, C.; di Grigoli, A.; Moschetti, G.; Settanni, L. Transfer, composition and technological characterization of the lactic acid bacterial populations of the wooden vats used to produce traditional stretched cheeses. Food Microbiol. 2015, 52, 31–41. [Google Scholar] [CrossRef] [PubMed]
  42. Bangar, S.P.; Suri, S.; Trif, M.; Ozogul, F. Organic acids production from lactic acid bacteria: A preservation approach. Food Biosci. 2022, 46, 101615. [Google Scholar] [CrossRef]
  43. Khattab, A.R.; Guirguis, H.A.; Tawfik, S.M.; Farag, M.A. Cheese ripening: A review on modern technologies towards flavor enhancement, process acceleration and improved quality assessment. Trends Food Sci. Technol. 2019, 88, 343–360. [Google Scholar] [CrossRef]
  44. Fox, P.F.; Guinee, T.P.; Cogan, T.M.; McSweeney, P.L.H. Fundamentals of Cheese Science; Springer: Berlin/Heidelberg, Germany, 2017. [Google Scholar]
  45. White, S.R.; Broadbent, J.R.; Oberg, C.J.; McMahon, D.J. Effect of Lactobacillus helveticus and Propionibacterium freudenreichii ssp. Shermanii combinations on propensity for split defect in Swiss cheese. J. Dairy Sci. 2003, 86, 719–727. [Google Scholar] [CrossRef]
  46. da Silva Ferrari, I.; de Souza, J.V.; Ramos, C.L.; da Costa, M.M.; Schwan, R.F.; Dias, F.S. Selection of autochthonous lactic acid bacteria from goat dairies and their addition to evaluate the inhibition of Salmonella typhi in artisanal cheese. Food Microbiol. 2016, 60, 29–38. [Google Scholar] [CrossRef] [PubMed]
  47. Rolim, F.R.L.; dos Santos, K.M.O.; de Barcelos, S.C.; do Egito, A.S.; Ribeiro, T.S.; da Conceição, M.L.; Magnani, M.; de Oliveira, M.E.G.; do Egypto, R.d.C.R. Survival of Lactobacillus rhamnosus EM1107 in simulated gastrointestinal conditions and its inhibitory effect against pathogenic bacteria in semi-hard goat cheese. LWT-Food Sci. Technol. 2015, 63, 807–813. [Google Scholar] [CrossRef]
  48. Jackson, K.A.; Gould, L.H.; Hunter, J.C.; Kucerova, Z.; Jackson, B. Listeriosis outbreaks associated with soft cheeses, United States, 1998–2014. Emerg. Infect. Dis. 2018, 24, 1116. [Google Scholar] [CrossRef]
  49. Verraes, C.; Vlaemynck, G.; Van Weyenberg, S.; De Zutter, L.; Daube, G.; Sindic, M.; Uyttendaele, M.; Herman, L. A review of the microbiological hazards of dairy products made from raw milk. Int. Dairy J. 2015, 50, 32–44. [Google Scholar] [CrossRef]
  50. Ross, R.P.; Morgan, S.; Hill, C. Preservation and fermentation: Past, present and future. Int. J. Food Microbiol. 2002, 79, 3–16. [Google Scholar] [CrossRef]
  51. Todorov, S.; Onno, B.; Sorokine, O.; Chobert, J.M.; Ivanova, I.; Dousset, X. Detection and characterization of a novel antibacterial substance produced by Lactobacillus plantarum ST 31 isolated from sourdough. Int. J. Food Microbiol. 1999, 48, 167–177. [Google Scholar] [CrossRef]
  52. De Pasquale, I.; Di Cagno, R.; Buchin, S.; De Angelis, M.; Gobbetti, M. Use of autochthonous mesophilic lactic acid bacteria as starter cultures for making Pecorino Crotonese cheese: Effect on compositional, microbiological and biochemical attributes. Food Res. Int. 2019, 116, 1344–1356. [Google Scholar] [CrossRef]
