Next Article in Journal
Challenges and Potential of Remote Sensing for Assessing Salmonella Risk in Water Sources: Evidence from Chile
Previous Article in Journal
Successful Treatment of Brain Abscess Caused by Nocardia farcinica with Combination Therapy Despite Discrepancies in In Vitro Results: A Case Report and Review of Diagnostic and Therapeutic Challenges
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Microorganisms
Volume 13
Issue 7
10.3390/microorganisms13071538
microorganisms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Biocontrol Potential of Bacillus stercoris Strain DXQ-1 Against Rice Blast Fungus Guy11

by
Qian Xu
,
Zhengli Shan
,
Zhihao Yang
,
Haoyu Ma
,
Lijuan Zou
,
Ming Dong
and
Tuo Qi
*
Ecological Security and Protection Key Laboratory of Sichuan Province, Mianyang Teachers’ College, Mianyang 621000, China
*
Author to whom correspondence should be addressed.
Microorganisms 2025, 13(7), 1538; https://doi.org/10.3390/microorganisms13071538
Submission received: 26 May 2025 / Revised: 19 June 2025 / Accepted: 27 June 2025 / Published: 30 June 2025
(This article belongs to the Section Plant Microbe Interactions)
Browse Figures
Review Reports Versions Notes

Abstract

Fungal diseases severely threaten global agriculture, while conventional chemical fungicides face increasing restrictions due to environmental and safety concerns. In this study, we isolated a soil-derived Bacillus stercoris strain, DXQ-1, exhibiting strong antagonistic activity against plant pathogenic fungi, notably Magnaporthe oryzae, the causal agent of rice blast. Scanning electron microscopy revealed that DXQ-1 disrupts fungal hyphae and inhibits conidial germination, with a 24 h crude broth treatment reducing germination to 83.33% and completely blocking appressoria formation. LC-MS-based metabolomic analysis identified key antifungal components, including lipids (35.83%), organic acid derivatives (22.15%), and small bioactive molecules (e.g., Leu-Pro, LPE 15:0). After optimizing fermentation conditions (LB medium, pH 7.0, 28 °C, 48 h), the broth showed >90% inhibition against M. oryzae and Nigrospora oryzae and retained high thermal (68 °C, 1 h) and UV (4 h) stability. Field trials demonstrated effective disease control and significant promotion of rice growth, increasing plant height (17.7%), fresh weight (53.3%), and dry weight (33.3%). These findings highlight DXQ-1 as a promising biocontrol agent, offering a sustainable and effective alternative for managing fungal diseases in crops.

1. Introduction

Fungal diseases represent a major threat to global crop production, while the extensive use of chemical fungicides is increasingly constrained by environmental pollution, resistance development, and food safety issues. This has driven the urgent demand for sustainable, eco-friendly alternatives. Among them, Bacillus species have emerged as promising biocontrol agents due to their broad-spectrum antifungal activity, plant-growth-promotion capabilities, and environmental resilience. Bacillus strains suppress pathogens through multiple mechanisms, including the secretion of lipopeptides (e.g., iturin, surfactin) [1,2,3], chitinases [4], and volatile organic compounds [5], as well as by inducing systemic resistance in host plants [6]. Recent studies have demonstrated the potential of various Bacillus strains, such as B. velezensis and B. thuringiensis, in inhibiting a wide range of pathogens through metabolite production and endophytic colonization [4,6,7] Moreover, synergistic effects have been observed when combining Bacillus with chemical fungicides, enhancing disease control and improving crop yield [6]. Despite progress in understanding Bacillus antifungal mechanisms, key challenges remain, including identifying functional genes related to antifungal activity, elucidating the complex interactions among microbes, plants, and pathogens, and ensuring efficacy under field conditions [8,9,10]. Therefore, further research into the functional genomics, strain screening, and field stability of Bacillus-based biocontrol agents is essential.
Bacillus species have gained increasing attention in plant disease management due to their broad-spectrum antifungal activity, environmental adaptability, and dual functionality in pathogen suppression and plant growth promotion. Recent studies highlight their potential as eco-friendly biocontrol agents. For instance, Endophytic Bacillus strains isolated from coffee leaves demonstrating both antifungal activity against soil-borne fungi and insecticidal effects on Lepidoptera pests [11]. Whole-genome sequencing of B. velezensis BN revealed 12 secondary metabolite biosynthetic gene clusters—including those for surfactin, iturin, and fengycin—whose synergistic action conferred broad resistance to pathogens like Fusarium spp. and Botrytis cinereal [3]. Additionally, genes encoding glycoside hydrolases and chitinases were found to enhance antifungal efficacy. Beyond disease suppression, Bacillus strains also promote plant growth. Rhizosphere-derived B. velezensis improved maize seedling growth by producing 3S,4R-ABD and 3R,4R-ABD, while nonvolatile compounds accumulating in the root maturation zone may regulate the relationship between plant roots and beneficial bacteria. Co-inoculation of Bacillus with other beneficial microorganisms can also result in niche complementarity, thereby enhancing the stability of biological controls [12,13,14,15]. Despite these advances, challenges remain in understanding the molecular mechanisms underlying metabolite biosynthesis and field efficacy.
Bacillus species exhibit broad-spectrum antimicrobial activity through the secretion of secondary metabolites that disrupt the cellular structures of plant pathogens [5,10]. In addition, they can trigger host defense responses by enhancing the activity of disease-resistance-related enzymes and by producing volatile organic compounds (VOCs) that inhibit pathogen growth and development [16,17,18,19]. Moreover, Bacillus functions as a plant-growth-promoting rhizobacteria (PGPR), playing a crucial role in crop protection, stimulating plant growth, and improving soil health [20,21,22,23]. Building on previous research, this study reports the isolation of a highly effective B. stercoris strain, designated DXQ-1. This study identifies and characterizes a soil-derived B. stercoris strain, DXQ-1, with potent antifungal activity and plant-growth-promoting effects, highlighting its potential as a sustainable biocontrol agent against rice fungal diseases. Our findings provide a scientific foundation for the development of robust, sustainable biocontrol strategies for integrated plant disease management.

2. Materials and Methods

2.1. Isolation and Identification of DXQ-1

In a rice field with a high incidence of rice blast disease, a patch of healthy rice plants was identified. Fresh soil was passed through a 20-mesh sieve, and 5 g was weighed and placed into a pre-prepared Erlenmeyer flask. Then, 45 mL of sterile water and an appropriate amount of glass beads were added. The mixture was shaken at 200 rpm/min at a constant temperature of 25 °C for 30 min to obtain a soil suspension. Using the gradient dilution method, three concentration gradients of the soil suspension (10−1, 10−2, 10−3) were prepared with sterile water in a laminar flow hood. For each gradient, 200 μL of the soil suspension was evenly spread on the surface of Gauze’s synthetic broth medium, Luria-Bertani culture plate and Nutrient Agar (NA) medium, and Potato Dextrose Agar (PDA) medium. Each treatment was performed in ten plates. To further screen for Bacillus species, the soil suspension was heated at 60 °C to induce spore formation and then spread onto NA medium. The plates were incubated upside–down at 28 °C for 3 days. Colonies with different morphologies were picked, streaked for purification, and numbered. The purified single colonies were transferred into 50% glycerol and stored at −80 °C for future use. We isolated over 300 colonies, including fungi, actinomycetes, Bacillus spp., etc. Using M. oryzae Guy11 as the indicator strain, biocontrol bacteria with antagonistic activity were preliminarily screened. After rescreening, the biocontrol Bacillus spp. with antagonistic effects were assigned corresponding identification numbers. The purified single colonies were preserved in a storage solution containing 50% glycerol and stored at −80 °C for future use.
To screen for bacterial strains with strong antagonistic activity against the rice blast pathogen, a dual culture assay was first performed. A mycelial plug was placed at the center of a PDA plate, and candidate Bacillus strains were streaked on opposite sides, 3 cm from the plug. Plates were incubated at 28 °C for 7 days, and inhibition zones were measured. Strains showing significant inhibition were further evaluated using the drug-amended plate method. Fermentation broths were centrifuged, and the supernatant was filtered (0.22 μm) to obtain sterile extracts. These were mixed with PDA at 10% (v/v) to prepare drug-containing media. A 5 mm mycelial plug was then inoculated at the center, and pathogen growth was assessed after incubation. The PDB mixed with PDA at 10% (v/v) was inoculated with M. oryzae strain Guy11 at the center, simultaneously with the control treatment. All treatments were performed in triplicate.
The biocontrol bacterium was discovered unintentionally during the cultivation of M. oryzae on CM medium, where a clear inhibition zone was observed. To identify the strain, 16S rRNA was amplified using specific primers (27F: AGA GTTTGATCMTGGCTCAG; 1492R: CGGTTACCTTGTTACGACTT) [24]. The resulting sequence was submitted to GenBank under accession number PV789457. Phylogenetic analysis was performed using the neighbor-joining (NJ) method in MEGA 7.0 software (RRID:SCR_011920) (https://www.megasoftware.net, accessed on 21 May 2024) [25].

2.2. Antifungal Activity and Pathogen Infection Experiments

Plant pathogenic fungi, including Magnaporthe oryzae (Guy11), Rhizoctonia solani (AG-1), Bipolaris maydis (C4), Fusarium graminearum (PH-1), and Nigrospora oryzae (LW11), were collected and are preserved in our laboratory. In this study, M. oryzae strain Guy11 was used as the indicator strain. Guy11 was cultured on CM medium at 28 °C for 5 days, and its spores were subsequently induced in tomato–oat medium at 28 °C for 8 days.
M. oryzae strain Guy11 was cultured on CM medium under alternating light and dark conditions at 28 °C for 7 days. After sufficient sporulation, 2 mL of sterile distilled water was added to the plate, and spores were gently dislodged from the colony surface using a pipette tip. The suspension was filtered through Miracloth to remove mycelial fragments and debris and then centrifuged at 8000 rpm for 3 min. The supernatant was discarded, and the washing step was repeated twice to obtain purified spores.
To observe conidial germination and appressorium formation, 30 μL of spore suspension was placed on a clean, hydrophobic slide and incubated in a humid chamber at 28 °C. Then, 5–7 cm rice leaves (cv. LTH) at the two-leaf stage were wounded, treated with 6-BA (1 mg/L, pH 7.0), and inoculated with M. oryzae spore suspension (2 × 105 conidia/mL) mixed with fermentation broth or sterile water. Inoculated leaves were incubated in darkness for 12 h and then under a 12 h light/dark cycle for 5–7 days. Lesion number and length were recorded and analyzed using ImageJ software version 1.64r [26]. Microscopic observations were performed using an Olympus optical microscope. For leaf inoculation in field conditions, rice plants (cv. TP309) at the two-leaf stage were used. The fermentation broth was mixed with the spore suspension, and Tween-20 was added to a final concentration of 0.01%. The mixture was then sprayed onto rice seedlings that had been growing in the field for about 14 days. Disease incidence was recorded one week after inoculation. Each treatment was performed in triplicate.

2.3. Optimization of Fermentation Conditions for Strain DXQ-1

To optimize the fermentation conditions of strain DXQ-1, NB, LB, and PDB media were initially tested, followed by the replacement of various carbon and nitrogen sources and nutrients. The optimal medium was screened using the drug-amended plate method. Seed cultures (2% inoculum) were incubated in sterilized liquid media at 28 °C and 180 rpm for 48 h to obtain fermentation broth. The resulting filtrate was mixed with PDA at a 10% (v/v) ratio to prepare drug-amended plates. PDA without filtrate served as the control. Mycelial plugs (5 mm) of M. oryzae and N. oryzae were inoculated at the center of the plates. Six plates were incubated at 28 °C for 7 days, and colony diameters were measured. Each treatment was performed in triplicate.
To determine the growth curve, DXQ-1 was cultured in LB (2% inoculum) under shaking conditions (28 °C, 180 rpm). Optical density (OD600) was recorded every 12 h for 144 h. For fermentation time optimization, samples were collected at 24, 48, 72, 96, and 120 h. Antimicrobial activity of the fermentation filtrates was evaluated using the drug-amended plate method.
To assess the effect of initial pH, LB media adjusted to pH 3~10 were inoculated and fermented under standard conditions. Similarly, to evaluate temperature effects, fermentation was conducted at 18 °C, 23 °C, 28 °C, 33 °C, and 38 °C. All filtrates were tested for bioactivity using the drug-amended plate method, with three replicates per treatment.

2.4. Isolation of Antifungal Active Substances

Strain DXQ-1 was cultured in sterilized LB liquid medium (2% inoculum) at 28 °C and 180 rpm for 48 h to obtain the fermentation broth. The broth was centrifuged at 8000 rpm for 5 min, and the supernatant was collected for further extraction.
The supernatant underwent sequential solvent extraction using petroleum ether, dichloromethane, ethyl acetate, and n-butanol in a 1:1 (v/v) ratio, following a polarity gradient. After phase separation, both aqueous and organic layers were concentrated to dryness via rotary evaporation. Each dried extract was re-dissolved in 100 mL of distilled water and sterilized through a 0.22 μm membrane filter. The antifungal activity of each extract was evaluated using the drug-amended plate method.
To further investigate the presence and diffusibility of antifungal metabolites, a sterile semipermeable membrane (molecular weight cut-off: 3500 Da) was placed on the surface of a PDA plate. A 50 μL aliquot of DXQ-1 bacterial suspension was spread evenly over the membrane and incubated at 28 °C for 48 h. After incubation, the membrane was carefully removed, and a 5 mm diameter mycelial plug of M. oryzae was placed at the center of the plate. Pathogen growth was monitored, photographed, and recorded to assess inhibition.

2.5. Growth-Promoting Ability Test of DXQ-1

TP309 rice seeds were soaked in a 3% H2O2 solution for 12 h and then rinsed and soaked in sterile water until use. For bacterial culture, 10 mL of DXQ-1 fermentation broth was added to 1000 mL of full-nutrient solution for rice cultivation. Rice seedlings were grown in 96-well hydroponic boxes with rice full-nutrient solution as the control and maintained in a growth chamber under alternating light and dark conditions for 28 days. After cultivation, root length, leaf length, plant height, fresh weight, and dry weight were measured and analyzed.

