Exploring Virulence Characteristics of Clinical Escherichia coli Isolates from Greece
Abstract
1. Introduction
2. Materials and Methods
2.1. Clinical Isolates, Identification and Susceptibility Testing
2.2. Detection of ESBL-Encoding Genes
2.3. Multilocus Sequence Typing
2.4. String Test
2.5. Hemolysin Production
2.6. Microtiter Plate (MTP) Assay
2.7. Serum Resistance Assay
2.8. CRISPR/Cas Typing and CRISPR Amplification
2.9. Whole-Genome Sequencing
2.10. Analysis of WGS Data
2.11. Nucleotide Sequence Accession Numbers
3. Results
3.1. Metadata and Susceptibility Info
3.2. Virulence Characteristics
3.3. CRISPR/Cas Systems
3.4. WGS Data
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Da Silva, G.J.; Mendonça, N. Association between antimicrobial resistance and virulence in Escherichia coli. Virulence 2012, 3, 18–28. [Google Scholar] [CrossRef]
- Jang, J.; Hur, H.G.; Sadowsky, M.J.; Byappanahalli, M.; Yan, T.; Ishii, S. Environmental Escherichia coli: Ecology and public health implications—A review. J. Appl. Microbiol. 2017, 123, 570–581. [Google Scholar] [CrossRef]
- Florez-Cuadrado, D.; Moreno, M.A.; Ugarte-Ruíz, M.; Domínguez, L. Antimicrobial resistance in the food chain in the European union. Adv. Food Nutr. Res. 2018, 86, 115–136. [Google Scholar] [CrossRef]
- Toval, F.; Köhler, C.-D.; Vogel, U.; Wagenlehner, F.; Mellmann, A.; Fruth, A.; Schmidt, M.A.; Karch, H.; Bielaszewska, M.; Dobrindt, U. Characterization of Escherichia coli isolates from hospital inpatients or outpatients with urinary tract infection. J. Clin. Microbiol. 2014, 52, 407–418. [Google Scholar] [CrossRef]
- Subedi, M.; Luitel, H.; Devkota, B.; Bhattarai, R.K.; Phuyal, S.; Panthi, P.; Shrestha, A.; Chaudhary, D.K. Antibiotic resistance pattern and virulence genes content in avian pathogenic Escherichia coli (APEC) from broiler chickens in Chitwan, Nepal. BMC Vet. Res. 2018, 14, 1–6. [Google Scholar] [CrossRef]
- Sanchez, F.; Fuenzalida, V.; Ramos, R.; Escobar, B.; Neira, V.; Borie, C.; Lapierre, L.; Lopez, P.; Venegas, L.; Dettleff, P. Genomic features and antimicrobial resistance patterns of shiga toxin-producing Escherichia coli strains isolated from food in Chile. Zoonoses Public Health 2021, 68, 226–238. [Google Scholar] [CrossRef]
- Shen, J.; Zhi, S.; Guo, D.; Jiang, Y.; Xu, X.; Zhao, L.; Lv, J. Prevalence, antimicrobial resistance, and whole genome sequencing analysis of shiga toxinproducing Escherichia coli (STEC) and enteropathogenic Escherichia coli (EPEC) from imported foods in China during 2015–2021. Toxins 2022, 14, 68. [Google Scholar] [CrossRef]
- Hazen, T.H.; Michalski, J.; Luo, Q.; Shetty, A.C.; Daugherty, S.C.; Fleckenstein, J.M.; Rasko, D.A. Comparative genomics and transcriptomics of Escherichia coli isolates carrying virulence factors of both enteropathogenic and enterotoxigenic Escherichia coli. Sci. Rep. 2017, 7, 3513. [Google Scholar] [CrossRef]
- Dadi, B.R.; Abebe, T.; Zhang, L.; Mihret, A.; Abebe, W.; Amogne, W. Distribution of virulence genes and phylogenetics of uropathogenic Escherichia coli among urinary tract infection patients in Addis Ababa, Ethiopia. BMC Infect. Dis. 2020, 20, 108. [Google Scholar] [CrossRef]
- Tabasi, M.; Asadi Karam, M.R.; Habibi, M.; Yekaninejad, M.S.; Bouzari, S. Phenotypic assays to determine virulence factors of uropathogenic Escherichia coli (UPEC) isolates and their correlation with antibiotic resistance pattern. Osong Public Health Res Perspect. 2015, 6, 261–268. [Google Scholar] [CrossRef]