  53. Carpino, S.; Randazzo, C.L.; Pino, A.; Russo, N.; Rapisarda, T.; Belvedere, G.; Caggia, C. Influence of PDO Ragusano cheese biofilm microbiota on flavour compounds formation. Food Microbiol. 2017, 61, 126–135. [Google Scholar] [CrossRef]
  54. Bezerra, T.K.A.; de Oliveira Arcanjo, N.M.; de Araújo, A.R.R.; de Queiroz, A.L.M.; de Oliveira, M.E.G.; Gomes, A.M.P.; Madruga, M.S. Volatile profile in goat coalho cheese supplemented with probiotic lactic acid bacteria. LWT-Food Sci. Technol. 2017, 76, 209–215. [Google Scholar] [CrossRef]
  55. Guillén, M.D.; Ibargoitia, M.L.; Sopelana, P.; Palencia, G.; Fresno, M. Components detected by means of solid-phase microextraction and gas chromatography/mass spectrometry in the headspace of artisan fresh goat cheese smoked by traditional methods. J. Dairy Sci. 2004, 87, 284–299. [Google Scholar] [CrossRef]
  56. Fuchsmann, P.; Stern, M.T.; Brügger, Y.A.; Breme, K. Olfactometry profiles and quantitation of volatile sulfur compounds of Swiss tilsit cheeses. J. Agric. Food Chem. 2015, 63, 7511–7521. [Google Scholar] [CrossRef] [PubMed]
  57. Bontinis, T.G.; Mallatou, H.; Pappa, E.C.; Massouras, T.; Alichanidis, E. Study of proteolysis, lipolysis and volatile profile of a traditional Greek goat cheese (Xinotyri) during ripening. Small Rumin. Res. 2012, 105, 193–201. [Google Scholar] [CrossRef]
  58. Curioni, P.M.G.; Bosset, J.O. Key odorants in various cheese types as determined by gas chromatography-olfactometry. Int. Dairy J. 2002, 12, 959–984. [Google Scholar] [CrossRef]
  59. Calabrese, F.M.; Russo, N.; Celano, G.; Pino, A.; Lopreiato, V.; Litrenta, F.; Di Bella, G.; Liotta, L.; De Angelis, M.; Caggia, C.; et al. Effect of olive by-products feed supplementation on physicochemical and microbiological profile of Provola cheese. Front. Microbiol. 2023, 16, 1112328. [Google Scholar] [CrossRef]
  60. Irmler, S.; Bavan, T.; Oberli, A.; Roetschi, A.; Badertscher, R.; Guggenbühl, B.; Berthoud, H. Catabolism of serine by Pediococcus acidilactici and Pediococcus pentosaceus. Appl. Environ. Microbiol. 2013, 79, 1309–1315. [Google Scholar] [CrossRef] [PubMed]
Microorganisms 14 00352 g001
Figure 1. LAB densities in cheese samples inoculated with Ln. mesenteroides subsp. mesenteroides Ln.F5 and Ln.M14, in single and in mixed cultures, during ripening (T0, T15, T30, and T60) and storage time (S30 and S60). Different letters indicate statistical differences among the Leuconostoc counts (p ≤ 0.05).
Figure 1. LAB densities in cheese samples inoculated with Ln. mesenteroides subsp. mesenteroides Ln.F5 and Ln.M14, in single and in mixed cultures, during ripening (T0, T15, T30, and T60) and storage time (S30 and S60). Different letters indicate statistical differences among the Leuconostoc counts (p ≤ 0.05).
Microorganisms 14 00352 g001
Microorganisms 14 00352 g002
Figure 2. Viable counts of pathogenic bacteria in model cheese samples differently inoculated with Ln. F5, Ln.M14, both in single and mixed cultures during ripening (T0, T15, T30 and T60) and storage (S30 and S60). (a) Listeria spp. densities in cheese samples inoculated with L. innocua (ATCC33090) and L. ivanovii (ATCC19119); (b) S. aureus (ATCC25923); (c) E. coli (ATCC25922); (d) M. luteus (NCBI8166); and (e) B. thermosphacta (ATCC11509).