2.6. Statistical Analysis

The means of three biological replicates were calculated, and differences between treatments were analyzed using Student’s t-test. Statistical significance was defined as p < 0.05.

3. Results

3.1. Identification and Characteristics of the Bacillus stercoris Strain DXQ-1

Through preliminary screening using the plate confrontation assay, five microbial strains exhibiting strong inhibitory effects against M. oryzae were identified (Table S1). Among them, two strains—DXQ-1 and XQ2—demonstrated the most potent antagonistic activity and were selected for further evaluation using the drug-amended agar method. As shown in Figure S1, strain DXQ-1 exhibited the highest inhibitory effect, indicating its strong potential as a biocontrol agent against rice blast. As shown in Figure 1A, strain DXQ-1 formed milky white colonies with irregular edges on PDA medium, and its surface was covered by a wrinkled biofilm-like structure. Scanning electron microscopy revealed that the cells exhibited typical rod-shaped morphology. Furthermore, Gram staining analysis confirmed that DXQ-1 is a Gram-positive bacterium capable of forming spores. Based on phylogenetic analysis (Figure 1B), strain DXQ-1 was preliminarily identified as Bacillus stercoris.
To determine the optimal fermentation time for maximal antimicrobial activity of strain DXQ-1, its growth curve and the inhibitory effects of fermentation broths collected at different time points were assessed (Figures S2 and S3B). DXQ-1 entered the logarithmic phase at 24 h and reached peak biomass at 60 h, followed by a stable stationary phase until 84 h. Antimicrobial activity was detectable as early as 24 h, despite low biomass (OD600 = 0.6). By 48 h, both biomass (OD600 = 2.0) and antimicrobial activity had increased significantly and approached a stable plateau. Considering the balance between growth and metabolite production, 48 h was identified as the optimal fermentation time to ensure high antimicrobial activity with efficient resource utilization. To optimize fermentation conditions for antimicrobial compound production by strain DXQ-1, basic media, pH, and temperature were systematically evaluated. Among the tested media, LB medium yielded the highest antimicrobial activity, with inhibition rates exceeding 90% against M. oryzae (Figure S3A). Temperature tests showed that fermentation at 28 °C produced the most effective antimicrobial metabolites, with reduced activity observed above 33 °C or below 23 °C (Figure S3C). pH screening revealed that DXQ-1 maintained strong inhibitory effects within a pH range of 5.0–9.0, with optimal activity at neutral pH (Figure S3D). Thus, LB medium, neutral pH, and 28 °C were selected as optimal fermentation conditions.

3.2. Antagonistic Activity of the Biocontrol Bacterium B. stercoris Strain DXQ-1

To evaluate its antifungal activity, strain DXQ-1 was selected to investigate its effects on the mycelial morphology of M. oryzae. Scanning electron microscopy (SEM) observations of the mycelia following confrontation with DXQ-1 are presented in Figure 2. In the control group, M. oryzae exhibited typical cylindrical hyphae with smooth surfaces and intact, continuous structures (Figure 2A,C). In contrast, hyphae exposed to DXQ-1 displayed marked morphological alterations, including densely wrinkled surfaces, localized swelling at hyphal tips, and, in some cases, hyphal breakage and fragmentation (Figure 2B,D). These observations suggest that bioactive metabolites produced by DXQ-1 may disrupt cell wall synthesis and compromise structural integrity, thereby significantly inhibiting fungal growth. These findings further support the strong antifungal potential of strain DXQ-1 through structural interference with pathogenic hyphae.
The results of the detached leaf assay evaluating the biocontrol efficacy of DXQ-1 fermentation broth against rice blast are presented in Figure 3A,B. As the concentration of the fermentation broth increased, lesion length caused by M. oryzae infection progressively decreased. Notably, all treatment groups exhibited significantly reduced longitudinal lesion expansion compared to the untreated control group, suggesting that metabolites produced by strain DXQ-1 may effectively inhibit hyphal growth and spore dispersal by interfering with the pathogen’s infection process or modulating host defense responses. The antimicrobial substances in the fermentation broth of strain DXQ-1 significantly inhibited spore germination and appressorium formation of M. oryzae Guy11 in a concentration-dependent manner (Table S2, Figure 3C). Undiluted broth almost completely suppressed germination and entirely blocked appressorium formation within 24 h. Even at 10-fold dilution, appressorium formation was minimal (6.25%). At 100-fold dilution, inhibition was reduced, with germination and appressorium formation reaching 100% and 98.75%, respectively, by 24 h. These results highlight the strong antifungal potential of DXQ-1 metabolites. Furthermore, when mixed suspensions of M. oryzae spores and various concentrations of DXQ-1 fermentation broth were sprayed onto rice plants under field conditions, disease symptoms observed one week later (Figure 3D,E) showed a marked reduction in lesion formation on treated leaves. These results indicate that strain DXQ-1 and its fermentation metabolites exhibit strong biocontrol potential against rice blast not only in vitro but also under natural field conditions.

3.3. Active Antimicrobial Substance Analysis of the Strain

The antimicrobial substances in DXQ-1 fermentation broth were extracted using solvents of varying polarity, and their bioactivity was assessed via the drug-amended plate method (Figure 4A). Among the extracts, the petroleum ether fraction exhibited the strongest inhibitory effect, significantly reducing pathogen colony diameter. The n-butanol extract showed moderate activity, while dichloromethane, aqueous, and ethyl acetate extracts displayed minimal inhibition, suggesting that the active compounds are non-polar and preferentially soluble in petroleum ether. To estimate the molecular weight of the active metabolites, a dialysis membrane assay was performed (Figure 4B). After three days of incubation, the M. oryzae colony growth was inhibited in the treatment group, indicating that the antimicrobial substances are capable of passing through the membrane. These results suggest that the active compounds have a molecular weight below 3500 Da.
Non-targeted metabolomic analysis of DXQ-1 fermentation broth was performed using LC-MS and the identified metabolites. The major compound classes included lipids and lipid-like molecules (35.83%), organic acids and derivatives (22.15%), benzene ring-containing organic compounds (11.40%), and organic heterocyclic compounds (11.07%). These findings suggest that DXQ-1 produces a chemically diverse array of metabolites, with strong representation of lipid-related and aromatic compounds. The top ten differential metabolites with the most significant abundance changes are listed in Table 1, including Leu-Pro, LPE 15:0, LPG 15:0, Propionyl-L-carnitine, and several aromatic or heterocyclic compounds, such as 4′-ethyl-N-(1-ethynylcyclohexyl)[1,1′-biphenyl]-4-carboxamide.
To assess the broad-spectrum antimicrobial potential of strain DXQ-1, its fermentation broth was tested against several phytopathogenic fungi using the drug-amended plate method. Target pathogens included Magnaporthe oryzae, Rhizoctonia solani, Fusarium graminearum, Bipolaris maydis, and Nigrospora oryzae (Figure 5). DXQ-1 exhibited the strongest inhibitory effects against M. oryzae and N. oryzae, nearly completely suppressing their growth. Notable inhibition was also observed against B. maydis and R. solani, while moderate suppression was recorded for F. graminearum. These results suggest that DXQ-1 possesses broad-spectrum antifungal activity, with particularly strong effects against rice and dove tree pathogens.

3.4. Evaluation of the Growth-Promoting Effect of Strain DXQ-1

The phosphate-solubilizing ability of strain DXQ-1 was evaluated for both inorganic and organic phosphorus sources. On PVK medium, DXQ-1 formed a distinct, clear halo around the colonies (Figure 6A), indicating effective inorganic phosphate solubilization. Furthermore, its robust growth on organic phosphorus-selective medium suggested a strong capacity to degrade organic phosphorus. Nitrogen fixation was assessed using Ashby nitrogen-free medium. As shown in Figure 6A, DXQ-1 exhibited vigorous colony growth, confirming its nitrogen-fixing ability. Siderophore production was evaluated using CAS agar, where DXQ-1 formed a clear orange-yellow halo, indicating its ability to secrete siderophores and chelate iron ions. Inoculated plants showed no signs of growth inhibition; instead, they exhibited enhanced morphological development (Figure 6B). Quantitative measurements (Figure 6C, Table S3) revealed that plant height increased by 17.7% (44.37 cm vs. 37.69 cm), fresh biomass by 53.3% (0.23 g vs. 0.15 g), and dry biomass by 33.3% (0.04 g vs. 0.03 g) compared to the non-inoculated control group. All parameters showed significant improvements, demonstrating that DXQ-1 effectively promotes rice growth through multiple plant-growth-promoting mechanisms, including phosphate solubilization, nitrogen fixation, and siderophore production.

4. Discussion

Fungal diseases represent a major threat to global crop yields, and the overuse of chemical fungicides has raised serious concerns regarding environmental pollution, pathogen resistance, and food safety [27,28]. As a result, the development of efficient, eco-friendly biological control strategies has become increasingly vital for sustainable agriculture. Bacillus species are widely recognized for their broad-spectrum antimicrobial activity, primarily through the secretion of secondary metabolites that disrupt pathogen cell structures [1,5,21]. Additionally, they can induce systemic resistance in host plants by activating defense-related enzymes and releasing volatile compounds that inhibit fungal growth. As plant-growth-promoting rhizobacteria (PGPR), Bacillus strains also contribute to improved crop productivity and soil health [17,20,29]. In this study, we investigated the biocontrol potential of a self-isolated Bacillus strain, DXQ-1, with a particular focus on its inhibitory effects against key phytopathogens, such as M. oryzae and R. solani. By elucidating the antimicrobial mechanisms of DXQ-1, optimizing its fermentation conditions, and evaluating its plant-growth-promoting traits, this research aimed to characterize the functional properties and pathogen interaction mechanisms of DXQ-1 secondary metabolites and expand the available resources of biocontrol strains. Ultimately, this study lays the foundation for the development of a scalable production and application system for DXQ-1, providing a promising biopesticide for environmentally sustainable fungal disease management in crops.
In this study, a highly antagonistic strain, DXQ-1, was isolated using the dual culture plate method and identified as B. stercoris based on morphological characteristics, 16S rRNA sequencing, and phylogenetic analysis. DXQ-1 inhibited the growth of M. oryzae by suppressing spore germination and inducing severe hyphal deformations, including shrinkage and breakage. These findings are consistent with previous reports on the antifungal mechanisms of Bacillus species. For example, B. velezensis has been shown to produce broad-spectrum antifungal compounds, such as bacillomycin and surfactin, while other studies have linked cyclic lipopeptides like iturin A and fengycin to the disruption of fungal hyphae [27,28,30,31]. Similarly, DXQ-1 likely exerts its effects through such lipopeptides, as evidenced by the observed morphological damage and inhibition of appressorium formation in M. oryzae. Notably, LC-MS-based metabolomic analysis revealed that DXQ-1 produces abundant lipids and organic acids, further supporting the presence of active lipopeptides. Petroleum ether extracts of the fermentation broth showed the strongest antifungal activity, aligning with reports that lipophilic lipopeptides like surfactin and fengycin disrupt fungal membranes [32,33,34]. Additionally, DXQ-1 exhibits siderophore production and nitrogen fixation, suggesting a multifunctional role in both disease suppression and plant growth promotion. Collectively, these results underscore the promise of DXQ-1 as a broad-spectrum biocontrol agent with practical potential for sustainable crop protection.
Strain DXQ-1 demonstrated multiple plant-growth-promoting traits and biocontrol functions. It formed a distinct phosphate-solubilizing halo on PVK medium and exhibited notable organic phosphorus degradation capacity. This is consistent with findings that B. amyloliquefaciens dissolves inorganic phosphate through the secretion of organic acids [35,36], suggesting a similar solubilization mechanism in DXQ-1. Nitrogen-fixing ability was confirmed using Ashby medium, aligning with studies showing that B. subtilis enhances nitrogenase activity and nitrogen uptake [37,38]. Additionally, B. subtilis reduces NH4+-N retention and NH3 volatilization in alkaline soil by enhancing nitrogen sink capacity [39], further supporting DXQ-1′s nitrogen-fixing potential. Siderophore production was verified through the CAS assay, indicating DXQ-1′s ability to alleviate iron deficiency stress in plants. This trait not only facilitates plant growth but also contributes to pathogen suppression through iron competition [40]. Siderophore-mediated competition between Staphylococcus aureus and Pseudomonas aeruginosa significantly influences the severity of microbial infections [41], reinforcing the relevance of DXQ-1′s siderophore production to its antifungal efficacy. Furthermore, inoculation with DXQ-1 significantly improved rice plant height, fresh biomass, and dry biomass, consistent with previous reports [42,43]. In addition to its plant-growth-promoting functions, DXQ-1 also holds promise for food safety applications. Bacillus strains can degrade mycotoxins, such as deoxynivalenol and zearalenone [44,45], suggesting that DXQ-1’s metabolic capabilities may extend to mycotoxin mitigation. These findings support the potential of DXQ-1 as part of a synergistic strategy to combat resistance and minimize chemical inputs.
Overall, the results comprehensively elucidate the antagonistic mechanisms, metabolic characteristics, and biocontrol potential of DXQ-1. Its broad-spectrum antifungal activity, stability, and multifunctional traits make it a promising candidate for sustainable crop protection. Based on the existing literature, Bacillus-based biocontrol agents offer notable advantages in terms of gene cluster diversity, synergistic metabolite action, and formulation adaptability. Future research should focus on unraveling the molecular mechanisms of DXQ-1’s bioactive compounds and optimizing its industrial-scale production and field application.

5. Conclusions

In this study, strain DXQ-1 was identified as Bacillus stercoris through morphological and molecular analyses. DXQ-1 demonstrated broad-spectrum antifungal activity against multiple plant pathogens, especially N. oryzae and M.oryzae, and exhibited several plant-growth-promoting traits. Under optimized fermentation conditions (LB medium, pH 7.0, 28 °C, 48 h), the strain maintained over 90% inhibition against M. oryzae, indicating enhanced production of bioactive compounds. The active metabolites, primarily petroleum ether, were soluble and <3500 Da in molecular weight. Metabolomic profiling further identified compounds, such as Leu-Pro and LPE 15:0, as key contributors to the antifungal activity, highlighting DXQ-1’s potential as an effective biocontrol agent. DXQ-1 still requires further validation under field conditions to assess its antifungal effect and growth-promoting performance, as well as its potential impact on the agro-ecological environment. Long-term monitoring should be conducted to analyze its effects on soil microbial community structure and ecological balance after application in order to ensure its environmental friendliness. On this basis, it is recommended to develop more stable, cost-effective, and efficient formulations and to design composite microbial agents that combine disease prevention and nutrient enhancement functions, providing strong support for the sustainable development of green agriculture.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/microorganisms13071538/s1, Figure S1: Screening and validation of biocontrol strains; Figure S2: DXQ-1 growth curve; Figure S3: Screening of fermentation conditions for DXQ-1; Table S1: Inhibition rate of candidate biocontrol strains against M. oryzae Guy11; Table S2: Effects of DXQ-1 fermentation broth on spore germination and appressorium formation of M. oryzae; Table S3: Plant height, fresh weight, and dry weight of TP309 rice plants after inoculation with DXQ-1 fermentation broth.

Author Contributions

Conceptualization, T.Q.; investigation, L.Z.; resources, Q.X.; data curation, Z.S. and Z.Y.; writing—original draft preparation, T.Q.; writing—review and editing, L.Z. and M.D.; visualization, Q.X. and H.M.; supervision, T.Q.; funding acquisition, L.Z., T.Q. and M.D. The authors have reviewed and edited the output and take full responsibility for the content of this publication. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (No.31972258, No.32272560), the Mianyang Science and Technology Program (2023ZYDF007), the Sichuan Science and Technology Program (2023NSFC1937), the Scientific research initiation project of Mianyang Normal University (QD2023A01, QD2023A024), and the Mainyang Normal University Innovation Team Project (CXTD2023PY02).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

