Identification of Reassortant Mammalian Orthoreovirus Strains in European Hedgehogs (Erinaceus europaeus): Genomic Insights and Host Association
Abstract
1. Introduction
2. Materials and Methods
2.1. Sampling
2.2. MRV Diagnostic Approaches and Sequence Strategies
3. Results
- -
- The first MRV sequence (MRV3_256444), identified in the Como province in 2023, had segment M3 closely related to a sequence from Italian chamois (MRV-3 chamois 84407 Italy 2009), while segment S4 showed 95.81% identity with a human strain from Tahiti. The remaining segments were related to a bat strain isolated from Pipistrellus kuhlii (T3/Pipistrellus_kuhlii/Italy/5515-2/2012), which was detected in Modena province (Emilia Romagna region) in 2012 [25].
- -
- The second sample (MRV3_38162/8), collected in Varese province, displayed greater variability in segment composition. Segment M3 was again related to the Italian chamois strain, and most of the remaining segments were similar to the P. kuhlii strain. However, segments S1 and S3 were related to a strain from Eptesicus serotinus in Slovenia, while segment S4 was related to a bat-derived strain from Germany.
- -
- The third MRV sequence (MRV3_236545/7), from Brescia province, had segments L1 and L3 related to human strains from Switzerland and Slovenia, respectively. Interestingly, aside from the final segment—similar to T3/Pipistrellus_kuhlii/Italy/5515-2/2012—all other segments were related to a strain detected in Eptesicus serotinus from Slovenia.
- -
- The fourth MRV sequence (MRV3_149086/3), also from Brescia province, was predominantly related to T3/Pipistrellus_kuhlii/Italy/5515-2/2012, with only segment S4 showing a relationship to the human strain from Tahiti.

4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Smith, J.M.B.; Marples, M.J. A Natural Reservoir of Penicillin-Resistant Strains of Staphylococcus aureus. Nature 1964, 201, 844–845. [Google Scholar] [CrossRef]
- Report of the International Union Conservation of Nature (IUCN). Available online: https://www.iucnredlist.org/species/29650/213411773#assessment-information (accessed on 1 July 2025).
- Hof, A.R.; Bright, P.W. Quantifying the Long-Term Decline of the West European Hedgehog in England by Subsampling Citizen-Science Datasets. Eur. J. Wildl. Res. 2016, 62, 407–413. [Google Scholar] [CrossRef]
- Krange, M. Change in the Occurrence of the West European Hedgehog (Erinaceus europaeus) in Western Sweden During 1950–2010. Master’s Thesis, University of Gothenburg, Gothenburg, Sweden, 2015. [Google Scholar]
- Hubert, P.; Julliard, R.; Biagianti, S.; Poulle, M.-L. Ecological Factors Driving the Higher Hedgehog (Erinaceus europaeus) Density in an Urban Area Compared to the Adjacent Rural Area. Landsc. Urban Plan. 2011, 103, 34–43. [Google Scholar] [CrossRef]
- Williams, B.M.; Baker, P.J.; Thomas, E.; Wilson, G.; Judge, J.; Yarnell, R.W. Reduced Occupancy of Hedgehogs (Erinaceus europaeus) in Rural England and Wales: The Influence of Habitat and an Asymmetric Intra-Guild Predator. Sci. Rep. 2018, 8, 12156. [Google Scholar] [CrossRef] [PubMed]
- van der Poel, J.L.; Dekker, J.; van Langevelde, F. Dutch Hedgehogs Erinaceus europaeus Are Nowadays Mainly Found in Urban Areas, Possibly Due to the Negative Effects of Badgers Meles meles. Wildl. Biol. 2015, 21, 51–55. [Google Scholar] [CrossRef]