Figure 2. Viable counts of pathogenic bacteria in model cheese samples differently inoculated with Ln. F5, Ln.M14, both in single and mixed cultures during ripening (T0, T15, T30 and T60) and storage (S30 and S60). (a) Listeria spp. densities in cheese samples inoculated with L. innocua (ATCC33090) and L. ivanovii (ATCC19119); (b) S. aureus (ATCC25923); (c) E. coli (ATCC25922); (d) M. luteus (NCBI8166); and (e) B. thermosphacta (ATCC11509).
Microorganisms 14 00352 g002
Microorganisms 14 00352 g003
Figure 3. Heatmap comparing the classes of volatile organic compounds (VOCs) detected in cheese samples differently treated with Leuconostoc Ln.F5 and Ln.M14 strains. Results are expressed as the means of VOC concentration in each sample during the ripening period.
Figure 3. Heatmap comparing the classes of volatile organic compounds (VOCs) detected in cheese samples differently treated with Leuconostoc Ln.F5 and Ln.M14 strains. Results are expressed as the means of VOC concentration in each sample during the ripening period.
Microorganisms 14 00352 g003
Microorganisms 14 00352 g004
Figure 4. Principal component analysis (PCA) biplot of volatile organic compounds (VOCs) measured in cheese samples.
Figure 4. Principal component analysis (PCA) biplot of volatile organic compounds (VOCs) measured in cheese samples.
Microorganisms 14 00352 g004
Table 1. Primers used to amplify genes encoding for bacteriocins in Leuconostoc mesenteroides.
Table 1. Primers used to amplify genes encoding for bacteriocins in Leuconostoc mesenteroides.
PrimersNucleotide Sequence (5′-3′)Target Gene
mesY105F
mesY105R		ATGACGAATATGAAGTC
TTACCAAAATCCATTTCC		mesY105
mesBF
mesBR		ATGCAAGATAAAACAAAA
TTATTTGTGGTTCTTG		mesB
lcnAF
lcnAR		ATGATGAACATGAAACCTAC
TTACCAGAAACCATTTCC		lcnA
lcnBF
lcnBR		ATGAATAACATGAAATCTGC
TTACCAGAAACCATTTCCACC		lcnB
Table 2. pH and acidity values in cheese samples inoculated with single and mixed cultures of Ln.F5 and Ln.M14, during ripening (T0, T15, T30, and T60) and storage (S30 and S60).
Table 2. pH and acidity values in cheese samples inoculated with single and mixed cultures of Ln.F5 and Ln.M14, during ripening (T0, T15, T30, and T60) and storage (S30 and S60).
SamplesRipeningStorage
T0T15T30T60S30S60
pHControl6.26 ± 0.136.15 ± 0.16 a6.10 ± 0.23 b6.06 ± 0.09 c6.00 ± 0.01 c5.98 ± 0.18 c
Ln.F56.31 ± 0.096.20 ± 0.12 a5.90 ± 0.23 b5.70 ± 0.06 b5.60 ± 0.28 b5.40 ± 0.29 a,b
Ln.M146.28 ± 0.246.00 ± 0.08 a5.50 ± 0.06 a5.40 ± 0.23 a5.38 ± 0.22 a5.30 ± 0.08 a
 Ln.F5 + Ln.M146.25 ± 0.125.60 ± 0.06 b5.50 ± 0.08 a5.50 ± 0.17 a5.35 ± 0.21 a5.20 ± 0.14 a
Acidity (°D)Control102 ± 1.23108 ± 2.11 a110 ± 1.05 a111 ± 3.29 a112 ± 4.12 a112 ± 2.08 a
Ln.F5105 ± 1.19117 ± 2.12 b127 ± 1.18 b143 ± 1.09 b145 ± 1.24 b149 ± 1.19 b
Ln.M14103 ± 1.14120 ± 2.28 c140 ± 1.09 c145 ± 1.29 b156 ± 2.32 d159 ± 1.24 c
 Ln.F5 + Ln.M14102 ± 1.28120 ± 1.02 c140 ± 2.27 c149 ± 1.2 b,c151 ± 3.04 c162 ± 1.17 d
Standard deviations (SD) are reported as replicates of three independent determinations. Values on the same column followed by a different letter are statistically different (p < 0.05).