No new data were created or analyzed in this study. Data sharing is not applicable to this article.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Wang, S.Y.; Herrera-Balandrano, D.D.; Wang, Y.X.; Shi, X.C.; Chen, X.; Jin, Y.; Liu, F.Q.; Laborda, P. Biocontrol ability of the Bacillus amyloliquefaciens Group, B. amyloliquefaciens, B. velezensis, B. nakamurai, and B. siamensis, for the Management of Fungal Postharvest Diseases: A Review. J. Agric. Food Chem. 2022, 70, 6591–6616. [Google Scholar] [CrossRef] [PubMed]
  2. Wang, S.Y.; Zhang, Y.J.; Chen, X.; Shi, X.C.; Herrera-Balandrano, D.D.; Liu, F.Q.; Laborda, P. Biocontrol methods for the management of Sclerotinia sclerotiorum in Legumes: A Review. Phytopathology 2024, 114, 1447–1457. [Google Scholar] [CrossRef]
  3. Zheng, Y.; Liu, T.; Wang, Z.; Wang, X.; Wang, H.; Li, Y.; Zheng, W.; Wei, S.; Leng, Y.; Li, J.; et al. Whole-genome sequencing and secondary metabolite exploration of the novel Bacillus velezensis BN with broad-spectrum antagonistic activity against fungal plant pathogens. Front. Microbiol. 2024, 15, 1498653. [Google Scholar] [CrossRef]
  4. Liu, F.; Chen, S.; Chen, X.; Yong, B.; He, B. Identification of chitinase from Bacillus velezensis strain S161 and its antifungal activity against Penicillium digitatum. Protein Expr. Purif. 2024, 223, 106562. [Google Scholar] [CrossRef]
  5. Poulaki, E.G.; Tjamos, S.E. Bacillus species: Factories of plant protective volatile organic compounds. J. Appl. Microbiol. 2023, 134, lxad037. [Google Scholar] [CrossRef] [PubMed]
  6. dos Santos, F.M.; de Souza Viera, L.; Camargo, D.P.; Queiroz dos Santos, D.K.; Brião Muniz, M.F.; Dressler da Costa, I.F.; Pereira Santos, J.R.; Pereira da Silva, J.C. Bacillus-based product protects soybean, improves grain yield and produces metabolites able to promote plant growth and antagonize pathogenic fungi. J. Phytopathol. 2024, 172, e13353. [Google Scholar] [CrossRef]
  7. Chebotar, V.K.; Gancheva, M.S.; Chizhevskaya, E.P.; Erofeeva, A.V.; Khiutti, A.V.; Lazarev, A.M.; Zhang, X.; Xue, J.; Yang, C.; Tikhonovich, I.A. Endophyte Bacillus vallismortis BL01 to control fungal and bacterial phytopathogens of tomato (Solanum lycopersicum L.) plants. Horticulturae 2024, 10, 1095. [Google Scholar] [CrossRef]
  8. Sharma, A.; Lee, H.J. Antimicrobial activity of probiotic bacteria isolated from plants: A Review. Foods 2025, 14, 495. [Google Scholar] [CrossRef]
  9. Penha, R.O.; Vandenberghe, L.P.S.; Faulds, C.; Soccol, V.T.; Soccol, C.R. Bacillus lipopeptides as powerful pest control agents for a more sustainable and healthy agriculture: Recent studies and innovations. Planta 2020, 251, 70. [Google Scholar] [CrossRef]
  10. Fira, D.; Dimkić, I.; Berić, T.; Lozo, J.; Stanković, S. Biological control of plant pathogens by Bacillus species. J. Biotechnol. 2018, 285, 44–55. [Google Scholar] [CrossRef]
  11. de Castro, M.T.; de Lima Ferreira, A.D.C.; do Nascimento, I.N.; Rocha, G.T.; Celestino, M.F.; Freire, Í.A.; Moreira, I.C.F.; Gomes, G.C.; dos Reis Cunha, B.B.; Montalvão, S.C.L.; et al. Endophytic Bacillus spp. of coffee plants (Coffea arabica L.) and its potential in the biocontrol of phytopathogenic fungi and Lepidoptera larvae. Egypt. J. Biol. Pest Control. 2025, 35, 8. [Google Scholar] [CrossRef]
  12. Zhang, W.; Mao, G.; Zhuang, J.; Yang, H. The co-inoculation of Pseudomonas chlororaphis H1 and Bacillus altitudinis Y1 promoted soybean [Glycine max (L.) Merrill] growth and increased the relative abundance of beneficial microorganisms in rhizosphere and root. Front. Microbiol. 2022, 13, 1079348. [Google Scholar] [CrossRef]
  13. Korir, H.; Mungai, N.W.; Thuita, M.; Hamba, Y.; Masso, C. Co-inoculation effect of Rhizobia and plant growth promoting Rhizobacteria on common bean growth in a low phosphorus soil. Front. Plant Sci. 2017, 8, 141. [Google Scholar] [CrossRef] [PubMed]
  14. Sibponkrung, S.; Kondo, T.; Tanaka, K.; Tittabutr, P.; Boonkerd, N.; Yoshida, K.I.; Teaumroong, N. Co-Inoculation of Bacillus velezensis strain S141 and Bradyrhizobium strains promotes nodule growth and nitrogen fixation. Microorganisms 2020, 8, 678. [Google Scholar] [CrossRef] [PubMed]
  15. Wang, J.; Zhao, S.; Xu, S.; Zhao, W.; Zhang, X.; Lei, Y.; Zhai, H.; Huang, Z. Co-inoculation of antagonistic Bacillus velezensis FH-1 and Brevundimonas diminuta NYM3 promotes rice growth by regulating the structure and nitrification function of rhizosphere microbiome. Front. Microbiol. 2023, 14, 1101773. [Google Scholar] [CrossRef]
  16. Nan, J.; Zhang, S.; Jiang, L. Antibacterial potential of Bacillus amyloliquefaciens GJ1 against citrus Huanglongbing. Plants 2021, 10, 261. [Google Scholar] [CrossRef]
  17. Yu, Y.Y.; Dou, G.X.; Sun, X.X.; Chen, L.; Zheng, Y.; Xiao, H.M.; Wang, Y.P.; Li, H.Y.; Guo, J.H.; Jiang, C.H. Transcriptome and biochemical analysis jointly reveal the effects of Bacillus cereus AR156 on postharvest strawberry gray mold and fruit quality. Front. Plant Sci. 2021, 12, 700446. [Google Scholar] [CrossRef]
  18. Ling, L.; Luo, H.; Yang, C.; Wang, Y.; Cheng, W.; Pang, M.; Jiang, K. Volatile organic compounds produced by Bacillus velezensis L1 as a potential biocontrol agent against postharvest diseases of wolfberry. Front. Microbiol. 2022, 13, 987844. [Google Scholar] [CrossRef]
  19. Wang, C.; Duan, T.; Shi, L.; Zhang, X.; Fan, W.; Wang, M.; Wang, J.; Ren, L.; Zhao, X.; Wang, Y. Characterization of volatile organic compounds produced by Bacillus siamensis YJ15 and their antifungal activity against Botrytis cinerea. Plant Dis. 2022, 106, 2321–2329. [Google Scholar] [CrossRef]
  20. Lyu, D.; Backer, R.; Berrué, F.; Martinez-Farina, C.; Hui, J.P.M.; Smith, D.L. Plant Growth-Promoting Rhizobacteria (PGPR) with microbial growth broth improve biomass and secondary metabolite accumulation of Cannabis sativa L. J. Agric. Food Chem. 2023, 71, 7268–7277. [Google Scholar] [CrossRef]
  21. Hashem, A.; Tabassum, B.; Fathi Abd Allah, E. Bacillus subtilis: A plant-growth promoting rhizobacterium that also impacts biotic stress. Saudi J. Biol. Sci. 2019, 26, 1291–1297. [Google Scholar] [CrossRef]
  22. Siddika, A.; Rashid, A.A.; Khan, S.N.; Khatun, A.; Karim, M.M.; Prasad, P.V.V.; Hasanuzzaman, M. Harnessing plant growth-promoting rhizobacteria, Bacillus subtilis and B. aryabhattai to combat salt stress in rice: A study on the regulation of antioxidant defense, ion homeostasis, and photosynthetic parameters. Front. Plant Sci. 2024, 15, 1419764. [Google Scholar] [CrossRef] [PubMed]
  23. Mashabela, M.D.; Tugizimana, F.; Steenkamp, P.A.; Piater, L.A.; Dubery, I.A.; Mhlongo, M.I. Untargeted metabolite profiling to elucidate rhizosphere and leaf metabolome changes of wheat cultivars (Triticum aestivum L.) treated with the plant growth-promoting rhizobacteria Paenibacillus alvei (T22) and Bacillus subtilis. Front. Microbiol. 2022, 13, 971836. [Google Scholar] [CrossRef] [PubMed]
  24. Comtet-Marre, S.; Chakoory, O.; Peyret, P. Targeted 16S rRNA Gene Capture by Hybridization and bioinformatic analysis. Methods Mol. Biol. 2023, 2605, 187–208. [Google Scholar] [CrossRef]
  25. Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef]
  26. Schneider, C.A.; Rasband, W.S.; Eliceiri, K.W. NIH Image to ImageJ: 25 years of image analysis. Nat. Methods 2012, 9, 671–675. [Google Scholar] [CrossRef]
  27. El-Saadony, M.T.; Saad, A.M.; Soliman, S.M.; Salem, H.M.; Ahmed, A.I.; Mahmood, M.; El-Tahan, A.M.; Ebrahim, A.A.M.; Abd El-Mageed, T.A.; Negm, S.H.; et al. Plant growth-promoting microorganisms as biocontrol agents of plant diseases: Mechanisms, challenges and future perspectives. Front. Plant Sci. 2022, 13, 923880. [Google Scholar] [CrossRef]
  28. Ayaz, M.; Li, C.H.; Ali, Q.; Zhao, W.; Chi, Y.K.; Shafiq, M.; Ali, F.; Yu, X.Y.; Yu, Q.; Zhao, J.T.; et al. Bacterial and fungal biocontrol agents for plant disease protection: Journey from lab to field, current status, challenges, and global perspectives. Molecules 2023, 28, 6735. [Google Scholar] [CrossRef]
  29. Sorokan, A.; Gabdrakhmanova, V.; Kuramshina, Z.; Khairullin, R.; Maksimov, I. Plant-Associated Bacillus thuringiensis and Bacillus cereus: Inside agents for biocontrol and genetic recombination in phytomicrobiome. Plants 2023, 12, 4037. [Google Scholar] [CrossRef]
  30. Keshmirshekan, A.; de Souza Mesquita, L.M.; Ventura, S.P.M. Biocontrol manufacturing and agricultural applications of Bacillus velezensis. Trends Biotechnol. 2024, 42, 986–1001. [Google Scholar] [CrossRef]
  31. Ma, S.; Wang, Y.; Teng, W. Bacillus velezensis K-9 as a potential biocontrol agent for managing potato scab. Plant Dis. 2023, 107, 3943–3951. [Google Scholar] [CrossRef]
  32. Li, Y.; Héloir, M.C.; Zhang, X.; Geissler, M.; Trouvelot, S.; Jacquens, L.; Henkel, M.; Su, X.; Fang, X.; Wang, Q.; et al. Surfactin and fengycin contribute to the protection of a Bacillus subtilis strain against grape downy mildew by both direct effect and defence stimulation. Mol. Plant Pathol. 2019, 20, 1037–1050. [Google Scholar] [CrossRef] [PubMed]
  33. Mandal, S.M.; Barbosa, A.E.; Franco, O.L. Lipopeptides in microbial infection control: Scope and reality for industry. Biotechnol. Adv. 2013, 31, 338–345. [Google Scholar] [CrossRef] [PubMed]
  34. Yan, L.; Li, G.; Liang, Y.; Tan, M.; Fang, J.; Peng, J.; Li, K. Co-production of surfactin and fengycin by Bacillus subtilis BBW1542 isolated from marine sediment: A promising biocontrol agent against foodborne pathogens. J. Food Sci. Technol. 2024, 61, 563–572. [Google Scholar] [CrossRef]
  35. Luo, L.; Zhao, C.; Wang, E.; Raza, A.; Yin, C. Bacillus amyloliquefaciens as an excellent agent for biofertilizer and biocontrol in agriculture: An overview for its mechanisms. Microbiol. Res. 2022, 259, 127016. [Google Scholar] [CrossRef] [PubMed]
  36. WoldemariamYohannes, K.; Wan, Z.; Yu, Q.; Li, H.; Wei, X.; Liu, Y.; Wang, J.; Sun, B. Prebiotic, Probiotic, Antimicrobial, and functional food applications of Bacillus amyloliquefaciens. J. Agric. Food Chem. 2020, 68, 14709–14727. [Google Scholar] [CrossRef]
  37. Panchami, P.S.; Geetha Thanuja, K.; Karthikeyan, S. Isolation and characterization of indigenous Plant Growth-Promoting Rhizobacteria (PGPR) from Cardamom Rhizosphere. Curr. Microbiol. 2020, 77, 2963–2981. [Google Scholar] [CrossRef]
  38. Galindo, F.S.; Thiengo, C.C.; Pagliari, P.H.; Bernardes, J.V.S.; Dos Santos, G.D.; Longato, P.A.F.; Vilela, L.S.; Teixeira Filho, M.C.M.; Lavres, J. Synergism of Bacillus subtilis and Azospirillum brasilense for enhanced N-use efficiency and maize growth: Evidence from (15)N isotopic and physiological responses. Physiol. Plant. 2025, 177, e70205. [Google Scholar] [CrossRef]
  39. Sun, B.; Bai, Z.; Bao, L.; Xue, L.; Zhang, S.; Wei, Y.; Zhang, Z.; Zhuang, G.; Zhuang, X. Bacillus subtilis biofertilizer mitigating agricultural ammonia emission and shifting soil nitrogen cycling microbiomes. Environ. Int. 2020, 144, 105989. [Google Scholar] [CrossRef]
  40. Gu, S.; Wei, Z.; Shao, Z.; Friman, V.P.; Cao, K.; Yang, T.; Kramer, J.; Wang, X.; Li, M.; Mei, X.; et al. Competition for iron drives phytopathogen control by natural rhizosphere microbiomes. Nat. Microbiol. 2020, 5, 1002–1010. [Google Scholar] [CrossRef]
  41. Harrison, F.; Paul, J.; Massey, R.C.; Buckling, A. Interspecific competition and siderophore-mediated cooperation in Pseudomonas aeruginosa. ISME J. 2008, 2, 49–55. [Google Scholar] [CrossRef] [PubMed]
  42. Dhar, S.K.; Kaur, J.; Singh, G.B.; Chauhan, A.; Tamang, J.; Lakhara, N.; Asyakina, L.; Atuchin, V.; Mudgal, G.; Abdi, G. Novel Bacillus and Prestia isolates from Dwarf century plant enhance crop yield and salinity tolerance. Sci. Rep. 2024, 14, 14645. [Google Scholar] [CrossRef] [PubMed]
  43. Puan, S.L.; Erriah, P.; Baharudin, M.M.A.; Yahaya, N.M.; Kamil, W.; Ali, M.S.M.; Ahmad, S.A.; Oslan, S.N.; Lim, S.; Sabri, S. Antimicrobial peptides from Bacillus spp. and strategies to enhance their yield. Appl. Microbiol. Biotechnol. 2023, 107, 5569–5593. [Google Scholar] [CrossRef] [PubMed]
  44. González Pereyra, M.L.; Di Giacomo, A.L.; Lara, A.L.; Martínez, M.P.; Cavaglieri, L. Aflatoxin-degrading Bacillus sp. strains degrade zearalenone and produce proteases, amylases and cellulases of agro-industrial interest. Toxicon Off. J. Int. Soc. Toxinology 2020, 180, 43–48. [Google Scholar] [CrossRef]
  45. Li, B.; Duan, J.; Ren, J.; Francis, F.; Li, G. Isolation and characterization of two new deoxynivalenol-degrading strains, Bacillus sp. HN117 and Bacillus sp. N22. Toxins 2022, 14, 781. [Google Scholar] [CrossRef]
Microorganisms 13 01538 g001
Figure 1. Identification and characteristics of B. stercoris strain DXQ-1. (A) The colony morphology, ultrastructure under the electron microscope, and bacterial staining of the of B. stercoris strain DXQ-1. (B) A phylogenetic tree was constructed based on the complete 16S rRNA gene sequences of strain DXQ-1 and other strains retrieved from GenBank. The tree was constructed using the neighbor-joining (NJ) algorithm, and 1000 bootstrap replicates were performed using MEGA 7.0 software. The bootstrap value (%) is indicated proximal to the nodes.
Figure 1. Identification and characteristics of B. stercoris strain DXQ-1. (A) The colony morphology, ultrastructure under the electron microscope, and bacterial staining of the of B. stercoris strain DXQ-1. (B) A phylogenetic tree was constructed based on the complete 16S rRNA gene sequences of strain DXQ-1 and other strains retrieved from GenBank. The tree was constructed using the neighbor-joining (NJ) algorithm, and 1000 bootstrap replicates were performed using MEGA 7.0 software. The bootstrap value (%) is indicated proximal to the nodes.
Microorganisms 13 01538 g001
Microorganisms 13 01538 g002
Figure 2. Antagonistic activity of the biocontrol bacterium B. stercoris strain DXQ-1 against the M. oryzae strain Guy11. (A) The mycelial morphology of M. oryzae strain Guy11. Scale bar = 1 cm. (B) DXQ-1 was inoculated into Guy11 colonies, and the colonies were photographed. (C) The ultrastructure of Guy11 in the control group; scale bar = 5 µm. (D) The ultrastructure of Guy11 after co-cultivation with B. stercoris strain DXQ-1; scale bar = 5 µm.
Figure 2. Antagonistic activity of the biocontrol bacterium B. stercoris strain DXQ-1 against the M. oryzae strain Guy11. (A) The mycelial morphology of M. oryzae strain Guy11. Scale bar = 1 cm. (B) DXQ-1 was inoculated into Guy11 colonies, and the colonies were photographed. (C) The ultrastructure of Guy11 in the control group; scale bar = 5 µm. (D) The ultrastructure of Guy11 after co-cultivation with B. stercoris strain DXQ-1; scale bar = 5 µm.
Microorganisms 13 01538 g002
Microorganisms 13 01538 g003
Figure 3. Effect of DXQ-1 extracts on disease incidence caused by M. oryzae. (A,B) Lesion symptoms and length after being incubated with Guy11, which included mixed fermentation broth and then M. oryzae spores 24 h later in the greenhouse. Rice leaves were incubated with 0 (CK), 1, 10, or 100% DXQ-1 fermentation broth. (C) Effect of DXQ-1 fermentation broth on spore germination of M. oryzae. Scale bar: 20 μm. (D,E) Lesion symptoms and blast disease lesion density after the therapeutic treatment, which involved spraying rice blast spores, followed by the fermentation broth 24 h later. Rice leaves were sprayed with DXQ-1 fermentation broth. Blast disease lesion density was quantified in infected leaf segments (5 cm in length) 5 days post-infection. The values are the means ± SDs. Asterisks denote a significant difference from the CK, determined using Student’s t-test (* indicates p < 0.05). n = 30 independent leaves in (B,E).
Figure 3. Effect of DXQ-1 extracts on disease incidence caused by M. oryzae. (A,B) Lesion symptoms and length after being incubated with Guy11, which included mixed fermentation broth and then M. oryzae spores 24 h later in the greenhouse. Rice leaves were incubated with 0 (CK), 1, 10, or 100% DXQ-1 fermentation broth. (C) Effect of DXQ-1 fermentation broth on spore germination of M. oryzae. Scale bar: 20 μm. (D,E) Lesion symptoms and blast disease lesion density after the therapeutic treatment, which involved spraying rice blast spores, followed by the fermentation broth 24 h later. Rice leaves were sprayed with DXQ-1 fermentation broth. Blast disease lesion density was quantified in infected leaf segments (5 cm in length) 5 days post-infection. The values are the means ± SDs. Asterisks denote a significant difference from the CK, determined using Student’s t-test (* indicates p < 0.05). n = 30 independent leaves in (B,E).
Microorganisms 13 01538 g003
Microorganisms 13 01538 g004
Figure 4. Active antimicrobial substance analysis of strain DXQ-1. (A) The mycelial morphology of Guy11 cultured on CM containing DXQ-1 extracts, petroleum extracts, dichloromethane extracts, n-butanol extracts, ethyl acetate extracts, and water extracts. PET: petroleum ether; EAC: acetic ester; DCM: dichloromethane; NBA: n-butanol. (B) Detection of the molecular weight of antibacterial substances using semipermeable membranes.
Figure 4. Active antimicrobial substance analysis of strain DXQ-1. (A) The mycelial morphology of Guy11 cultured on CM containing DXQ-1 extracts, petroleum extracts, dichloromethane extracts, n-butanol extracts, ethyl acetate extracts, and water extracts. PET: petroleum ether; EAC: acetic ester; DCM: dichloromethane; NBA: n-butanol. (B) Detection of the molecular weight of antibacterial substances using semipermeable membranes.
Microorganisms 13 01538 g004
Microorganisms 13 01538 g005
Figure 5. Antimicrobial spectrum of DXQ-1 extracts against phytopathogenic fungi. The mycelial morphology and colony diameters of Rhizoctonia solani, Fusarium graminearum, Nigrospora oryzae, Magnaporthe oryzae, and Bipolaris maydis were assessed on PDA plates supplemented with DXQ-1 extracts. The extracts were obtained from DXQ-1 cultured in PDB medium and incorporated into the plates. Plates without DXQ-1 extract served as controls (CK). Scale bar = 1 cm.
Figure 5. Antimicrobial spectrum of DXQ-1 extracts against phytopathogenic fungi. The mycelial morphology and colony diameters of Rhizoctonia solani, Fusarium graminearum, Nigrospora oryzae, Magnaporthe oryzae, and Bipolaris maydis were assessed on PDA plates supplemented with DXQ-1 extracts. The extracts were obtained from DXQ-1 cultured in PDB medium and incorporated into the plates. Plates without DXQ-1 extract served as controls (CK). Scale bar = 1 cm.
Microorganisms 13 01538 g005
Microorganisms 13 01538 g006
Figure 6. Plant-growth-promoting effects of DXQ-1. (A) Colony morphology of DXQ-1 cultured on PVK, calcium phytate, Ashby, and CAS media, indicating its abilities in phosphorus solubilization (PVK), organic phosphorus solubilization (calcium phytate), nitrogen fixation (Ashby), and siderophore production (CAS). (B) Phenotype, (C) plant height, (D) fresh weight, and (E) dry weight of TP309 rice plants after inoculation with DXQ-1 fermentation broth; sterile PDB served as the control. Data are presented as mean ± SD. Asterisks indicate statistically significant differences compared to the control (Student’s t-test, * p < 0.05). Scale bar in (A) = 1 cm.
Figure 6. Plant-growth-promoting effects of DXQ-1. (A) Colony morphology of DXQ-1 cultured on PVK, calcium phytate, Ashby, and CAS media, indicating its abilities in phosphorus solubilization (PVK), organic phosphorus solubilization (calcium phytate), nitrogen fixation (Ashby), and siderophore production (CAS). (B) Phenotype, (C) plant height, (D) fresh weight, and (E) dry weight of TP309 rice plants after inoculation with DXQ-1 fermentation broth; sterile PDB served as the control. Data are presented as mean ± SD. Asterisks indicate statistically significant differences compared to the control (Student’s t-test, * p < 0.05). Scale bar in (A) = 1 cm.
Microorganisms 13 01538 g006
Table 1. Analysis of DXQ-1 antifungal substances.
Table 1. Analysis of DXQ-1 antifungal substances.
Compounds m/zFormulaDXQ-1 Fold Change
Leu-Pro273.14C11 H20 N2 O3425.71
LPE 15:0438.26C20 H42 N O7 P161.67
4′-ethyl-N-(1-ethynylcyclohexyl)[1,1′-biphenyl]-4-carboxamide330.19C23 H25 N O135.95
LPG 15:0469.25C21 H43 O9 P111.09
Propionyl-L-carnitine216.12C10 H19 N O498.36
1,1-Dimethyl-2-oxopropyl N-[2-(2-pyridyl)ethyl]carbamate251.13C13 H18 N2 O397.11
Esculin339.07C15 H16 O990.19
Lauric Acid245.17C12 H24 O289.65
Tanespimycin566.28C31 H43 N3 O883.86
2,3-Dinor prostaglandin E1307.19C18 H30 O564.45
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Xu, Q.; Shan, Z.; Yang, Z.; Ma, H.; Zou, L.; Dong, M.; Qi, T. Biocontrol Potential of Bacillus stercoris Strain DXQ-1 Against Rice Blast Fungus Guy11. Microorganisms 2025, 13, 1538. https://doi.org/10.3390/microorganisms13071538

AMA Style

Xu Q, Shan Z, Yang Z, Ma H, Zou L, Dong M, Qi T. Biocontrol Potential of Bacillus stercoris Strain DXQ-1 Against Rice Blast Fungus Guy11. Microorganisms. 2025; 13(7):1538. https://doi.org/10.3390/microorganisms13071538

Chicago/Turabian Style

Xu, Qian, Zhengli Shan, Zhihao Yang, Haoyu Ma, Lijuan Zou, Ming Dong, and Tuo Qi. 2025. "Biocontrol Potential of Bacillus stercoris Strain DXQ-1 Against Rice Blast Fungus Guy11" Microorganisms 13, no. 7: 1538. https://doi.org/10.3390/microorganisms13071538

APA Style

Xu, Q., Shan, Z., Yang, Z., Ma, H., Zou, L., Dong, M., & Qi, T. (2025). Biocontrol Potential of Bacillus stercoris Strain DXQ-1 Against Rice Blast Fungus Guy11. Microorganisms, 13(7), 1538. https://doi.org/10.3390/microorganisms13071538

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop