Molecular Typing of Tick-Borne Pathogens in Ixodids of Bosnia and Herzegovina

Abstract

Ticks are key vectors of zoonotic pathogens, and their expanding distribution in Europe heightens public health concerns. In Bosnia and Herzegovina, while tick distribution is well documented, molecular data on tick-borne pathogens remain limited. This study aimed to illustrate the presence and diversity of these pathogens, focusing on areas with high human activity. Ticks (n = 556) were collected in April 2022 from eight diverse locations, including urban parks, private properties, and rural sites. PCR-based screening was employed to detect Anaplasmataceae, Borrelia, Francisella, Piroplasmida, Rickettsia, and tick-borne encephalitis virus (TBEV), with subsequent sequencing to confirm results. Further characterization of Borrelia burgdorferi sensu lato was achieved via reverse line blotting (RLB) hybridization and sequencing. Ixodes ricinus was the most prevalent species, followed by Dermacentor marginatus and D. reticulatus. Our analysis revealed an overall infection rate of 22.1% in questing ticks, with Rickettsia spp. and Borrelia spp. predominating. Notably, seven Borrelia species were identified in I. ricinus, alongside Anaplasma phagocytophilum, Rickettsia helvetica, and R. monacensis, with co-infections mainly observed in peri-urban areas. This study provides the first molecular evidence of multiple tick-borne pathogens in the region, underscoring the need for further surveillance and risk assessment of tick-borne diseases in the region.

1. Introduction

Among all arthropod vectors, ixodid or hard ticks (Acari: Ixodida: Ixodidae) transmit the widest range of pathogens, including protozoa, bacteria, and viruses, posing significant medical and veterinary risks [1]. Hard ticks are widely present in Europe, and climate change is expanding their habitats and thus increasing the risk of regular contact to tick-borne pathogens (TBPs) for both animals and humans [2,3]. The prevalence of TBPs impacting human health has risen significantly over recent decades, reflecting a growing public health challenge [3].

Ixodes ricinus is a three-host tick and the most prevalent tick species throughout the western Palearctic, including Central and (south)eastern Europe. New locations are continuously recorded in Europe [4,5], and endemic areas have reported a notable increase in abundance [6]. Feeding patterns of this species are highly diverse, allowing ticks to feed on various animal species, from small mammals and birds to larger animals, which contributes to the transmission of various pathogens [7,8]. The recent description of Ixodes inopinatus as a distinct species from I. ricinus emphasizes the need for further investigations into its distribution and ecological role. Both species co-exist in overlapping geographical regions, including the Mediterranean basin; however, morphological and molecular identification is challenging [9,10].

The genus Dermacentor comprises 33 species; Dermacentor marginatus and D. reticulatus are the most abundant tick species in the Balkans. Both species quest by latching onto hosts from low vegetation [11]. Dermacentor marginatus commonly targets medium and large mammals including deer, whereas D. reticulatus targets livestock and wildlife, as it is found in open habitats [12,13].

Ixodes ricinus is a highly competent vector for a variety of pathogens, of which the spirochete bacteria Borrelia are the most prevalent. Borrelia burgdorferi s.l. display the most important and the most prevalent tick-borne pathogens in the Northern Hemisphere [14]. Species within the B. burgdorferi s.l. complex, including B. burgdorferi s.s., Borrelia afzelii, and Borrelia garinii, are associated with the progression of Lyme borreliosis (LB) due to their unique pathogenic profiles. Borrelia afzelii is commonly associated with persistent cutaneous symptoms, while B. garinii frequently leads to neurological complications [15,16]. The newly described species B. spielmanii has been identified in a few skin isolates from patients with erythema migrans [17], although its pathogenic potential remains to be fully investigated and confirmed.

Tick-borne encephalitis virus (TBEV) (Flaviviridae) presents a significant public health threat, and infections can cause neurological disorders, including meningitis, encephalitis, and meningoencephalitis [18]. Ixodes ricinus is the key vector for the transmission of the TBE virus across Europe and parts of Central Asia. Among ticks in the genus Dermacentor, the TBEV has also been detected in D. marginatus and D. reticulatus, the latter being a competent vector under experimental conditions [19], expanding its potential transmission range [20].

Other tick-borne bacteria of medical and particularly veterinary relevance are Rickettsia, Anaplasma, and Ehrlichia. The obligate intracellular bacteria of the genus Rickettsia are transmitted by Ixodes and Dermacentor ticks. The latter contributes to the spread of rickettsial pathogens that cause diseases such as spotted fever. Spotted fever group (SFG) Rickettsia spp., namely R. slovaca and R. raoultii, are the causative agents of tick-borne lymphadenopathy (TIBOLA) or Dermacentor-borne necrosis erythema and lymphadenopathy (DEBONEL) [21]. On the other hand, the role of R. monacensis in human disease remains unclear due to its limited pathogenicity despite its occasional detection in human cases [22,23], and the pathogenicity of R. helvetica has been suspected but never proven [24].

The genera Anaplasma, Ehrlichia, and two Neoehrlichia species comprise the intracellular bacteria of the Anaplasmataceae family that are transmitted by ticks to various mammalian hosts, including humans. Species such as Anaplasma phagocytophilum, A. capra, and A. marginale cause anaplasmosis with symptoms including fatigue, fever, and muscle aches; in severe cases, it may lead to complications like immune system dysregulation or reduced platelet levels (thrombocytopenia) [25].

Babesiosis, also known as piroplasmosis, is caused by intraerythrocytic protozoa of the genus Babesia. Symptoms often range from flu-like symptoms such as fever, chills, sweat, and fatigue, with severe cases potentially leading to hemolytic anemia due to red blood cell destruction. The risk of complications is higher in immune-compromised, splenectomised, or elderly individuals [26].

In Balkan countries, data on tick distribution are available, but tick-borne pathogens have been neglected for a long time. Tick surveillance in Bosnia and Herzegovina has demonstrated 19 endemic species [27], of which I. ricinus is the most prevalent species followed by D. marginatus [28]. A few studies, mostly including ticks collected from animals, revealed B. burgdorferi s.l. was predominantly detected in I. ricinus ticks, with detection rates ranging from 2 to 5% depending on the collection site and environmental factors [29]. Similarly, Rickettsia spp., including R. slovaca and R. raoultii, have been detected in Dermacentor and Ixodes ticks, with reported prevalence rates surpassing 10% [30]. Omeragić et al. [29] reported a minimal infection rate of 3.1% for Babesia and 8.8% for A. phagocytophilum in I. ricinus pools. These findings highlight the presence of pathogens in Bosnia and Herzegovina and a dynamic of infection that affects both animals and humans. Although surveys on tick distribution have been conducted, molecular data confirming pathogen presence by PCR and sequencing, particularly from individually analyzed specimens, are scarce but important to assess true prevalence rates. In the current study, we aimed to provide new insights into the prevalence of tick-borne pathogens and analyze sequence data in central and northeastern Bosnia and Herzegovina, particularly at locations with frequent human interaction such as recreational areas.

2. Materials and Methods

2.1. Tick Collection Sites

The survey was conducted at eight different peri-urban and rural collection sites in central and northeastern Bosnia and Herzegovina. Collection sites were chosen based on potential suitability for questing ticks (e.g., uncut grass, meadow/forest intersection) and accessibility (public or private with access granted by owners) in April 2022 (Figure 1). All collection sites were sampled once. The attributes of collection sites are given in

Table 1. Attributes of tick collection sites.

Location	Site	Type	Attributes	Collection Method
BIH1	public	peri-urban	large public recreational park with large meadows and forest close by, sheep close by	flagging, from host
BIH2	agricultural	rural	surroundings of agricultural area with high grass and bushes	flagging
BIH3	private	peri-urban	private property with uncut grass in small garden	flagging
BIH4	private	peri-urban	private property with large meadows and forest close by	flagging
BIH5	private	peri-urban	private property with large meadows and forest close by	flagging
BIH6	public	rural	riverbank along Drina, regular floodings	flagging
BIH7	public	rural	uphill forest around Zvornik castle	flagging
BIH8	private	peri-urban	private property with large meadows and forest close by	flagging

.

Questing ticks were collected using a 1 × 1 m white flannel flag, flagging along predefined transects (on average 10 × 50 m²) for an hour. At location BIH1, sheep close by were additionally sampled (with consent of the owners) by carefully removing engorged ticks from animal hosts using tweezers to ensure specimen integrity. Collected ticks were put in 2 mL tubes with screw caps, stored in dry ice before storage in −80 °C.

2.2. Nucleic Acid Extraction

For nucleic acid extraction, ticks were cut longitudinally into two halves. From one half, DNA was isolated using a DNeasy^® Blood and Tissue Kit (Qiagen, Hilden, Germany) by incubating in 180 µL ATL buffer and 20 µL proteinase K overnight following the manufacturer’s instructions.

For RNA isolation, halves of ticks were pooled (maximum of six individuals), sorted by location and sex. To each pool, 180 µL phosphate-buffered saline (PBS) was added and crushed with 3 mm stainless steel beads for 5 min at 6000× g with a Qiagen TissueLyser LT (Qiagen, Hilden, Germany). The homogenate was centrifuged at 18,000× g for 5 min, and the supernatant was transferred to a new tube. Consecutively, a Qiagen RNeasy Mini Kit (Qiagen, Hilden, Germany) was used, adding 560 µL of AVL-AVE Lysis buffer (containing RNA carrier) to the homogenate, followed by 350 µL of 70% ethanol, only mixing by pipetting. Subsequent steps were performed based on the manufacturer’s instructions, with a 50 µL final elution volume. The RNA eluate was stored at −20 °C until further use.

2.3. Morphological and Molecular Tick Identification

The morphological identification of ticks was performed under a stereomicroscope using the identification keys from Estrada-Peña et al. [31]. Due to morphological and genetic discrepancies between I. ricinus and I. inopinatus, we refer to I. ricinus sensu lato in this study.

The molecular identification of chosen ticks was based on the amplification of a 16S rRNA gene segment using the primer combination 16S+1 (5′-CTGCTCAATGATTTTTTAAATTGCTGTGG-3′) and 16S-1 (5′-CCGGTCTGAACTCAGATCAAGT-3′) by Black and Piesman [32]. The PCR conditions were 94 °C for 5 min for initial denaturation, followed by 38 cycles of 94 °C for 1 min, 52 °C for 1 min, and 72 °C for 1 min, with a final elongation at 72 °C for 10 min. For all PCR amplifications, the 2× EmeraldAmp^® GT PCR Master Mix (Takara Bio Europe, Paris, France) was used with 2 μL template DNA and sterile H₂O, adding up to a final volume of 25 μL. Reactions were run on an Eppendorf Mastercycler (Eppendorf AG, Hamburg, Germany). Bands were analyzed with a Gel DocTM XR+ Imager (Bio-Rad Laboratories, Inc., Hercules, CA, USA), cut out and subsequently purified with the IllustraTM GFXTM PCR DNA and Gel Purification Kit (GE Healthcare, Buckinghamshire, UK); then, they were sent to Microsynth Austria GmbH for Sanger sequencing.

Sequences were obtained from both strands, aligned with Clustal X 2.1 [33], and a consensus sequence was generated in GenDoc 2.7.0 [34]. The obtained sequences were uploaded to GenBank and compared to available sequences in the GenBank database using the Basic Local Alignment Search Tool (BLAST) (https://blast.ncbi.nlm.nih.gov/Blast.cgi; accessed on 25 March 2025).

2.4. DNA-Based Pathogen Detection

Samples were screened for the presence of Anaplasmataceae, Borrelia, Francisella, Piroplasmida, and Rickettsia DNA. For the detection of pathogen DNA, published protocols were used (

Table 2. PCR protocols for DNA-based pathogen detection.

Pathogen, Target Gene (Length)	Primer Sequence (5′-3′)	PCR Protocol	References
Anaplasmataceae 16S rRNA gene (345 bp)	EHR16SD-for: GGTACCYACAGAAGAAGTCC EHR16SR-rev: TAGCACTCATCGTTTACAGC	95 °C/2 min; 35×: 94 °C/1 min, 54 °C/30 s, 72 °C/30 s; 72 °C 5 min	[35,36]
Anaplasma spp. typing A. capra groEL gene (874 bp)	groEL for: TGAAGAGCATCAAACCCGAAG groEL rev: CTGCTCGATGCTATCGG	94 °C/5 min; 35×: 94 °C/30 s, 63 °C/30 s, 72 °C/1 min; 72 °C 10 min	[37]
A. bovis groEL gene (529 bp)	groEL for: GTGGGATGTACTGCTGACC groEL rev: ATGGGGAGATATCCGCGA	94 °C/5 min; 35×: 94 °C/30 s, 63 °C/30 s, 72 °C/1 min; 72 °C 10 min	[38]
A. ovis msp4 gene (347 bp)	msp4 for: TGAAGGGAGCGGGTCATGGG msp4 rev: GAGTAATTGCAGCCAGGCACTCT	94 °C/5 min; 35×: 94 °C/30 s, 63 °C/30 s, 72 °C/1 min; 72 °C 10 min	[39]
A. phagocytophilum 16S rRNA gene (172 bp)	16S-for: AGTGCTGAATGTGGGGATAATTTATCTCCGTG 16S-rev: CTAATCTCCATGTCAAGAGTGGTAAGGTTT	94 °C/5 min; 35×: 94 °C/30 s, 63 °C/30 s, 72 °C/1 min; 72 °C 10 min	[38]
Borrelia spp. 16S rRNA gene (674 bp)	BORR_ALLG_for: ACGCTGGCAGTGCGTCTT BORR_ALLG_rev: CTGATATCAACAGATTCC	94 °C/5 min; 40×: 94 °C/1.5 min, 63 °C/2 min, 72 °C/2 min; 72 °C 10 min	[40]
B. garinii/ B. bavariensis typing * clpA gene (849 bp) clpA gene (706 bp)	clpAF1237: AAAGATAGATTTCTTCCAGAC clpAR2218: GAATTTCATCTATTAAAAGCTTTC clpAF1255: GACAAAGCTTTTGATATTTTAG clpAR2104: CAAAAAAAACATCAAATTTTCTATCTC	98 °C/1 min; 10×: 98 °C/5 s, (60–1 °C/cycle)/5 s, 72 °C/15 s; 40×: 98 °C/5 s, 50 °C/5 s, 72 °C/15 s; 72 °C 1 min 98 °C/1 min; 10×: 98 °C/5 s, (60 –1 °C/cycle)/5 s, 72 °C/15 s; 45×: 98 °C/5 s, 50 °C/5 s, 72 °C/15 s; 72 °C 1 min	[41]
Francisella 16S rRNA gene (400 bp)	TUL4-435: GCTGTATCATCATTTAATAAACTGCTG TUL4-863: TTGGGAAGCTTGTATCATGGCACT	94 °C/5 min; 40×: 94 °C/1 min, 54 °C/1 min, 72 °C/1 min; 72 °C/10 min	[42]
Piroplasmida * 18S rRNA gene (700 bp) 18S rRNA gene (561 bp)	BTH-1F: CCTGAGAAACGGCTACCACATCT BTH-1R: TTGCGACCATACTCCCCCCA GF2: GYYTTGTAATTGGAATGATGG GR2: CCAAAGACTTTGATTTCTCTC	94 °C/2 min; 40×: 95 °C/30 s, 68 °C/1 min, 2 °C/1 min; 72 °C 10 min 94 °C/2 min; 40×: 95 °C/30 s, 60 °C/1 min, 72 °C/1 min; 72 °C 10 min	[43,44]
Rickettsia 23S/5S rRNA gene (350–550 bp)	ITS_F: GATAGGTCGGGTGTGGAAG IST_R: TCGGGATGGGATCGTGTG	96 °C/4 min; 35×: 94 °C/1 min, 52 °C/1 min, 72 °C/2 min; 72 °C 3 min	[45]

* Nested PCR.

). Negative controls (H₂O) and respective positive controls (DNA at our disposal of Anaplasma marginale originating from bovine blood, Borrelia burgdorferi s.s. B31 strain, Babesia venatorum originating from I. ricinus, Rickettsia raoultii Jongejan strain, and Francisella tularensis subsp. holarctica) were used in each PCR run.

2.5. RNA-Based Pathogen Detection

A reverse transcriptase (RT) qPCR with the “universal” flavivirus primer set PF1S (5′-TGYRTBTAYAACATGATGGG-3′) and PF2Rbis (5′-GTGTCCCADCCDGCDGTRTC-3′) and the Luna^® Universal One-Step RT-qPCR Kit (New England Biolabs, Ipswich, MA, USA) was used to detect TBEV RNA [46]. For all reactions, 2.5 µL of RNA template was used with the following PCR conditions: 55 °C for 10 min, followed by 45 cycles of 95 °C for 1 min, 95 °C for 10 s, and 50 °C for 1 min. Sterile H₂O was used as a negative control, and RNA extracted from a live Yellow fever virus vaccine (Stamaril^®, Sanofi, Paris, France) was used as a positive control.

2.6. Borrelia Burgdorferi Sensu Lato Species Discrimination by Reverse Line Blotting (RLB)

All samples positive for B. burgdorferi s.l. by PCR were subjected to PCR-RLB hybridization. A genus-specific RLB-PCR was carried out as reported previously [47,48], using the biotinylated primer pairs shown in Table 1. Each PCR reaction mix with a 25 μL total volume contained the following: 5 μL (5×) of Phire reaction buffer, 200 nmol/L of each dNTP (Solis BioDyne, Tartu, Estonia), 400 nmol/L of each primer per specific primer pair, 0.125 μL Phire Hot Start II DNA Polymerase (Thermo Scientific, Vienna, Austria), PCR-grade water (Sigma-Aldrich, Vienna, Austria), and 2.5 μL of template DNA [49]. The resulting amplicons were analyzed using RLB hybridization as described previously [50].

The further discrimination of B. garinii and B. bavariensis was achieved by amplification and sequencing of the housekeeping gene clpA [41]. A nested PCR was carried out using the primer pairs shown in Table 1. Each PCR reaction was prepared in a total of 25 μL volume containing the following: 5 μL (5×) of Phire reaction buffer, 200 nmol/L of each dNTP (Solis BioDyne, Tartu, Estonia), 400 nmol/L of each primer per specific primer pair (first reaction: clpAF1237 and clpAR2218 and second reaction: clpAF1255 and clpAR2104), 0.5 μL Phire Hot Start II DNA Polymerase (Thermo Scientific, Vienna, Austria), PCR-grade water (Sigma-Aldrich, Vienna, Austria), and lastly 2.5 μL of template DNA. Bands were analyzed with iBright CL750 Imaging System (Thermo Fisher Scientific, Vienna, Austria), cut out, and subsequently purified using QIAquick Gel Extraction kit (Qiagen, Hilden, Germany); then, they were sent to sequencing at Microsynth (Microsynth AG, Vienna, Austria).

2.7. Statistical Analysis

All data were analyzed using Microsoft Excel 16.82 for Mac and R 3.6.2 [51]. Due to the heterogeneity of prevalence rates between locations and the low number of Dermacentor spp., we refrained from further statistical analyses.

3. Results

3.1. Tick Collection

Overall, 556 ticks were collected, comprising three species from eight locations. Of these, 511 (91.9%) were Ixodes ricinus, 42 (7.6%) were Dermacentor marginatus, and 3 (0.5%) were D. reticulatus. Of all, 507 (91.2%) specimens were questing, 16 (2.9%) were unfed from a host, and 33 (5.9%) were engorged females (

Table 3. Number of collected ticks by species, sex, and developmental stage.

	Nymph		Female			Male
	Questing	Host	Questing	Host a	Engorged b	Questing	Host
I. ricinus	211	-	152	-	16	132	-
D. marginatus	-	-	7	-	17	2	16
D. reticulatus	-	-	3	-	-	-	-
Total	211	0	162	0	33	134	16

^a Unfed, collected from host. ^b Attached to host and fed.

). Only I. ricinus and D. marginatus were collected from host animals, which were sheep exclusively at location BIH1 (Stojčevac public park).

Ixodes ricinus was collected at seven locations, except an open agricultural field (BIH2), and numbers varied considerably between locations. Dermacentor marginatus was sampled at three locations (engorged at BIH1 from sheep close to public park, questing at BIH2 open agricultural field, and BIH8 private property) and D. reticulatus collected at only one location (questing at BIH2 private property) (

Table 4. Sampled tick species by location.

	BIH1	BIH2	BIH3	BIH4	BIH5	BIH6	BIH7	BIH8	Total
I. ricinus	72	-	5	196	148	3	46	41	511
D. marginatus	34	6	-	-	-	-	-	2	42
D. reticulatus	-	3	-	-	-	-	-	-	3
Total	106	9	5	196	148	3	46	43	556

).

At location BIH1, I. ricinus and D. marginatus were both collected from sheep, and sympatric occurrence of questing D. marginatus and D. reticulatus was observed at location BIH2 (open agricultural field) (Table 4).

3.2. Tick Barcoding

Altogether, 16S rDNA barcoding of 70 specimens was performed. All barcodes allowed for identification to the species level. Haplotyping revealed no genetic pattern associated with geographical origin. Twenty-three I. ricinus sequences with a length of 406 to 408 base pairs (bp) resulted in 12 haplotypes, all showing 99.75% to 100% identity with various I. ricinus sequences originating, e.g., from Poland (MK671578), Slovakia (MN947216), and Portugal (KY039161). Thirty-four barcodes with a length of 414 to 416 bp were obtained from D. marginatus, divided into eight haplotypes, which showed 99.76% to 100% identity with sequences from China (OM368304), Turkey (MT229170), and Spain (MH645513). All three D. reticulatus sequences with a length of 403 bp displaying a single haplotype were 100% identical to reference sequences from Russia (OR936112) and Poland (MK671579) (

Table 5. Generated barcodes, haplotypes, and accession numbers of ticks from BIH.

Species	Barcodes	Haplotypes	Accession Numbers	BLAST Identity
I. ricinus	23	12	PV203446 to PV203468	99.75% (MK671578) to 100% (KY039161)
D. marginatus	34	8	PV203469 to PV203502	99.52% (OM368304) to 100% (MT229170)
D. reticulatus	3	1	PV203503 to PV203505	100% (OR936112)

).

3.3. DNA-Based Pathogen Screening

Altogether, 112 (112/507; 22.1%) questing ticks, nine (9/16; 56.3%) unfed ticks collected from hosts, and four (4/33; 12.1%) engorged ticks were positive for at least one pathogen. Double infections were detected in questing ticks (11/507; 2.2%) and unfed ticks from hosts (2/16; 12.5%), and triple infections (5/507; 1.0%) were only from questing I. ricinus ticks (

Table 6. Detected pathogens by feeding status.

Status	Negative	Positive	Single	Double	Triple
questing (507)	395 (77.9%)	112 (22.1%)	105 (20.6%)	11 (2.2%)	5 (1.0%)
unfed from host (16)	7 (43.8%)	9 (56.3%)	7 (43.8%)	2 (12.5%)	-
engorged (33)	33 (87.9%)	4 (12.1%)	4 (12.1%)	-	-

).

Of 495 questing Ixodes ricinus specimens, 108 (21.1%) were infected with at least one pathogen, 13 (2.5%) were infected with two pathogens, and 5 (1.0%) with three pathogens (Table 6). Of all 16 engorged female I. ricinus collected from sheep, only one (6.3%) was infected with R. monacensis. The highest single infection rates were observed for Rickettsia (58/511; 11.4%) and Borrelia (39/511; 7.9%), followed by Anaplasma (15/511; 2.9%) and Neoehrlichia mikurensis (1/511; 0.2%) (

Table 7. Single pathogens and co-infections detected in questing I. ricinus ticks.

Pathogen	Nymphs (n = 211) a	Female (n = 152) a	Male (n = 132) a	Total (n = 495) b
Single infection
A. phagocytophilum	3 (1.4%)	8 (5.3%)	4 (3.0%)	15 (3.0%)
B. burgdorferi s.l. c	1 (0.5%)	-	-	1 (0.2%)
B. afzelii	2 (1.0%)	5 (3.3%)	3 (2.3%)	10 (2.0%)
B. burgdorferi s.s.	8 (3.8%)	4 (2.6%)	2 (1.5%)	14 (2.8%)
B. garinii	1 (0.5%)	-	1 (0.8%)	2 (0.4%)
B. lusitaniae	2 (1.0%)	9 (5.9%)	7 (5.3%)	18 (3.6%)
B. spielmanii	-	-	2 (1.5%)	2 (0.4%)
B. valaisiana	2 (1.0%)	1 (0.7%)	2 (1.5%)	5 (1.0%)
B. miyamotoi	2 (1.0%)	-	-	2 (0.4%)
N. mikurensis	1 (0.5%)	-	-	1 (0.2%)
R. helvetica	11 (5.2%)	17 (11.2%)	14 (10.6%)	42 (8.5%)
R. monacensis	7 (3.3%)	3 (2.0%)	6 (4.6%)	16 (3.2%)
Double infection
B. burgdorferi s.s. + B. valaisiana	1 (0.5%)	-	-	1 (0.2%)
B. burgdorferi s.s. + B. afzelii	-	1 (0.7%)	-	1 (0.2%)
B. burgdorferi s.s. + B. lusitaniae	-	1 (0.7%)	1 (0.8%)	2 (0.4%)
B. afzelii + B. lusitaniae	-	2 (1.3%)	-	2 (0.4%)
B. lusitaniae + B. valaisiana	-	-	1 (0.8%)	1 (0.2%)
B. burgdorferi s.s. + N. mikurensis	1 (0.5%)	-	-	1 (0.2%)
B. lusitaniae + R. helvetica	-	1 (0.7%)	2 (1.5%)	3 (0.6%)
Triple infection
B. burgdorferi s.s. + B. afzeli + B. lusitaniae	2 (1.0%)	-	-	2 (0.4%)
B. afzeli + B. valaisiana + B. spielmanii	-	-	1 (0.8%)	1 (0.2%)
R. monacensis + B. burgdorferi s.s. + B. lusitaniae	-	-	1 (0.8%)	1 (0.2%)
A. phagocytophilum + B. burgdorferi s.s. + B. lusitaniae	-	1 (0.7%)	-	1 (0.2%)

^a No. and % of infected stage. ^b Total no. and % infected. ^c Not further discriminated by RLB.

).

For Anaplasma, only A. phagocytophilum was detected, with highest rates in female ticks (4.8%). Borrelia comprised B. burgdorferi s.l. (37/511; 7.2%), as well as B. miyamotoi (2/511; 0.4%). One sample (nymph) was positive for Neoehrlichia mikurensis (0.2%), and Rickettsia positive samples were split into R. helvetica (42/511; 8.2%) and R. monacensis (16/511; 3.3%) (Table 7).

Further discrimination of B. burgdorferi s.l. by RLB revealed six species, namely B. afzelii (10/511; 2.0%), B. burgdorferi s.s. (14/511; 2.7%), B. garinii (2/511; 0.4%), B. lusitaniae (18/511; 3.5%), B. spielmanii (2/511; 0.4%), and B. valaisiana (5/511; 1.0%) (Table 7).

The majority of double infections (7/11; 63.6%) detected in I. ricinus comprised two B. burgdorferi s.l. species, as well as three (3/11; 27.2%) B. lusitaniae + R. helvetica infections and one (1/11; 9.0%) B. burgdorferi s.s. + N. mikurensis infection (Table 7). Triple infections involved several B. burgdorferi s.l. species, A. phagocytophilum, and R. monacensis.

Neither Babesia/Theileria or Francisella DNA nor flavivirus RNA were detected in the samples.

In D. marginatus, five (5/16; 31.3%) male specimens collected from hosts were positive for A. ovis and three (3/7; 42.9%) questing females, three (3/17; 17.6%) unengorged females, and four (4/16; 25.0%) males from a host were positive for R. raoultii. One (1/7; 14.3%) questing female and two (2/16; 12.5%) males collected from a host were positive for R. slovaca. Double infections were only detected in males collected from a host, which comprised one (1/16; 6.3%) A. ovis + R. raoultii co-infection and one (1/16; 6.3%) A. ovis + R. slovaca infection.

Of the three D. reticulatus specimens collected questing, one (1/3; 33.3%) was infected with R. raoultii.

As a byproduct of the Anaplasmataceae PCR, Wolbachia spp. and Candidatus Midichloria mitochondrii DNA were detected and sequenced. In 25 of 507 (4.9%) questing I. ricinus, Wolbachia spp. DNA was detected, but only in ticks from location BIH4 (9/187; 4.8%) and BIH5 (16/132; 12.1%). The majority of Wolbachia spp. DNA was detected in nymphs (23/211; 10.9%) and only few females (1/152; 0.7%) and males (1/132; 0.8%). All Wolbachia sp. sequences showed highest similarity with Wolbachia subgroup A. Additionally, in six (6/152; 4.0%) questing female I. ricinus, Candidatus Midichloria mitochondrii DNA was detected.

3.4. Detected Pathogens by Location

While maintaining the same collection effort at all eight locations, the number of ticks and the number of detected pathogens varied considerably between locations. At two locations (BIH3 a private house with small garden and BIH6 along Drina riverbank), no pathogens were detected. At location BIH2 (around agricultural field), only Dermacentor spp. were detected, being infected with R. raoultii and R. slovaca (Supplementary Table S1). The highest diversity of pathogens in questing I. ricinus was detected at location BIH4 (10 pathogens), followed by location BIH5 (eight pathogens) and location BIH1 (seven pathogens), with all three peri-urban collection sites exhibiting the interface of meadows and mixed forests (Figure 2). Also, double and triple infections (BIH1 and BIH4) were only detected in I. ricinus from these three sites (Table S1).

3.5. Pathogen Typing

Sequences of pathogens were uploaded to GenBank and compared to available reference sequences. All 14 A. phagocytophilum sequences comprised a single haplotype, showing 100% identity with reference sequences originating from ticks (I. ricinus, MW922753; I. scapularis, HG916766; or R. sanguineus sensu lato, OR976127) and animals such as dogs (MK814412), horses (MK811374), or rats (OL690564). For A. ovis, the confirmatory PCR based on the major surface protein 4 (msp4) gene showed 100% identity with isolates from sheep in Pakistan (PQ616034) or China (MH908943) (

Table 8. Generated sequences, haplotypes, and accession numbers of detected pathogens.

Pathogen	Sequences	Haplotypes	Accession Numbers	BLAST Identity
A. phagocythophilum	14	1	PV203568 to PV203581	100% (MW922753, HG916766, OL690564)
A. ovis a	5	1	PV203582 to PV203586	100% (PQ616034, MH908943)
B. myamotoi	1	1	PV203587	100% (KJ847049, KF422749).
N. mikurensis	1	1	PV203588	100% (OP269946, OP269947)
R. monacensis	6	2	PV231331 to PV231336	99.71% to 100% (JQ796867, LN794217)
R. helvetica	4	2	PV231337 to PV231340	99.8% to 100% (JQ796866, EU057990)
R. raoultii	5	1	PV231341 to PV231345	100% (CP010969)
R. slovaca	3	1	PV231346 to PV231348	100% (MN581971, AY125009)

^a Sequences confirmed by PCR based on major surface protein 4 (msp4) gene.

).

For Borrelia, only B. myamotoi was subjected to sequence analysis, revealing 100% identity with reference sequences originating from I. ricinus in Czech Republic (KJ847049) and Poland (KF422749). Typing of B. burgdorferi s.l. species was accomplished by RLB only due to low specificity of the applied PCR.

A single sequence of N. mikurensis showed 99.26% identity to Candidatus Neoehrlichia sp. (OP269946, OP269947) and 98.9% identity to the sequence of the Ca. Neoehrlichia mikurensis reference genome (CP066557).

For Rickettsia, six R. monacensis sequences comprising two haplotypes were 99.71% to 100% identical to a strain from Poland (JQ796867) and the type strain (LN794217). Four R. helvetica sequences comprising two haplotypes showed 99.8% to 100% identity to reference sequences from Poland (JQ796866) and Austria (EU057990). Five R. raoultii sequences consisting of a single haplotype showed 100% identity to the “Khabarovsk” strain (CP010969), and three R. slovaca sequences (single haplotype) were 100% identical to strains from Pakistan (MN581971) and Portugal (AY125009) (Table 8).

4. Discussion

Our study provides a snapshot and a valuable cross-section through tick-borne pathogens in local tick populations from central and northeastern Bosnia and Herzegovina, thereby demonstrating a high diversity of pathogens. Ixodes ricinus, the predominant tick species in the area, showed an infection rate of more than 20% with at least one pathogen, including co-infections (2.5%) and triple infections (1.0%). We provide the first molecular data on Borrelia genotyping in the region, identifying six distinct B. burgdorferi sensu lato genospecies in addition to B. myamotoi.

4.1. Pathogens in Questing Ticks

Previous studies in Bosnia and Herzegovina have confirmed the presence of B. burgdorferi s.l.; however, the identification of specific genospecies has been limited. Omeragić et al. [29] conducted molecular screening of tick-borne pathogens in I. ricinus ticks, detecting B. burgdorferi s.l. in 3.4% of specimens exclusively in those collected from domestic animals. On the contrary, our study is the first to report the presence of six distinct species within the B. burgdorferi complex in this region, namely B. afzelii, B. garinii, B. burgdorferi s.s., B. lusitaniae, B. spielmanii, B. valaisiana, and additionally B. miyamotoi, a relapsing fever spirochete considered an emerging human pathogen [52]. Among the genospecies that infect humans, B. burgdorferi s.s., B. afzelii, and B. garinii are the primary agents of Lyme borreliosis in Europe [53,54]. Recently, Lasić et al. [55] detected B. burgdorferi s.l. in I. ricinus ticks collected from patients in Sarajevo, the capital of Bosnia and Herzegovina, and recent data from the Institute of Public Health [56] indicate a rising trend in reported Lyme borreliosis cases.

In Bosnia and Herzegovina, previous studies have identified the presence of Rickettsia species in ticks. For instance, Omeragić et al. [29] detected Rickettsia spp. in ticks collected from cats, sheep, goats, and dogs, while all ticks collected from vegetation tested negative. In contrast, our study found the highest Rickettsia spp. positivity rates in ticks sampled by flagging, with R. helvetica (8.2%) as the most prevalent, followed by R. monacensis (3.3%). This is in line with Hodžić et al. [57], who reported R. helvetica (5.7%) and R. monacensis (1.1%) in questing I. ricinus in the region. The molecular detection of Rickettsia spp. was reported in patients with a history of tick bites who sought medical care, confirming the presence of R. helvetica, R. monacensis, and R. felis, highlighting their potential pathogenicity in humans [58]. Boretti et al. [59] assessed the public health significance of R. helvetica, detecting the pathogen in dogs, foxes, humans, and Ixodes ticks. Rickettsia helvetica infections in humans manifest as a non-specific febrile illness and in more severe cases, R. helvetica-associated meningitis has been reported [60,61]. On the other hand, R. monacensis infections can present with fever, rash, or headache, though their full clinical spectrum remains incompletely understood [62].

DNA of A. phagocytophilum was detected in 3% of questing I. ricinus, contrary to a recent study by Omeragić et al. [29], who reported absence in pools of questing adult I. ricinus. However, the presence of A. phagocytophilum DNA was recently confirmed in various animal hosts, as well as in ticks collected from dogs across all regions of BIH, with infections ranging from 0.9 to 23.8% [29]. As an emerging tick-borne pathogen, A. phagocytophilum represents a significant veterinary and public health concern [63]. The low A. phagocytophilum infection rates observed in this study are in line with previous findings in Bosnia and Herzegovina [57] and more broadly across Eastern Europe. Although there are no officially reported human cases of A. phagocytophilum infections, the presence of Anaplasma spp. has been confirmed in blood samples collected from stray dogs in Bosnia and Herzegovina [64], which highlights the need for further surveillance and awareness of this emerging pathogen, particularly given its zoonotic potential [63] and the role of domestic animals as potential reservoirs. Neoehrlichia mikurensis was detected in only a single I. ricinus tick, highlighting its rare occurrence in the sampled tick population. This emerging tick-borne pathogen is of clinical relevance, particularly in immunocompromised individuals [65].

We report the detection of Wolbachia spp. and Candidatus Midichloria mitochondrii as a rather incidental finding while screening for TBPs of the genera Anaplasma and Ehrlichia, suggesting that the true prevalence of these symbionts might be higher if specific PCR assays were employed. Wolbachia subgroup A in ticks is typically associated with insect endoparasitoids like Ixodiphagus hookeri, which parasitize ticks, leading to incidental detection in tick samples [66]. Midichloria species are known endosymbionts of ticks, residing in ovarian tissues and occasionally in salivary glands, with potential implications for tick biology and pathogen transmission [67].

4.2. Co-Infections

Double and triple co-infections with Borrelia spp. or other tick-borne pathogens are more common in I. ricinus due to its diverse host range, and they may exacerbate disease severity in infected individuals [68,69,70]. In the present study, Borrelia-infected ticks were exclusively collected from peri-urban locations with frequent human presence, aligning with the findings on I. ricinus ticks collected from peri-urban locations in Kosovo [71]. The proximity to forested areas, the presence of wildlife species, and the presence of stray dogs likely contribute to the maintenance and transmission of Borrelia spp. and other tick-borne pathogens [72].

4.3. Pathogen Absence

Interestingly, no Babesia spp. DNA was detected in the analyzed tick samples, aligning with previous studies that reported low prevalence or sporadic detection in the region [73]. While I. ricinus is a known vector of Babesia spp., with human infections reported in Europe, its circulation in Bosnia and Herzegovina remains poorly characterized. Similarly, no evidence of tick-borne encephalitis virus (TBEV) was found, which may be attributed not only to inactive TBEV foci and a lower risk of transmission in the sampled areas but also to the relatively low number of ticks examined, given that TBEV infection rates in ticks are typically < 1:1000. However, considering the particular focal distribution of the TBEV and the endemic presence in neighboring countries, continued surveillance is crucial for assessing potential spillover risks [74,75].

4.4. Sympatric Occurrence of Dermacentor spp.

We observed sympatric occurrences of both D. marginatus and D. reticulatus species questing at the same locations, a phenomenon that has been documented in other regions. For instance, Drehmann et al. [76] reported overlapping distributions of these species across Germany, suggesting potential ecological interactions and shared habitats. While previous research confirms the presence of both Dermacentor species, Omeragić et al. [28] also noted that the previously registered abundance of D. marginatus had nearly doubled. In our study, A. ovis was detected in 31.3% of male D. marginatus ticks from hosts, while R. raoultii and R. slovaca were identified in both questing and host-collected ticks.

4.5. Differences in Pathogen Diversity

The absence or low diversity of tick-borne pathogens in rural locations may be attributed to limited sample sizes, reducing the likelihood of encountering infected ticks. However, pathogen prevalence is not solely dependent on sample size; host-related factors, including the availability, density, and reservoir competence of the main tick hosts also play a crucial role in pathogen circulation [77,78]. For instance, despite similar trapping effort, tick density and pathogen prevalence varied between the peri-urban and rural settings, as the difference in habitat supports distinct wildlife reservoirs and host communities, which affect tick feeding and infection cycles [72,79]. Low pathogen detection in certain locations may be attributed to the absence of key reservoir hosts, reducing pathogen circulation in local tick populations [6]. Areas with fragmented landscapes and lower host densities have been linked to decreased infection rates in ticks [80]. Additionally, climatic factors such as temperature, precipitation, and humidity play a crucial role in tick survival and pathogen transmission. For example, one site with few collected specimens and no pathogen detection in this study was located along the Drina River, where periodic flooding may disrupt tick activity and reduce pathogen persistence in the environment [81,82].

5. Conclusions

Despite sampling only once per location within a single year and the collection sites being heterogeneous, potentially influencing pathogen detection rates, our findings underscore the veterinary and medical significance of tick-borne pathogens in Bosnia and Herzegovina, particularly Borrelia species (including cases of co-infection), A. phagocytophilum, N. mikurensis, and Rickettsia spp., all of which were detected in our study. Continuous surveillance is essential, especially in recreational areas, where human–tick encounters are frequent, to monitor the dynamics of TBP circulation. Future research should aim for longitudinal sampling over multiple seasons across diverse habitats to better understand the dynamics of tick-borne diseases and their implications for public health and veterinary medicine.