Table 3. Quantification of volatile organic compounds (VOCs, expressed as µg/kg) in cheese samples after 30 and 60 days of ripening by SPME-GC-MS.
Table 3. Quantification of volatile organic compounds (VOCs, expressed as µg/kg) in cheese samples after 30 and 60 days of ripening by SPME-GC-MS.
C-T60Ln.F5-T30Ln.F5-T60Ln.M14-T30Ln.M14-T60Mix of Leuconostoc-T30Mix of Leuconostoc-T60
ALCOHOLS 119.13 ± 9.81 a540.31 ± 9.34 c692.42 ± 6.54 e633.23 ± 10.16 d406.01 ± 6.48 b633.23 ± 10.16 d865.72 ± 14.14 f
Ethanol119.13 ± 9.81 c41.77 ± 1.78 a103.47 ± 4.75 c218.19 ± 8.24 d103.44 ± 5.73 c218.19 ± 8.24 d398.13 ± 21.45 e
2-Butanol-451.79 ± 10.48 d419.57 ± 9.91 c301.75 ± 7.22 b265.82 ± 17.84 a301.75 ± 7.22 b261.80 ± 16.19 a
1-Butanol-46.75 ± 2.92 a169.38 ± 8.12 d113.30 ± 11.18 c36.76 ± 5.64 a113.30 ± 11.18 c205.80 ± 8.88 e
KETONES361.12 ± 11.06 c---78.85 ± 7.90 b--
2-Butanone----78.85 ± 7.90 b--
2,3-Butanedione83.06 ± 4.73------
2-Butanone, 3-hydroxy-252.22 ± 15.56------
2-Nonanone25.85 ± 0.23------
ACIDS-1046.43 ± 48.63 c1622.74 ± 101.12 d452.25 ± 7.60 a1522.80 ± 73.83 d452.25 ± 7.60 a703.92 ± 37.22 b
Acetic acid-82.33 ± 1.91 b81.81 ± 3.08 b50.84 ± 1.81 a95.56 ± 9.12 c50.84 ± 1.81 a46.88 ± 1.68 a
Propionic acid-74.01 ± 2.02 b29.94 ± 1.15 a----
Heptanoic acid-8.87 ± 0.31 a-61.96 ± 2.70 b94.72 ± 8.78 c61.96 ± 2.70 b141.59 ± 11.14 d
Butyric acid-18.06 ± 1.04 a540.34 ± 44.28 e256.58 ± 11.60 b287.70 ± 7.71 bc256.58 ± 11.60 b401.11 ± 18.54 d
Iso-valeric acid-109.89 ± 2.55 a124.51 ± 4.99 b----
2-Methyl-butyric acid--312.52 ± 16.50----
Pentanoic acid--125.27 ± 6.94 b-160.65 ± 9.47 c-1.59 ± 0.36 a
Hexanoic acid-530.68 ± 42.96 b229.77 ± 7.98 a-726.02 ± 45.64 c--
Heptanoic acid--21.91 ± 1.34 a-137.17 ± 12.18 c--
Octanoic acid-222.61 ± 13.50 e129.29 ± 5.63 c82.87 ± 4.89 b16.29 ± 0.91 a82.87 ± 4.89 b112.76 ± 5.50 c
Benzoic acid----4.71 ± 0.78--
Decanoic acid--55.88 ± 1.54 a-232.49 ± 26.92 c-71.31 ± 2.91 a
THIOETHERS35.05 ± 2.09 a259.00 ± 10.42 d502.75 ± 18.62 e53.48 ± 3.58 b46.29 ± 2.46 ab72.95 ± 3.27 c84.51 ± 2.44 c
Disulfide, dimethyl35.05 ± 2.09 a259.00 ± 10.42 d428.04 ± 21.02 e53.48 ± 3.58 b46.29 ± 2.46 ab72.95 ± 3.27 c84.51 ± 2.44 c
Trisulfide, dimethyl--74.71 ± 2.40----
ESTERS5.83 ± 0.54 a93.60 ± 2.60 c38.82 ± 0.28 b669.77 ± 9.25 f1261.53 ± 15.97 g204.15 ± 7.48 d519.00 ± 7.24 e
Butanoic acid, ethyl ester5.83 ± 0.54 a-19.12 ± 0.86 b39.08 ± 2.13 d38.02 ± 2.84 d-24.41 ± 2.43 c
Butanoic acid, butyl ester-68.15 ± 1.74 a-96.17 ± 8.44 c83.25 ± 1.48 b79.48 ± 3.69 ab104.49 ± 10.71 c