- Hof, A.R.; Bright, P.W. The Value of Agri-Environment Schemes for Macro-Invertebrate Feeders: Hedgehogs on Arable Farms in Britain. Anim. Conserv. 2010, 13, 467–473. [Google Scholar] [CrossRef]
- Young, R.P.; Davison, J.; Trewby, I.D.; Wilson, G.J.; Delahay, R.J.; Doncaster, C.P. Abundance of Hedgehogs (Erinaceus europaeus) in Relation to the Density and Distribution of Badgers (Meles meles). J. Zool. 2006, 269, 349–356. [Google Scholar] [CrossRef]
- Magouras, I.; Brookes, V.J.; Jori, F.; Martin, A.; Pfeiffer, D.U.; Dürr, S. Emerging Zoonotic Diseases: Should We Rethink the Animal–Human Interface? Front. Vet. Sci. 2020, 7, 582743. [Google Scholar] [CrossRef]
- Baptista, C.V.J.; Seixas, F.; Gonzalo-Orden, J.M.; Oliveira, P.A. Can the European Hedgehog (Erinaceus europaeus) Be a Sentinel for One Health Concerns? Biologics 2021, 1, 61–69. [Google Scholar] [CrossRef]
- Baptista, C.J.; Oliveira, P.A.; Gonzalo-Orden, J.M.; Seixas, F. Do Urban Hedgehogs (Erinaceus europaeus) Represent a Relevant Source of Zoonotic Diseases? Pathogens 2023, 12, 268. [Google Scholar] [CrossRef]
- Pomorska-Mól, M.; Ruszkowski, J.J.; Gogulski, M.; Domanska-Blicharz, K. First Detection of Hedgehog Coronavirus 1 in Poland. Sci. Rep. 2022, 12, 2125. [Google Scholar] [CrossRef]
- Corman, V.M.; Kallies, R.; Philipps, H.; Göpner, G.; Müller, M.A.; Eckerle, I.; Brünink, S.; Drosten, C.; Drexler, J.F. Characterization of a Novel Betacoronavirus Related to Middle East Respiratory Syndrome Coronavirus in European Hedgehogs. J. Virol. 2014, 88, 717–724. [Google Scholar] [CrossRef] [PubMed]
- Steyer, A.; Gutiérrez-Aguire, I.; Kolenc, M.; Koren, S.; Kutnjak, D.; Pokorn, M.; Poljšak-Prijatelj, M.; Rački, N.; Ravnikar, M.; Sagadin, M.; et al. High Similarity of Novel Orthoreovirus Detected in a Child Hospitalized with Acute Gastroenteritis to Mammalian Orthoreoviruses Found in Bats in Europe. J. Clin. Microbiol. 2013, 51, 3818–3825. [Google Scholar] [CrossRef] [PubMed]
- Duncan, R. Extensive Sequence Divergence and Phylogenetic Relationships between the Fusogenic and Nonfusogenic Orthoreoviruses: A Species Proposal. Virology 1999, 260, 316–328. [Google Scholar] [CrossRef] [PubMed]
- Sabin, A.B. Reoviruses. Science 1959, 130, 1387–1389. [Google Scholar] [CrossRef]
- Narayanappa, A.T.; Sooryanarain, H.; Deventhiran, J.; Cao, D.; Venkatachalam, B.A.; Kambiranda, D.; LeRoith, T.; Heffron, C.L.; Lindstrom, N.; Hall, K.; et al. A Novel Pathogenic Mammalian Orthoreovirus from Diarrheic Pigs and Swine Blood Meal in the United States. mBio 2015, 6, e00593-15. [Google Scholar] [CrossRef]
- Jiang, R.-D.; Li, B.; Liu, X.-L.; Liu, M.-Q.; Chen, J.; Luo, D.-S.; Hu, B.-J.; Zhang, W.; Li, S.-Y.; Yang, X.-L.; et al. Bat Mammalian Orthoreoviruses Cause Severe Pneumonia in Mice. Virology 2020, 551, 70–75. [Google Scholar] [CrossRef]
- Ouattara, L.A.; Barin, F.; Barthez, M.A.; Bonnaud, B.; Roingeard, P.; Goudeau, A.; Castelnau, P.; Vernet, G.; Paranhos-Baccalà, G.; Komurian-Pradel, F. Novel Human Reovirus Isolated from Children with Acute Necrotizing Encephalopathy. Emerg. Infect. Dis. 2011, 17, 101528. [Google Scholar] [CrossRef]
- Chua, K.B.; Crameri, G.; Hyatt, A.; Yu, M.; Tompang, M.R.; Rosli, J.; McEachern, J.; Crameri, S.; Kumarasamy, V.; Eaton, B.T.; et al. A Previously Unknown Reovirus of Bat Origin Is Associated with an Acute Respiratory Disease in Humans. Proc. Natl. Acad. Sci. USA 2007, 104, 11424–11429. [Google Scholar] [CrossRef]
- Thoner, T.W., Jr.; Meloy, M.M.; Long, J.M.; Diller, J.R.; Slaughter, J.C.; Ogden, K.M. Reovirus Efficiently Reassorts Genome Segments during Coinfection and Superinfection. J. Virol. 2022, 96, e0091022. [Google Scholar] [CrossRef]
- Ahasan, M.S.; Subramaniam, K.; Sayler, K.A.; Loeb, J.C.; Popov, V.L.; Lednicky, J.A.; Wisely, S.M.; Krauer, J.M.C.; Waltzek, T.B. Molecular Characterization of a Novel Reassortment Mammalian Orthoreovirus Type 2 Isolated from a Florida White-Tailed Deer Fawn. Virus Res. 2019, 270, 197642. [Google Scholar] [CrossRef]
- Lelli, D.; Moreno, A.; Steyer, A.; Naglič, T.; Chiapponi, C.; Prosperi, A.; Faccin, F.; Sozzi, E.; Lavazza, A.; Lelli, D.; et al. Detection and Characterization of a Novel Reassortant Mammalian Orthoreovirus in Bats in Europe. Viruses 2015, 7, 5844–5854. [Google Scholar] [CrossRef] [PubMed]
- Lelli, D.; Moreno, A.; Lavazza, A.; Bresaola, M.; Canelli, E.; Boniotti, M.B.; Cordioli, P. Identification of Mammalian Orthoreovirus Type 3 in Italian Bats. Zoonoses Public Health 2013, 60, 84–92. [Google Scholar] [CrossRef] [PubMed]
- Qin, P.; Li, H.; Wang, J.-W.; Wang, B.; Xie, R.-H.; Xu, H.; Zhao, L.-Y.; Li, L.; Pan, Y.; Song, Y.; et al. Genetic and Pathogenic Characterization of a Novel Reassortant Mammalian Orthoreovirus 3 (MRV3) from a Diarrheic Piglet and Seroepidemiological Survey of MRV3 in Diarrheic Pigs from East China. Vet. Microbiol. 2017, 208, 126–136. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.; Shao, Y.; Liu, C.; Liu, D.; Guo, D.; Qiu, Z.; Tian, J.; Zhang, X.; Liu, S.; Qu, L. Isolation and Pathogenicity of the Mammalian Orthoreovirus MPC/04 from Masked Civet Cats. Infect. Genet. Evol. 2015, 36, 345–351. [Google Scholar] [CrossRef]
- Decaro, N.; Campolo, M.; Desario, C.; Ricci, D.; Camero, M.; Lorusso, E.; Elia, G.; Lavazza, A.; Martella, V.; Buonavoglia, C. Virological and Molecular Characterization of a Mammalian Orthoreovirus Type 3 Strain Isolated from a Dog in Italy. Vet. Microbiol. 2005, 109, 19–27. [Google Scholar] [CrossRef]
- Anbalagan, S.; Spaans, T.; Hause, B.M. Genome Sequence of the Novel Reassortant Mammalian Orthoreovirus Strain MRV00304/13, Isolated from a Calf with Diarrhea from the United States. Genome Announc. 2014, 2, e00451-14. [Google Scholar] [CrossRef]
- Lian, H.; Liu, Y.; Zhang, S.; Zhang, F.; Hu, R. Novel Orthoreovirus from Mink, China, 2011. Emerg. Infect. Dis. 2013, 19, 1978–1980. [Google Scholar] [CrossRef]
- Arnaboldi, S.; Righi, F.; Filipello, V.; Trogu, T.; Lelli, D.; Bianchi, A.; Bonardi, S.; Pavoni, E.; Bertasi, B.; Lavazza, A.; et al. Mammalian Orthoreovirus (MRV) Is Widespread in Wild Ungulates of Northern Italy. Viruses 2021, 13, 238. [Google Scholar] [CrossRef]
- Besozzi, M.; Lauzi, S.; Lelli, D.; Lavazza, A.; Chiapponi, C.; Pisoni, G.; Viganò, R.; Lanfranchi, P.; Luzzago, C. Host range of mammalian orthoreovirus type 3 widening to alpine chamois. Vet. Microbiol. 2019, 230, 72–77. [Google Scholar] [CrossRef]
- Trogu, T.; Canziani, S.; Tolini, C.; Carrera, M.; Sozzi, E.; Lelli, D.; Lavazza, A.; Mandola, M.L.; Robetto, S.; Marchino, M.; et al. Virological investigation in synanthropic rodents in North Italy. Int. J. Infect. Dis. 2023, 130, 189–190. [Google Scholar] [CrossRef]
- Lombardy Wildlife Regional Monitoring Plan, Year 2022–2023. Available online: http://www.vetinweb.it/cm_siv/?q=node/3249 (accessed on 1 July 2025).
- Kohl, C.; Lesnik, R.; Brinkmann, A.; Ebinger, A.; Radonić, A.; Nitsche, A.; Mühldorfer, K.; Wibbelt, G.; Kurth, A. Isolation and Characterization of Three Mammalian Orthoreoviruses from European Bats. PLoS ONE 2012, 7, e43106. [Google Scholar] [CrossRef] [PubMed]
- Day, J.M. The diversity of the orthoreoviruses: Molecular taxonomy and phylogenetic divides. Infect. Genet. Evol. 2009, 9, 390–400. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, L.-T.; Schmidt, H.A.; von Haeseler, A.; Minh, B.Q. IQ-TREE: A Fast and Effective Stochastic Algorithm for Estimating Maximum-Likelihood Phylogenies. Mol. Biol. Evol. 2015, 32, 268–274. [Google Scholar] [CrossRef]
- Lelli, D.; Beato, M.S.; Cavicchio, L.; Lavazza, A.; Chiapponi, C.; Leopardi, S.; Baioni, L.; De Benedictis, P.; Moreno, A. First identification of mammalian orthoreovirus type 3 in diarrheic pigs in Europe. Virol. J. 2016, 13, 92. [Google Scholar] [CrossRef]
- Li, Z.; Liu, D.; Ran, X.; Liu, C.; Guo, D.; Hu, X.; Tian, J.; Zhang, X.; Shao, Y.; Liu, S.; et al. Characterization and Pathogenicity of a Novel Mammalian Orthoreovirus from Wild Short-Nosed Fruit Bats. Infect. Genet. Evol. 2016, 43, 347–353. [Google Scholar] [CrossRef]
- Tyler, K.L.; Barton, E.S.; Ibach, M.L.; Robinson, C.; Campbell, J.A.; O’Donnell, S.M.; Valyi-Nagy, T.; Clarke, P.; Wetzel, J.D.; Dermody, T.S. Isolation and Molecular Characterization of a Novel Type 3 Reovirus from a Child with Meningitis. J. Infect. Dis. 2004, 189, 1664–1675. [Google Scholar] [CrossRef]
- Spinner, M.L.; Giovanni, G.D.D. Detection and Identification of Mammalian Reoviruses in Surface Water by Combined Cell Culture and Reverse Transcription-PCR. Appl. Environ. Microbiol. 2001, 67, 3016–3020. [Google Scholar] [CrossRef]
- Lodder, W.J.; van den Berg, H.H.J.L.; Rutjes, S.A.; de Roda Husman, A.M. Presence of Enteric Viruses in Source Waters for Drinking Water Production in the Netherlands. Appl. Environ. Microbiol. 2010, 76, 161–167. [Google Scholar] [CrossRef]
- Pérez-Losada, M.; Arenas, M.; Galán, J.C.; Palero, F.; González-Candelas, F. Recombination in viruses: Mechanisms, methods of study, and evolutionary consequences. Infect. Genet. Evol. 2015, 30, 296–307. [Google Scholar] [CrossRef] [PubMed]
- Ye, D.; Ji, Z.; Shi, H.; Chen, J.; Shi, D.; Cao, L.; Liu, J.; Li, M.; Dong, H.; Jing, Z.; et al. Molecular characterization of an emerging reassortant mammalian orthoreovirus in China. Arch. Virol. 2020, 165, 2281–2285. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Fu, S.; Cao, L.; Lei, W.; Cao, Y.; Song, J.; Tang, Q.; Zhang, H.; Feng, Y.; Yang, W.; et al. Isolation and Identification of a Natural Reassortant Mammalian Orthoreovirus from Least Horseshoe Bat in China. PLoS ONE 2015, 10, e0118598. [Google Scholar] [CrossRef] [PubMed]
- Naglič, T.; Rihtarič, D.; Hostnik, P.; Toplak, N.; Koren, S.; Kuhar, U.; Jamnikar-Ciglenečki, U.; Kutnjak, D.; Steyer, A. Identification of novel reassortant mammalian orthoreoviruses from bats in Slovenia. BMC Vet. Res. 2018, 14, 264. [Google Scholar] [CrossRef]
- Onuma, M.; Cao, Y.; Hasegawa, M.; Kusakabe, S. A Close Relationship of Chiroptera with Eulipotyphla (Core Insectivora) Suggested by Four Mitochondrial Genes. Zool. Sci. 2000, 17, 1327–1332. [Google Scholar] [CrossRef]

| Target [Ref.] | Primer | Sequence 5′ to 3′ | MRV Specificity | Amplicon Size (bp) |
|---|---|---|---|---|
| L1 [35] | BatReoF | CACCATGTCAAGCTGCTCCC | All types | |
| BatReoR | ACCGCCATGTATGTCCTCCAG | |||
| BatReoProbe | FAM-CCCAGTCGCGGTCATTACCACTCCG-BBQ | |||
| S1 [28] | S1-R1F | GGAGCTCGACACAGCAAATA | Type 1 | 505 |
| S1-R1R | GATGATTGACCCCTTGTGC | |||
| S1 [28] | S1-R2F | CTCCCGTCACGGTTAATTTG | Type 2 | 394 |
| S1-R2R | GATGAGTCGCCACTGTGC | |||
| S1 [28] | S1-R3F | TGGGACAACTTGAGACAGGA | Type 3 | 326 |
| S1-R3R | CTGAAGTCCACCRTTTTGWA | |||
| S1 [36] | ENT-S1-R3F | GCTATTGGTCGGATGGAT | Type 3 | 1416 |
| ENT-S1-R3R | GATGAAATGCCCCAGTGC |
| Province | Number of Hedgehogs | ||||
|---|---|---|---|---|---|
| 2022 | 2023 | Total | |||
| Neg | Pos | Neg | Pos | ||
| Lombardy | |||||
| Bergamo | 23 | 2 | 43 | 2 | 70 |
| Brescia | 29 | 2 | 7 | 3 | 41 |
| Como | 1 | 2 | 3 | ||
| Cremona | 2 | 1 | 4 | 7 | |
| Lecco | 1 | 1 | 2 | ||
| Lodi | 3 | 5 | 8 | ||
| Monza Brianza | 1 | 1 | 2 | ||
| Milan | 2 | 20 | 11 | 33 | |
| Varese | 1 | 5 | 6 | ||
| Emilia Romagna | |||||
| Ferrara | 53 | 65 | 1 | 119 | |
| Not defined | 2 | 2 | |||
| Total | 110 | 4 | 145 | 34 | 293 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Trogu, T.; Carrera, M.; Tolini, C.; Nucci, A.; Canziani, S.; Grilli, G.; Rapi, M.C.; Manfredini, S.; Rubini, S.; Lelli, D.; et al. Identification of Reassortant Mammalian Orthoreovirus Strains in European Hedgehogs (Erinaceus europaeus): Genomic Insights and Host Association. Microorganisms 2025, 13, 2047. https://doi.org/10.3390/microorganisms13092047
Trogu T, Carrera M, Tolini C, Nucci A, Canziani S, Grilli G, Rapi MC, Manfredini S, Rubini S, Lelli D, et al. Identification of Reassortant Mammalian Orthoreovirus Strains in European Hedgehogs (Erinaceus europaeus): Genomic Insights and Host Association. Microorganisms. 2025; 13(9):2047. https://doi.org/10.3390/microorganisms13092047
Chicago/Turabian StyleTrogu, Tiziana, Maya Carrera, Clara Tolini, Ambra Nucci, Sabrina Canziani, Guido Grilli, Maria Cristina Rapi, Sara Manfredini, Silva Rubini, Davide Lelli, and et al. 2025. "Identification of Reassortant Mammalian Orthoreovirus Strains in European Hedgehogs (Erinaceus europaeus): Genomic Insights and Host Association" Microorganisms 13, no. 9: 2047. https://doi.org/10.3390/microorganisms13092047
APA StyleTrogu, T., Carrera, M., Tolini, C., Nucci, A., Canziani, S., Grilli, G., Rapi, M. C., Manfredini, S., Rubini, S., Lelli, D., Carta, V., Bertasio, C., Sozzi, E., Lavazza, A., & Moreno, A. (2025). Identification of Reassortant Mammalian Orthoreovirus Strains in European Hedgehogs (Erinaceus europaeus): Genomic Insights and Host Association. Microorganisms, 13(9), 2047. https://doi.org/10.3390/microorganisms13092047