- Farajzadah Sheikh, A.; Goodarzi, H.; Yadyad, M.J.; Aslani, S.; Amin, M.; Jomehzadeh, N.; Ranjbar, R.; Moradzadeh, M.; Azarpira, S.; Akhond, M.R.; et al. Virulence-associated genes and drug susceptibility patterns of uropathogenic Escherichia coli isolated from patients with urinary tract infection. Infect. Drug Resist. 2019, 12, 2039–2047. [Google Scholar] [CrossRef] [PubMed]
- Papagiannitsis, C.C.; Študentová, V.; Jakubů, V.; Španělová, P.; Urbášková, P.; Žemličková, H.; Hrabák, J. High prevalence of ST131 among CTX-M-producing Escherichia coli from community-acquired infections, in the Czech Republic. Microb. Drug Resist. 2015, 21, 74–84. [Google Scholar] [CrossRef] [PubMed]
- Chudejova, K.; Sourenian, T.; Palkovicova, J.; Stredanska, K.; Nechutna, L.; Vlkova, K.; Studentova, V.; Working Group for Monitoring of Antibiotic Resistance; Hrabak, J.; Papagiannitsis, C.C.; et al. Genomic characterization of ST38 NDM-5-producing Escherichia coli isolates from an outbreak in the Czech Republic. Antimicrob. Agents Chemother. 2024, 68, e0013324. [Google Scholar] [CrossRef] [PubMed]
- Zelendova, M.; Papagiannitsis, C.C.; Valcek, A.; Medvecky, M.; Bitar, I.; Hrabak, J.; Gelbicova, T.; Barakova, A.; Kutilova, I.; Karpiskova, R.; et al. Characterization of the Complete Nucleotide Sequences of mcr-1-Encoding Plasmids from Enterobacterales Isolates in Retailed Raw Meat Products from the Czech Republic. Front. Microbiol. 2021, 11, 604067. [Google Scholar] [CrossRef]
- Colinon, C.; Miriagou, V.; Carattoli, A.; Luzzaro, F.; Rossolini, G.M. Characterization of the IncA/C plasmid pCC416 encoding VIM-4 and CMY-4 beta-lactamases. J. Antimicrob. Chemother. 2007, 60, 258–262. [Google Scholar] [CrossRef]
- Patel, G.; Huprikar, S.; Factor, S.H.; Jenkins, S.G.; Calfee, D.P. Outcomes of carbapenem-resistant Klebsiella pneumoniae infection and the impact of antimicrobial and adjunctive therapies. Infect. Control Hosp. Epidemiol. 2008, 29, 1099–1106. [Google Scholar] [CrossRef]
- Louwen, R.; Staals, R.H.; Endtz, H.P.; van Baarlen, P.; van der Oost, J. The role of CRISPR-Cas systems in virulence of pathogenic bacteria. Microbiol. Mol. Biol. Rev. 2014, 78, 74–88. [Google Scholar] [CrossRef]
- Choi, K.R.; Lee, S.Y. CRISPR technologies for bacterial systems: Current achievements and future directions. Biotechnol. Adv. 2016, 34, 1180–1209. [Google Scholar] [CrossRef]
- Gunderson, F.F.; Cianciotto, N.P. The CRISPR-associated gene cas2 of Legionella pneumophila is required for intracellular infection of amoebae. mBio. 2013, 4, e00074-13. [Google Scholar] [CrossRef]
- Louwen, R.; Horst-Kreft, D.; de Boer, A.G.; van der Graaf, L.; de Knegt, G.; Hamersma, M.; Heikema, A.P.; Timms, A.R.; Jacobs, B.C.; Wagenaar, J.A.; et al. A novel link between Campylobacter jejuni bacteriophage defence, virulence and Guillain-Barré syndrome. Eur. J. Clin. Microbiol. Infect. Dis. 2013, 32, 207–226. [Google Scholar] [CrossRef]
- Babu, M.; Beloglazova, N.; Flick, R.; Graham, C.; Skarina, T.; Nocek, B.; Gagarinova, A.; Pogoutse, O.; Brown, G.; Binkowski, A.; et al. A dual function of the CRISPR-Cas system in bacterial antivirus immunity and DNA repair. Mol. Microbiol. 2011, 79, 484–502. [Google Scholar] [CrossRef] [PubMed]
- Makarova, K.S.; Anantharaman, V.; Aravind, L.; Koonin, E.V. Live virus-free or die: Coupling of antivirus immunity and programmed suicide or dormancy in prokaryotes. Biol. Direct 2012, 7, 40. [Google Scholar] [CrossRef] [PubMed]
- Zegans, M.E.; Wagner, J.C.; Cady, K.C.; Murphy, D.M.; Hammond, J.H.; O’Toole, G.A. Interaction between bacteriophage DMS3 and host CRISPR region inhibits group behaviors of Pseudomonas aeruginosa. J. Bacteriol. 2009, 191, 210–219. [Google Scholar] [CrossRef]
- Hatoum-Aslan, A.; Marraffini, L.A. Impact of CRISPR immunity on the emergence and virulence of bacterial pathogens. Curr. Opin. Microbiol. 2014, 17, 82–90. [Google Scholar] [CrossRef] [PubMed]
- Wayne, P.A. Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing. In CLSI 2013, 23rd International Supplement, CLSI document M100-S23; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2013. [Google Scholar]
- Wirth, T.; Falush, R.D.; Lan, F.; Colles, P.; Mensa, L.H.; Wieler, H.; Karch, P.R.; Reeves, M.C.; Maiden, H.; Ochman, H.; et al. Sex and virulence in Escherichia coli: An evolutionary perspective. Mol. Microbiol. 2006, 60, 1136–1151. [Google Scholar] [CrossRef]
- Stepanović, S.; Vuković, D.; Hola, V.; Di Bonaventura, G.; Djukić, S.; Cirković, I.; Ruzicka, F. Quantification of biofilm in microtiter plates: Overview of testing conditions and practical recommendations for assessment of biofilm production by staphylococci. APMIS 2007, 115, 891–899. [Google Scholar] [CrossRef]
- Hamad, P.A. Phenotypic and Molecular Detection of Biofilm Formation in Methicillin-Resistant Staphylococcus Aureus Isolated from Different Clinical Sources in Erbil City. Mediterr. J. Hematol. Infect. Dis. 2023, 15, e2023016. [Google Scholar] [CrossRef]
- Moghaddam, M.; Goldsmith, K.L.; Kerwick, R.A. The preparation of blood grouping serum from human citrated plasma. Vox Sang 1971, 20, 277–280. [Google Scholar] [CrossRef]
- Rakovitsky, N.; Lurie-Weinberger, M.N.; Hameir, A.; Wulffhart, L.; Keren Paz, A.; Schwartz, D.; Carmeli, Y. Phenotypic and Genomic Characterization of Nine String-Positive Carbapenem-Resistant Acinetobacter baumannii Isolates from Israel. Microbiol Spectr. 2023, 11, e0300222. [Google Scholar] [CrossRef]
- Touchon, M.; Charpentier, S.; Clermont, O.; Rocha, E.P.; Denamur, E.; Branger, C. CRISPR distribution within the Escherichia coli species is not suggestive of immunity-associated diversifying selection. J. Bacteriol. 2011, 193, 2460–2467. [Google Scholar] [CrossRef]
- Zankari, E.; Hasman, H.; Cosentino, S.; Vestergaard, M.; Rasmussen, S.; Lund, O.; Aarestrup, F.M.; Larsen, M.V. Identification of acquired antimicrobial resistance genes. J. Antimicrob. Chemother. 2012, 67, 2640–2644. [Google Scholar] [CrossRef] [PubMed]
- Carattoli, A.; Zankari, E.; Garcia-Fernandez, A.; Voldby Larsen, M.; Lund, O.; Villa, L.; Aarestrup, F.M.; Hasman, H. In silico detection and typing of plasmids using PlasmidFinder and plasmid multilocus sequence typing. Antimicrob Agents Chemother. 2024, 58, 3895–3903. [Google Scholar] [CrossRef]
- Malberg Tetzschner, A.M.; Johnson, J.R.; Johnston, B.D.; Lund, O.; Scheutz, F. In Silico Genotyping of Escherichia coli isolates for extraintestinal virulence genes by use of Whole-Genome Sequencing data. J. Clin. Microbiol. 2020, 58, e01269-20. [Google Scholar] [CrossRef] [PubMed]
- Joensen, K.G.; Tetzschner, A.M.; Iguchi, A.; Aarestrup, F.M.; Scheutz, F. Rapid and Easy In Silico Serotyping of Escherichia coli Isolates by Use of Whole-Genome Sequencing Data. J. Clin. Microbiol. 2015, 53, 2410–2426. [Google Scholar] [CrossRef] [PubMed]
- Feil, E.J.; Li, B.C.; Aanensen, D.M.; Hanage, W.P.; Spratt, B.G. eBURST: Inferring patterns of evolutionary descent among clusters of related bacterial genotypes from multilocus sequence typing data. J. Bacteriol. 2004, 186, 1518–1530. [Google Scholar] [CrossRef]
- Abo-Kamar, A.M.; Mustafa, A.A.; Al-Madboly, L.A. Purified α-Amylase from Bacillus cereus exhibits antibiofilm and antiquorum sensing activities against uropathogenic Escherichia coli, Downregulating fimH, and papC virulence genes: Implications for urinary tract infections. BMC Microbiol. 2024, 24, 502. [Google Scholar] [CrossRef]
- Xu, W.Y.; Li, Y.J.; Fan, C. Different loci and mRNA copy number of the increased serum survival gene of Escherichia coli. Can. J. Microbiol. 2018, 64, 147–154. [Google Scholar] [CrossRef]
- Vallejos-Vidal, E.; Fierro-Castro, C.; Santillán-Araneda, M.J.; Goldstein, M.; Reyes-Cerpa, S.; Balasch, J.C.; Khansari, A.R.; Dierckens, K.; Bossier, P.; Tort, L.; et al. The Administration of Heat Shock Protein-70 Bacterial Homolog (DnaK) Improves the Cumulative Survival and the Expression of Immune-Related Genes in Gnotobiotic Full-Sibling Sea Bass Larvae Challenged with Vibrio anguillarum. Animals 2025, 15, 1655. [Google Scholar] [CrossRef]
- Spurbeck, R.R.; Dinh, P.C., Jr.; Walk, S.T.; Stapleton, A.E.; Hooton, T.M.; Nolan, L.K.; Kim, K.S.; Johnson, J.R.; Mobley, H.L. Escherichia coli isolates that carry vat, fyuA, chuA, and yfcV efficiently colonize the urinary tract. Infect. Immun. 2012, 80, 4115–4122. [Google Scholar] [CrossRef]
- Bondì, R.; Chiani, P.; Michelacci, V.; Minelli, F.; Caprioli, A.; Morabito, S. The Gene tia, Harbored by the Subtilase-Encoding Pathogenicity Island, Is Involved in the Ability of Locus of Enterocyte Effacement-Negative Shiga Toxin-Producing Escherichia coli Strains To Invade Monolayers of Epithelial Cells. Infect. Immun. 2017, 85, e00613-17. [Google Scholar] [CrossRef]
- Warner, A.J.; Tokach, M.D.; Carrender, B.; Amachawadi, R.G.; Labbé, A.; Heuser, W.; Coble, K.; DeRouchey, J.M.; Woodworth, J.C.; Goodband, R.D.; et al. Evaluation of a Lactococcus lactis-based dried fermentation product administered through drinking water on nursery pig growth performance, fecal Escherichia coli virulence genes and pathotypes, antibiotic usage, and mortality. Transl. Anim. Sci. 2023, 7, txad093. [Google Scholar] [CrossRef] [PubMed]
- Freire, C.A.; Rodrigues, B.O.; Elias, W.P.; Abe, C.M. Adhesin related genes as potential markers for the enteroaggregative Escherichia coli category. Front. Cell. Infect. Microbiol. 2022, 12, 997208. [Google Scholar] [CrossRef]
- Zhang, M.; Han, W.; Gu, J.; Qiu, C.; Jiang, Q.; Dong, J.; Lei, L.; Li, F. Recent advances on the regulation of bacterial biofilm formation by herbal medicines. Front. Microbiol. 2022, 13, 1039297. [Google Scholar] [CrossRef] [PubMed]
- Mendhe, S.; Badge, A.; Ugemuge, S.; Chandi, D. Impact of Biofilms on Chronic Infections and Medical Challenges. Cureus 2023, 15, e48204. [Google Scholar] [CrossRef]
- Ali, A.; Zahra, A.; Kamthan, M.; Husain, F.M.; Albalawi, T.; Zubair, M.; Alatawy, R.; Abid, M.; Noorani, M.S. Microbial Biofilms: Applications, Clinical Consequences, and Alternative Therapies. Microorganisms 2023, 11, 1934. [Google Scholar] [CrossRef] [PubMed]
- Ong, C.L.; Ulett, G.C.; Mabbett, A.N.; Beatson, S.A.; Webb, R.I.; Monaghan, W.; Nimmo, G.R.; Looke, D.F.; McEwan, A.G.; Schembri, M.A. Identification of type 3 fimbriae in uropathogenic Escherichia coli reveals a role in biofilm formation. J. Bacteriol. 2008, 190, 1054–1063. [Google Scholar] [CrossRef]
- Anderson, G.G.; Palermo, J.J.; Schilling, J.D.; Roth, R.; Heuser, J.; Hultgren, S.J. Intracellular bacterial biofilm-like pods in urinary tract infections. Science 2003, 301, 105–107. [Google Scholar] [CrossRef]
- Eto, D.S.; Sundsbak, J.L.; Mulvey, M.A. Actin-gated intracellular growth and resurgence of uropathogenic Escherichia coli. Cell Microbiol. 2006, 8, 704–717. [Google Scholar] [CrossRef]
- Gagaletsios, L.A.; Tagkalegkas, A.; Bitar, I.; Papagiannitsis, C.C. Exploring virulence characteristics of Klebsiella pneumoniae isolates recovered from a Greek hospital. Mol. Genet. Genomics. 2025, 300, 52. [Google Scholar] [CrossRef]
- Gagaletsios, L.A.; Papagiannitsis, C.C.; Petinaki, E. Prevalence and analysis of CRISPR/Cas systems in Pseudomonas aeruginosa isolates from Greece. Mol. Genet. Genom. 2022, 297, 1767–1776. [Google Scholar] [CrossRef]
- Koonin, E.V.; Makarova, K.S.; Wolf, Y.I. Evolutionary Genomics of Defense Systems in Archaea and Bacteria. Annu. Rev. Microbiol. 2017, 71, 233–261. [Google Scholar] [CrossRef] [PubMed]
- Goman, A.; Ize, B.; Jeannot, K.; Pin, C.; Payros, D.; Goursat, C.; Ravon-Katossky, L.; Murase, K.; Chagneau, C.V.; Revillet, H.; et al. Uncovering a new family of conserved virulence factors that promote the production of host-damaging outer membrane vesicles in gram-negative bacteria. J. Extracell. Vesicles 2025, 14, e270032. [Google Scholar] [CrossRef] [PubMed]
- Chen, M.; Li, Y.; Zhang, J.; Chen, S.; Zhang, Y. Molecular and genetic characteristics of highly virulent Klebsiella pneumoniae in respiratory infection. Chin. J. Hosp. Infect. Dis. 2020, 30, 6–9. [Google Scholar]
- Pradal, I.; Weckx, S.; De Vuyst, L. The production of esters by specific sourdough lactic acid bacteria species is limited by the precursor concentrations. Appl. Environ. Microbiol. 2025, 91, e0221624. [Google Scholar] [CrossRef]
- Al-Shayeb, B.; Sachdeva, R.; Chen, L.X.; Ward, F.; Munk, P.; Devoto, A.; Castelle, C.J.; Olm, M.R.; Bouma-Gregson, K.; Amano, Y.; et al. Clades of huge phages from across earth’s ecosystems. Nature 2020, 578, 425–431. [Google Scholar] [CrossRef]
Primers | Sequence (5′→3′) | References |
---|---|---|
C1Fw | GTTATGCGGATAATGCTACC | [31] |
C1Rev | CGTAYYCCGGTRGATTTGGA | [31] |
C2Fw | AAATCGTATGAAGTGATGCAT | [31] |
C2Rev | GTCGATGCAAACACATAAATA | [31] |
C3Fw | GCGCTGGATAAAGAGAAAAAT | [31] |
C3Rev | GCCCACCATTCACCTGTA | [31] |
C4Fw | CTGAACAGCGGACTGATTTA | [31] |
C4Rev | GTACGACCTGAGCAAAG | [31] |
Ec-Cas1-F | ATGTCTTCGAATTACCTTACG | This study |
Ec-Cas1-R | TCATTGGTCAGCCTTAGCCA | This study |
Ec-Cas2-F | ATGAGTATGGTGGTTGTGGTC | This study |
Ec-Cas2-R | TTATTGATTTTCAACAGGAAGA | This study |
CCs*/STs (Number of Isolates) | Percentage (%) | Source (Number of Isolates) | Department (Number of Isolates) |
---|---|---|---|
CC10 ST10 (1) ST744 (1) | 2% | Blood (1) Urine (1) | Emergency medicine (1) Urology (1) |
ST14 | 1% | Urine (1) | Emergency medicine (1) |
ST58 | 1% | Urine (1) | Emergency medicine (1) |
CC69 ST69 (3) ST922 (3) | 6% | Urine (5) Blood (1) | Internal medicine (2) Neurology (2) Surgery (1) Pediatrics (1) |
CC95 ST95 (1) ST140 (1) ST390 (2) | 4% | Urine (2) Blood (2) | Emergency medicine (3) Pediatrics (1) |
ST104 | 5% | Urine (5) | Emergency medicine (3) Outpatient (1) Endocrinology (1) |
CC131 ST131 (30) ST1195 (1) ST7379 (7) ST7527 (5) ST10605 (2) | 45% | Urine (27) Blood (14) Sputum (1) Pus (2) Unknown (1) | Emergency medicine (22) Internal medicine (14) Urology (4) ICU (2) Rheumatology (1) Surgery (2) |
ST156 | 1% | Blood (1) | Internal medicine (1) |
ST186 | 1% | Urine (1) | Pediatrics (1) |
ST216 | 1% | Blood (1) | Internal medicine (1) |
CC410 ST410 (2) ST3059 (1) | 3% | Urine (3) | Emergency medicine (1) Internal medicine (1) Pediatrics (1) |
ST476 | 2% | Urine (1) Blood (1) | Emergency medicine 2% |
ST501 | 2% | Urine (1) Blood (1) | Internal medicine (1) Outpatient (1) |
ST569 | 2% | Urine (1) Blood (1) | Internal medicine (1) Emergency medicine (1) |
ST646 | 4% | Urine (4) | Emergency medicine (3) Internal medicine (1) |
ST648 | 1% | Swab (1) | Internal medicine (1) |
ST708 | 1% | Urine (1) | Urology (1) |
ST1011 | 1% | Urine (1) | Internal medicine (1) |
ST1133 | 1% | Urine (1) | Internal medicine (1) |
ST1432 | 1% | Urine | Emergency medicine |
ST1538 | 1% | Pus (1) | Urology (1) |
ST2371 | 1% | Urine (1) | Urology (1) |
ST3387 | 1% | Urine (1) | Orthopedics (1) |
ST3423 | 1% | Blood (1) | Pediatrics (1) |
ST3459 | 1% | Urine (1) | Emergency medicine (1) |
ST4077 | 1% | Urine (1) | Internal medicine (1) |
ST4560 | 3% | Urine (1) Blood (2) | Emergency medicine (2) Neurology (1) |
ST5328 | 1% | Urine (1) | Internal medicine (1) |
ST9312 | 1% | Blood (1) | Emergency medicine (1) |
ST9612 | 4% | Urine (2) Blood (2) | Emergency medicine (2) Internal medicine (1) Surgery (1) |
Isolate | Source | Department | ST | Resistance Genes | CRISPR/Cas System | CRISPR 1 | CRISPR 2 |
---|---|---|---|---|---|---|---|
Eco-7702 | Urine | Emergency medicine | 58 | blaTEM-1, aph(3″)-Ib, aph(6)-Id, dfrA5, sul2 | Type I-E | 11 spacers | 13 spacers |
Eco-3191 | Urine | Neurology | 69 | No | Type I-E | 8 spacers | 7 spacers |
Eco-6371 | Urine | Internal medicine | 69 | blaTEM-1, aph(3″)-Ib, aph(6)-Id, dfrA7, sul1, sul2, tetA | Type I-E | 17 spacers | 9 spacers |
Eco-8539 | Blood | Surgery | 69 | blaTEM-1, aph(3″)-Ib, aph(6)-Id, dfrA14, sul2, tet(A), qnrS1 | Type I-E | 17 spacers | 9 spacers |
Eco-7686 | Blood | Emergency medicine | 95 | No | Type I-F | 5 spacers | 4 spacers |
Eco-2829 | Blood | Internal medicine | 156 | blaTEM-1, aac(6′)-Ib3, catB3, dfrA1, mcr1.1, sul1, tet(B) | Type I-E | 18 spacers | 13 spacers |
Eco-8623 | Blood | Internal medicine | 216 | No | Type I-E | 21 spacers | 10 spacers |
Eco-7461 | Urine | Emergency medicine | 390 | No * | Type I-F | 5 spacers | 6 spacers |
Eco-8617 | Blood | Pediatrics | 390 | No * | Type I-F | 8 spacers | 6 spacers |
Eco-2194 | Urine | Outpatient | 501 | blaCTX-M-15, aph(3″)-Ib, aph(6)-Id, mph(A), sul2 | Type I-E | 16 spacers | - |
Eco-6440 | Urine | Internal medicine | 569 | blaTEM-1 | Type I-F | 13 spacers | 7 spacers |
Eco-2000 | Swab | Internal medicine | 648 | blaKPC-2, blaVEB-1, blaOXA-10, blaOXA-1. aac(6′)-Ib-cr, aadA1, aadB, aph(3″)-Ib, aph(6)-Id, arr-2, catB3, cmlA1, dfrA14, dfrA23, sul2, tet(A) | Type I-E | 11 spacers | 16 spacers |
Eco-2258 | Urine | Urology | 708 | No * | Type I-E | 17 spacers | - |
Eco-6443 | Urine | Urology | 744 | blaTEM-1, aac(6′)-Ib, aph(3″)-Ib, aph(6)-Id, aadA2, aadA5, dfrA17, sul1, tet(B) | Type I-E | 5 spacers | 8 spacers |
Eco-3092 | Urine | Internal medicine | 1011 | blaCTX-M-14, aac(3)-IId, aadA1, aadA2, catA1, dfrA1, mph(A), sul, tet(A) | Type I-E | 14 spacers | 7 spacers |
Eco-3095 | Urine | Urology | 2371 | blaCTX-M-14, blaTEM-1 | Type I-F | 14 spacers | 13 spacers |
Eco-2253 | Urine | Internal medicine | 5328 | No | Type I-F | 10 spacers | 6 spacers |
Eco-3281 | Blood | Emergency medicine | 9312 | blaNDM-1, blaCTX-M-15, blaOXA-1, blaTEM-1, aac(6′)-Ib, aph(3″)-Ib, aph(6)-Id, catB3, dfrA14, sul2, tet(A) | Type I-E | 21 spacers | 4 spacers |
Isolate | ST | Serotype | Resistance Genes | Plasmid Replicons | Virulence Genes | CRISPR/Cas System |
---|---|---|---|---|---|---|
Eco-7827 | 10 | O8: H17 | No | IncFIB (AP001918), IncFIC (FII), IncFII (29) | astA, csgA, cvaC, etsC, fimH, fyuA, hlyEF, iroN, irp2, iss, iucC, iutA, mcbA, mchF, nlpI, ompT, papC, terC, traJ, traT, yehABC | - |
Eco-7702 | 58 | O25: H8 | blaTEM-1, aph(3″)-Ib, aph(6)-Id, dfrA5, sul2 | IncFIB (AP001918), IncFII, IncQ | cia, csgA, cvaC, etsC, fdeC, fimH, fyuA, hlyEF, iroN, irp2, iss, iucC, iutA, lpfA, mchF, nlpI, ompT, sitA, terC, traJ, traT, yehABCD | Type I-E |
Eco-3191 | 69 | O17: H18 | No | No | chuA, csgA, eilA, fdeC, fimH, hlyE, iss, kpsE, kpsMII, lpfA, nlpI, ompT, sitA, terC, yehABCD | Type I-E |
Eco-6371 | 69 | O15: H18 | blaTEM-1, aph(3″)-Ib, aph(6)-Id, dfrA7, sul1, sul2, tetA | IncFIA, IncFIB (AP001918), IncFII, IncQ1, Col156, Col440I | air, anr, chuA, colE4, csgA, eilA, fdeC, fimH, fyuA, hylAE, ireA, iroN, irp2, iss, iucC, iutA, kpsE, kpsMII, lpfA, nlpI, ompT, papC, sat, sitA, terC, tiA, traJ, traT, yehABCD | Type I-E |
Eco-8539 | 69 | O15: H18 | blaTEM-1, aph(3″)-Ib, aph(6)-Id, dfrA14, sul2, tet(A), qnrS1 | IncFIA, IncFIB (AP001918), IncFIC (FII) | chuA, csgA, cvaC, eilA, etsC, fdeC, fimH, fyuA, hlyEF, iroN, irp2, iss, iucC, iutA, kpsE, kpsMII, lpfA, mchF, nlpI, ompT, sitA, terC, traT, tsh, yehABCD | Type I-E |
Eco-7686 | 95 | O1: H7 | No | IncFIB (AP001918), IncFII, Col8282 | chuA, cia, csgA, cvaC, etsC, fimH, fyuA, hlyF, ireA, iroN, irp2, iss, iucC, iutA, kpsE, kpsMII, mchF, neuC, nlpI, ompT, papA_F11, papC, sitA, terC, tia, traJ, traT, usp, yehABCD, yfcV | Type I-F |
Eco-2131 | 131 | O25: H4 | blaCTX-M-15, blaOXA-1, blaTEM-1, aac(6′)-Ib-cr, aadA2, aph(3″)-Ib, catA1, dfrA12, dfrA14, mph(A), sul1, sul2, tet(A) | IncB, IncFIB (AP001918), IncFII (pCoo), ColpEC648 | chuA, cib, cma, cvaC, fimH, fyuA, hlyF, iha, iroN, irp2, iss, iucC, iutA, kpsE, kpsMII, nlpI, ompT, sat, terC, traT, yehACD, yfcV | - |
Eco-2180 | 131 | O25: H4 | blaCTX-M-15, blaOXA-1, aac(6′)-Ib-cr, aadA5, catB3, dfrA17, mph(A), sul1 | IncFIA, IncFII, IncI1-I (Alpha) | afaACD, chuA, fimH, fyuA, iha, irp2, iss, iucC, iutA, kpsE, kpsMII, nlpI, ompT, sat, shiA, sitA, terC, traT, yehACD, yfcV | - |
Eco-3096 | 131 | O25: H4 | blaCTX-M-27, aadA5, aph(3″)-Ib, aph(6)-Id, dfrA17, mph(A), sul1, sul2 | IncFIA, IncFIB (AP001918), IncFII(pRSB107), Col156 | chuA, fimH, fyuA, iha, irp2, iss, iucC, iutA, kpsE, kpsMII, nlpI, ompT, sat, senB, sitA, terC, traT, yehACD, yfcV | - |
Eco-3090 | 140 | O50: H5 | blaCTX-M-14, aac(6′)-Ib3, cmlA1, mph(A) | IncFIB (AP001918), IncFIC (FII), IncFII | chuA, csgA, cvaC, dnaK, etsC, fimH, fyuA, hlyF, ibeA, ireA, iroN, irp2, iss, iucC, iutA, kpsE, kpsMII, mchF, neuC, nlpI, ompT, sitA, terC, traJ, traT, usp, yehABCD, yfcV | - |
Eco-2829 | 156 | O159: H28 | blaTEM-1, aac(6′)-Ib3, catB3, dfrA1, mcr1.1, sul1, tet(B) | IncFIB (AP001918), IncFIC (FII), IncX4 | astA, cma, csgA, cvaC, etsC, fdeC, hlyEF, hra, iroN, iss, iucC, iutA, lpfA, nlpI, ompT, sitA, terC, traJ, traT, yehABCD | Type IE |
Eco-8623 | 216 | O3: H4 | No | IncY | clpK1, csgA, etsC, fimH, hlyE, nlpI, terC, | Type I-E |
Eco-2194 | 501 | O86: H4 | blaCTX-M-15, aph(3″)-Ib, aph(6)-Id, mph(A), sul2 | IncFIB (AP001918), IncFII (pRSB107) | aap, aar, aatA, aggABCDR, chuA, csgA, eilA, fyuA, hlyE, irp2, iucC, iutA, kpsE, kpsMII, lpfA, neuC, nlpI, sitA, terC, traT, yehBCD | Type I-E |
Eco-6440 | 569 | O134: H31 | blaTEM-1 | IncFIB (AP001918), IncFII (29), Col156 | chuA, csgA, dhak, fimH, fyuA, ibeA, irp2, kpsE, kpsMII, neuC, nlpI, ompT, senB, sitA, terC, traJ, traT, usp, vat, yehABCD, yfcV | Type I-F |
Eco-2000 | 648 | O45: H6 | blaKPC-2, blaVEB-1, blaOXA-10, blaOXA-1. aac(6′)-Ib-cr, aadA1, aadB, aph(3″)-Ib, aph(6)-Id, arr-2, catB3, cmlA1, dfrA14, dfrA23, sul2, tet(A) | IncB, IncC, IncFIB (H89-PhagePlasmid), IncN, IncY | chuA, csgA, eilA, fyuA, gad, hlyE, irp2, kpsE, lpfA, nlpI, terC, traT, yehBCD, yfcV | Type I-E |
Eco-6443 | 744 | O101: H9 | blaTEM-1, aac(6′)-Ib, aph(3″)-Ib, aph(6)-Id, aadA2, aadA5, dfrA17, sul1, tet(B) | IncFIB (AP001918), IncFIB (K), IncFII, IncFII (K), IncR | cma, csgA, cvaC, himH, hlyEF, ireA, iroN, iss, mchF, nlpI, ompT, sitA, terC, tia, traJ, traT, yehABCD | Type I-E |
Eco-3092 | 1011 | O102: H28 | blaCTX-M-14, aac(3)-IId, aadA1, aadA2, catA1, dfrA1, mph(A), sul, tet(A) | IncFIB (AP001918), IncFIC (FII), IncI1-I (Alpha) | chuA, cvaC, eilA, etsC, fdeC, fimH, hlyEF, iroN, iss, iucC, iutA, mchF, nlpI, ompT, sitA, terC, tia, traJ, traT, tsh, yehBCD | Type I-E |
Eco-3095 | 2371 | O1: H42 | blaCTX-M-14, blaTEM-1 | IncI1-I (Alpha) | chuA, fimH, kpsE, kpsMII, nlpI, terC, yehCD | Type I-F |
Eco-2253 | 5328 | O185: H10 | No | IncFIB (AP001918), IncFIC (FII) | chuA, cia, dhak, etsC, fimH, fyuA, hlyF, ibeA, iroN, irp2, iss, nlpI, ompT, sitA, terC, traJ, traT, vat, yehABCD, yfcV | Type I-F |
Eco-3281 | 9312 | Not found | blaNDM-1, blaCTX-M-15, blaOXA-1, blaTEM-1, aac(6′)-Ib, aph(3″)-Ib, aph(6)-Id, catB3, dfrA14, sul2, tet(A) | IncC, p0111, repB (R1701) | csgA, fimH, gad, hlyE, iss, nlpI, terC, yehABCD | Type IE |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gagaletsios, L.A.; Kikidou, E.; Galbenis, C.; Bitar, I.; Papagiannitsis, C.C. Exploring Virulence Characteristics of Clinical Escherichia coli Isolates from Greece. Microorganisms 2025, 13, 1488. https://doi.org/10.3390/microorganisms13071488
Gagaletsios LA, Kikidou E, Galbenis C, Bitar I, Papagiannitsis CC. Exploring Virulence Characteristics of Clinical Escherichia coli Isolates from Greece. Microorganisms. 2025; 13(7):1488. https://doi.org/10.3390/microorganisms13071488
Chicago/Turabian StyleGagaletsios, Lazaros A., Elisavet Kikidou, Christos Galbenis, Ibrahim Bitar, and Costas C. Papagiannitsis. 2025. "Exploring Virulence Characteristics of Clinical Escherichia coli Isolates from Greece" Microorganisms 13, no. 7: 1488. https://doi.org/10.3390/microorganisms13071488
APA StyleGagaletsios, L. A., Kikidou, E., Galbenis, C., Bitar, I., & Papagiannitsis, C. C. (2025). Exploring Virulence Characteristics of Clinical Escherichia coli Isolates from Greece. Microorganisms, 13(7), 1488. https://doi.org/10.3390/microorganisms13071488