Hexanoic acid, ethyl ester---93.41 ± 7.32 d76.92 ± 5.28 c48.81 ± 4.19 a60.76 ± 3.66 b
Propyl hexanoate--19.70 ± 0.59 a-113.31 ± 5.64 b--
Butanoic acid, butyl ester----29.36 ± 3.15--
Hexanoic acid, hexyl ester----159.00 ± 12.35--
Octanoic acid, ethyl ester-25.45 ± 0.86 a-198.64 ± 5.98 d265.04 ± 14.56 e42.66 ± 3.71 b91.62 ± 6.31 c
Propyl octanoate---99.66 ± 8.94 c140.48 ± 12.88 d33.20 ± 4.27 a76.69 ± 1.03 b
Butyl caprylate----142.13 ± 6.53 b-74.68 ± 3.97 a
Ethyl caprate----214.04 ± 18.13 b-86.36 ± 3.55 a
Decanoic acid, ethyl ester---142.84 ± 13.23---
Total521.12 ± 3.87 a1939.33 ± 70.99 c2856.72 ± 126.55 e1362.57 ± 13.31 b3315.47 ± 88.76 f1362.57 ± 13.31 b2173.15 ± 18.28 d
The values are expressed as mean ± standard deviation; Values on the same row followed by a different letter are statistically different (p < 0.05).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Mokdad, F.H.; Benmechernene, Z.; Todaro, A.; Caggia, C.; Randazzo, C.L.; Russo, N. Effect of Two Selected Probiotic Leuconostoc mesenteroides Bacteriocin-Producing Strains on Biopreservation and Organic Volatile Compounds in Model Cheese During Ripening and Storage. Microorganisms 2026, 14, 352. https://doi.org/10.3390/microorganisms14020352

AMA Style

Mokdad FH, Benmechernene Z, Todaro A, Caggia C, Randazzo CL, Russo N. Effect of Two Selected Probiotic Leuconostoc mesenteroides Bacteriocin-Producing Strains on Biopreservation and Organic Volatile Compounds in Model Cheese During Ripening and Storage. Microorganisms. 2026; 14(2):352. https://doi.org/10.3390/microorganisms14020352

Chicago/Turabian Style

Mokdad, Feyza Halima, Zineb Benmechernene, Aldo Todaro, Cinzia Caggia, Cinzia L. Randazzo, and Nunziatina Russo. 2026. "Effect of Two Selected Probiotic Leuconostoc mesenteroides Bacteriocin-Producing Strains on Biopreservation and Organic Volatile Compounds in Model Cheese During Ripening and Storage" Microorganisms 14, no. 2: 352. https://doi.org/10.3390/microorganisms14020352

APA Style

Mokdad, F. H., Benmechernene, Z., Todaro, A., Caggia, C., Randazzo, C. L., & Russo, N. (2026). Effect of Two Selected Probiotic Leuconostoc mesenteroides Bacteriocin-Producing Strains on Biopreservation and Organic Volatile Compounds in Model Cheese During Ripening and Storage. Microorganisms, 14(2), 352. https://doi.org/10.3390/microorganisms14020352

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop