Next Article in Journal
Assessment of Soil Health Through Metagenomic Analysis of Bacterial Diversity in Russian Black Soil
Previous Article in Journal
Staphylococcus aureus Biofilm-Associated Infections: Have We Found a Clinically Relevant Target?
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Microorganisms
Volume 13
Issue 4
10.3390/microorganisms13040853
microorganisms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Expression and Antagonistic Activity Against Plant Pathogens of the Phage Tail-like Protein from Burkholderia multivorans WS-FJ9

by
Tong-Yue Wen
1,2,†,
Xing-Li Xie
1,2,†,
Wei-Liang Kong
1,2 and
Xiao-Qin Wu
1,2,*
1
Co-Innovation Center for Sustainable Forestry in Southern China, College of Forestry, Nanjing Forestry University, Nanjing 210037, China
2
Jiangsu Key Laboratory for Prevention and Management of Invasive Species, Nanjing Forestry University, Nanjing 210037, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Microorganisms 2025, 13(4), 853; https://doi.org/10.3390/microorganisms13040853
Submission received: 18 March 2025 / Revised: 1 April 2025 / Accepted: 2 April 2025 / Published: 9 April 2025
(This article belongs to the Section Antimicrobial Agents and Resistance)
Browse Figures
Versions Notes

Abstract

:
Microorganisms exert antagonistic effects on pathogens through different mechanisms, thereby achieving biological control of plant diseases. Many Burkholderia strains can produce complex secondary metabolites and substances that have toxic effects on host cells. The phage tail-like bacteriocins (tailocins) is a compound with antibacterial activity. However, its function in B. multivorans has not yet been reported. This article explores the ability of B. multivorans WS-FJ9 to antagonise plant pathogenic fungi and oomycetes, screening the potential tailocins in the strain WS-FJ9 and verifying their function, to reveal its novel antimicrobial mechanisms. We found that WS-FJ9 had strong antagonistic effects on the plant pathogenic fungi Phomopsis macrospore and Sphaeropsis sapinea, and the pathogenic oomycete Phytophthora cinnamomi. The phage tail-like protein Bm_67459 was predicted from the WS-FJ9 strain genome. The Bm_67459 cDNA encoded 111 amino acid sequence, and the relative molecular weight was approximately 11.69 kDa, the theoretical isoelectric point (pI) was 5.49, and it was a hydrophilic protein. Bm_67459 had no transmembrane helix region or signal peptide, and it belonged to the Phage_TAC_7 super family. qRT-PCR results showed that Bm_67459 gene expression was significantly upregulated during contact between WS-FJ9 and P. cinnamomi. The purified Bm_67459 protein significantly inhibited P. cinnamomi mycelial growth at 10 μg·mL−1. In summary, the WS-FJ9 strain had broad-spectrum anti-phytopathogenic activity, and the tailocin Bm_67459 was an important effector against the plant pathogen P. cinnamomi, which helps to reveal the antagonistic mechanism of this strain at the molecular level and provides excellent strain resources for the biological control of plant diseases.

1. Introduction

Plant diseases have always been an important factor threatening agricultural and forestry production. To control plant diseases, farmers usually apply methods that include chemical control, physical control, and biocontrol [1]. Chemical fungicides are expensive, toxic, and hazardous with many environmental problems. Finding safe and nontoxic biocontrol bacteria to control plant diseases has become a research hotspot in recent years [2]. The mechanisms of biological control include mainly competition, plant induced systemic resistance (ISR), and antagonism [3]. Among them, antagonism is the most important antibacterial mechanism. Biocontrol bacteria can produce antibacterial proteins, antibiotics, and bacteriocins to inhibit plant pathogenic microorganisms [4]. Bacteriocins are potent antimicrobial peptides that are produced by bacteria, with extensively post-translationally modified structures encoded on complex gene clusters. Bacteriocins are ribosomally synthesised peptides secreted by a variety of bacteria for the purpose of killing other bacteria, and they participate in removing microbial competition in prokaryotes [5,6]. Additionally, some phage tail genes can express proteins with bacteriocin-like functions, i.e., phage tail-like bacteriocins (tailocins). Tailocins are widely distributed in Gram-negative bacteria and exhibit strong specificity towards their targets, greatly affecting the surrounding microbial community [7]. In recent years, studies have found that this type of protein has antagonistic activity against plant pathogens [8].
Tailocins derived from prophages are a unique class of bacteriocins that are composed of many different polypeptide subunits [9]. F- and R-type pyocin-encoding gene clusters of Pseudomonas aeruginosa PAO1 are almost identical to the tail genes of the λ and P2 phages, respectively [10]. Nearly 65% of completely sequenced bacterial genomes contain prophage genes, and some bacteria carry prophage sequences that account for 20% of the capacity of the bacterial genome [11]. Prophages integrations confer virulence factors to bacteria and enhance bacterial adaptation to the environment [12]. This type of protein can have toxic effects on certain plant pathogenic bacteria and fungi. For example, the S-type pyocin produced by Pseudomonas fluorescens SF39a and the tailocin produced by strain SF4c have antibacterial activity against several plant pathogens of Xanthomonas and Pseudomonas [13,14,15,16]. Yao et al. found that the phage-like tail protein BceTMilo can antagonise 60% of Burkholderia cepacia complex (Bcc), representing 10 species and 90% of non-Bcc Burkholderia strains [17]. One kind of R-type pyocin can kill Campylobacter, Neisseria, and Haemophilus [18]. However, at present, studies of tailocins are focused mostly on inhibiting plant pathogenic bacteria, and there are still few reports on the inhibition of plant pathogenic fungi and oomycetes. Swain et al. found that Burkholderia gladioli NGJ1 secreted the prophage tail protein Bg_9562 through the type III secretion system, which had antagonistic effects on plant pathogenic fungi and oomycetes such as Rhizoctonia solani, Fusarium oxysporum, Magnaporthe oryzae, and Phytophthora sp. [19]. However, it has not been reported whether there are similar phage tail-like proteins in other Burkholderia strains that can antagonise plant pathogenic fungi and oomycetes.
The plant growth-promoting bacterium B. multivorans WS-FJ9 was screened from the rhizosphere of pine trees in our laboratory [20]. Previous research has shown that WS-FJ9 effectively promoted plant growth and dissolved phosphate, and had a certain antagonistic effect on plant pathogens [21,22], but the specific antagonistic mechanism was still unclear. Liu et al. reported genome data for B. multivorans WS-FJ9 and analysed and verified the phosphate-dissolving-related genes of this bacteria [23]. This study explored its antagonistic effects and mechanism against a variety of forest pathogens. At the same time, whole-genome data of WS-FJ9 was analysed, the sequences were blasted to find phage tail-like protein genes with potential antibacterial function, and a protein encoded by such a gene was prokaryotically expressed and purified. The possible role of this gene was explored in the antagonism of the WS-FJ9 against plant pathogens. These results were expected to lay a foundation for the in-depth study of the role and function of this protein and other prophage tail proteins in Burkholderia and provide new ideas for the prevention and control of plant diseases.

2. Materials and Methods

2.1. Bacteria and Plant Pathogens

The plant growth-promoting bacteria, B. multivorans WS-FJ9, was isolated from the rhizosphere soil of a slash pine (Pinus elliottii) in the Guangzhuang Forestry Center, Fujian, China [20], and deposited in the Chinese Center for Type Culture Collection (Accession No. CCTCCM2011435). Plant pathogens: P. cinnamomi (causes cedar root rot), R. solani (causes pine seedling damping-off), Phomopsis macrospore (causes poplar canker), and Sphaeropsis sapinea (causes pine shoot blight) were stored in the Laboratory of Forest Pathology, Nanjing Forestry University.

2.2. In Vitro Antifungal Activity

We used a 0.5 cm hole punch to take plugs containing mycelia from the aforementioned 4 plant pathogens, which had been cultured on a potato dextrose agar (PDA) plate (containing 20 g of agar, 20 g of dextrose, 200 g of potato, and 1 L of sterile water) for 7 days. Then, each pathogen was inoculated on an inverted PDA plate with a sterile needle by the direct contact method. Each plug was added to 25 μL of WS-FJ9 fermentation broth and cultured for 3 days in Luria–Bertani (LB) medium (containing 5 g of yeast extract, 10 g of tryptone, and 10 g of NaCl per litre, pH 7.0). Three plugs were placed in each empty culture dish, and three culture dishes were prepared in each treatment. The same amount of normal saline was added to each plug in the control group. After 72 h, mycelial growth of the pathogen was observed by a Zeiss SteREO Discovery.V20 microscope (Oberkochen, Germany).

2.3. Bioinformatics Analysis of the Phage Tail-like Protein Bm_67459 of B. multivorans WS-FJ9

According to the genome data of the WS-FJ9 [23], phage tail-like proteins were screened, and a homology analysis of selected protein sequences in the NCBI database was performed using BLAST (https://blast.ncbi.nlm.nih.gov/, accessed on 7 May 2024). It was found that contig67459 had high similarity with a reported prophage tail-like protein with antibacterial activity, Bg_9562 [19], so we renamed the gene Bm_67459. DNAMAN software (v10.0) was used to compare the amino acid sequences of the Bm_67459 and Bg_9562 proteins. ExPASy online analysis software was used to analyse the physical and chemical properties of the Bm_67459 protein (https://web.expasy.org/protparam/, accessed on 7 May 2024), and the transmembrane region of the Bm_67459 protein was predicted by the TMHMM Server v. 2.0 (http://www.cbs.dtu.dk/services/TMHMM/, accessed on 7 May 2024). The NetPhos 3.1 Server tool was used to analyse phosphorylation sites encoded by the Bm_67459 gene (http://www.Cbs.Dtu.dk/services/NetPhos/, accessed on 7 May 2024), while SignalP-4.0 software was used to predict the N-terminal signal peptide sequence of the Bm_67459 protein (http://www.cbs.dtu.dk/services/SignalP-4.0/, accessed on 7 May 2024). In addition, the NCBI conserved domain database (CDD) was used to analyse the functional domain of the Bm_67459 protein (https://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi, accessed on 7 May 2024), and its secondary structure was analysed at the online software SOPMA (https://npsa-prabi.ibcp.fr/cgi-bin/npsa_automat.pl?page=npsa_sopma.html, accessed on 7 May 2024). Finally, SWISS-MODEL software (https://swissmodel.expasy.org/, accessed on 7 May 2024) was used to predict and analyse the three-dimensional structure of the Bm_67459 protein (http://swissmodel.expasy.org, accessed on 7 May 2024).

2.4. Gene Cloning of the Phage Tail-like Protein Bm_67459 of B. multivorans WS-FJ9

According to the whole genome sequencing and annotation results for the WS-FJ9 strain, specific primers of the phage tail-like protein gene Bm_67459 were designed by Primer Premier 5.0 (Premier Biosoft International, Palo Alto, CA, USA), as shown in Table 1. Total DNA was isolated from WS-FJ9 cells using a SteadyPure Bacteria Genomic DNA Extraction Kit (Accurate Biology, Changsha, China), and then the Bm_67459 gene was amplified. The PCR system used included 2 μL of DNA template, 2 μL of primer pairs, and 10 µL of Green Taq Mix, and it was adjusted to 20 μL in volume with ddH2O. The conditions for amplification were enzyme activation at 98 °C for 5 min, denaturation at 98 °C for 30 s, and hybridization at 65 °C for 30 s. The PCR products were detected by 1% agarose gel electrophoresis. Recovery and purification of PCR products was performed using a TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver. 4.0 (TaKaRa, Dalian, China). The above purified PCR product was ligated to the pMDTM19-T cloning vector and transformed into competent Escherichia coli DH5α cells. Then, the cells were evenly spread on LB solid medium containing ampicillin (100 µg·mL−1) and cultured at 37 °C. Once transformed clones were identified, bacterial suspension from each clone was sequenced at Nanjing GenScript (Nanjing, China).

2.5. qRT-PCR

After adding a drop of the fermentation suspension of WS-FJ9 to the surface of pathogen plugs and incubating for 24 h, the surfaces of the plugs were repeatedly washed with 0.9% normal saline so that the bacteria were suspended in normal saline. The bacteria were centrifuged at 5000 r·min−1 for 5 min to complete the collection of WS-FJ9. A bacterial total RNA extraction kit was used to extract the total RNA of WS-FJ9 (TransGen Biotech, Beijing, China). cDNA was synthesised from the extracted bacterial RNA by HiScript II Q Select RT SuperMix for qPCR (Vazyme, Nanjing, China). Specific primers were designed by Primer 5.0 software for quantitative real-time PCR (qRT-PCR) (Table 1), and the 16S rDNA gene of WS-FJ9 (Accession No. KY003099.1) was chosen as a reference gene [18]. qRT-PCR was carried out in a 20 μL system that contained 2 μL of the diluted cDNA, 10 μL of AceQ Universal SYBR qPCR Master Mix, 0.4 μL of each primer (10 μM), and 7.2 μL of ddH2O. Relative expression levels (fold) were determined using ABI Prism 7500 software (Applied Biosystems, Foster City, CA, USA) and the 2−ΔΔCt method [24]. qRT-PCR was conducted with three biological and technical replicates.

2.6. Construction of a Prokaryotic Expression Vector with the Phage Tail-like Protein Bm_67459 Gene

According to the sequence characteristics of the Bm_67459 gene and the restriction endonuclease recognition sites of the expression vector pET32a, EcoRV restriction sites (underlined portions) were added to upstream and downstream primers for the target gene (designed with Primer 5.0): E-Bm_67459-F (5′–AAGGCCATGGCTGATATCATGACGAACCACGCTCAACACG–3′) and E- Bm_67459-R (5′–GAATTCGGATCCGATATCCGCAGACGGGGATGCCAT–3′). The Bm_67459 gene was amplified using WS-FJ9 DNA as the template and the high-fidelity enzyme Phanta Max Super-Fidelity DNA Polymerase (Vazyme, Nanjing, China). The PCR system (50 mL) consisted of 1 µL of dNTP Mix, 2 µL of DNA template, 4 µL of the primers F/R, 1 µL of DNA polymerase, 25 µL of 2× Phanta Max Buffer, and 17 µL of ddH2O. The PCR conditions were the same as those in Section 2.4. The correct size of the PCR product was observed by 1% agarose gel electrophoresis, and the PCR product was purified. The purified Bm_67459 gene fragment was inserted into the EcoRV site of the His-tag-containing plasmid pET32a to generate the pET32a-Bm_67459 expression vector, which was transformed into E. coli DH5α cells. These cells were plated on LB solid medium containing 100 µg·mL−1 ampicillin and incubated overnight at 37 °C. The positive clones were sequenced, and restriction enzyme digestion ensured that the correct expression plasmid was obtained through subcloning.

2.7. Induced Expression and Purification of the Phage Tail-like Protein Bm_67459 of B. Multivorans WS-FJ9

The successfully constructed pET32a-Bm_67459 plasmid was transformed into E. coli BL21 cells. The empty pET-32a vector as a control was also transformed into E. coli BL21 cells. We selected colonies on LB solid medium with 100 μg·mL−1 ampicillin. After colony PCR identification, E. coli BL21 cells containing the pET32a-Bm_67459 plasmid or pET-32a were inoculated into LB liquid medium containing 100 µg·mL−1 ampicillin and cultured overnight at 37 °C. The bacterial suspension was inoculated into LB liquid medium at a ratio of 1:100 and cultivated at 37 °C to an OD600 of 0.6–0.8. Then, we added 0.5 mmol·L−1 isopropyl-β-thiogalactopyranoside (IPTG) to the bacterial solution, which was incubated at 37 °C under constant shaking for 4 h to induce expression of the recombinant protein. The bacteria were collected by centrifugation at 8000 r·min−1 for 10 min at low temperature, suspended in an appropriate amount of phosphate-buffered saline (PBS) (10 mM, pH 7.2–7.4), and ultrasonically disrupted in an ice-water bath. After disruption, the supernatant was collected and centrifuged, and the pellet was suspended in PBS. The supernatant and the precipitate were collected for SDS-PAGE electrophoresis, and the expression of the target protein was analysed by staining with Coomassie brilliant blue. The Bm_67459 fusion protein was purified from the supernatant using a Ni-NTA-Sefinose column (Sangon Biotech, Shanghai, China).
Preliminary experiments showed that the target protein was soluble. Therefore, the protein was purified from the supernatant by Ni affinity chromatography. The Bm_67459 fusion protein was added to the Ni-NTA-Sefinose column and washed with 5 volumes of Ni-IDA binding buffer (300 mM NaCl, 50 mM Tris-HCl, pH 8.0) until the OD280 value of the effluent reached a baseline. Then, the target protein was eluted with Ni-NTA washing buffer with imidazole concentrations of 50, 100, 150, and 250 mmol·L−1 at a flow rate of 1 mL·min−1, and the effluent was collected. The abovementioned protein solution was poured into a dialysis bag, and PBS (0.2 g of KCl, 3.58 g of Na2HPO4.12H2O, 0.27 g of KH2PO4, 8.8 g of NaCl) (Zuhe Corporation, Nanjing, China).was used for overnight dialysis [25]. Then, 20 µL of each sample was detected by 12% SDS-PAGE. The remaining fusion protein was stored in a freezer at −80 °C.

2.8. Western Blot Analysis of the Bm_67459 Fusion Protein of B. multivorans WS-FJ9

The recombinant protein was subjected to SDS-PAGE electrophoresis and transferred to a PVDF membrane (0.45 mm). The membrane was kept in a blocking buffer containing 4% non-fat milk for 1.5 h, incubated with 1:1000 diluted anti-His antibody for 1 h at room temperature, and washed with a phosphate-buffered saline-Tween 20 (PBST) buffer 3 times (5 min each time). Then, after incubating with the secondary antibody for 0.5 h at room temperature, the membrane was washed 3 times with PBST washing buffer; the colour was developed with the Clarity Western ECL Substrate (BIO-RAD, Hercules, CA, USA) ultrasensitive luminescence colour developing solution and then photographed.

2.9. Antibacterial Effect of Phage Tail-like Protein Bm_67459 of B. multivorans WS-FJ9

The purified Bm_67459 protein was diluted to 10, 20, 30, 40, and 50 μg·mL−1, and 20 μL of protein solution at each concentration was dropped directly on the surface of pathogenic plugs. The control group was treated with heat-inactivated protein (incubated in boiling water for 45 min) and 1× PBS buffer solution. The samples were placed in a constant temperature incubator at 25 °C for 24 h, and the growth of pathogenic hyphae was observed using a Zeiss stereo microscope (Oberkochen, Germany). Each treatment was biologically repeated three times.

2.10. Statistical Analysis of the Data

Statistical analyses were carried out using Excel 2016 (Microsoft Corporation, Redmond, WA, USA) and SPSS software (ver. 23.0 IBM Corp., Armonk, NY, USA). Comparisons among treatments were analysed for significance using Duncan’s new multiple range test.

3. Results

3.1. Antagonistic Effect of B. multivorans WS-FJ9 on Forest Pathogens

Compared with the control treatment, the fermentation broth of the WS-FJ9 had strong inhibitory effects on P. cinnamomi, P. macrospore, and S. sapinea, but basically no inhibitory effect on R. solani. The surfaces of the pathogenic plugs of P. cinnamomi, P. macrospore, and S. sapinea treated with the WS-FJ9 strain were relatively moist and lacked mycelial growth (Figure 1), indicating that the WS-FJ9 strain had a strong inhibitory effect on the mycelial growth of the above three plant pathogenic strains. However, the mycelial growth on the surface of the R. solani plug treated with the WS-FJ9 was still vigorous and basically unchanged from that in the control group, indicating that the WS-FJ9 had no inhibitory effect on R. solani mycelia.

3.2. Effect of B. multivorans WS-FJ9 on Hyphae of Tree Pathogens by Electron Microscopy

The effect of WS-FJ9 on the hyphae of three pathogens was observed by scanning electron microscopy. After treatment with WS-FJ9, the mycelium of the pathogens appeared distorted, intertwined, twisted, folded, uneven in thickness, broken, shrivelled, and even split and dissolved on the surface of the mycelium (Figure 2).

3.3. Analysis and Cloning of Phage Tail-like Protein Genes from B. multivorans WS-FJ9

Analysing the genome of WS-FJ9 resulted in the annotation of 21 phage tail-like protein genes (Table 2). Most of these proteins existed in clusters in the genome, and their sizes varied greatly. The largest phage tail-like protein gene, contig67_457, was 2.64 kb, while the smallest was only 114 bp (contig67_458).
The 21 tail-like protein genes were analysed with BLASTN on the NCBI website, and the contig67_459 gene was 74% similar to the gene encoding the reported prophage tail protein Bg_9562 secreted by B. gladioli NGJ1 which has antifungal function [14]. Through multiple sequence alignment in DNAMAN, it was found that the amino acid sequence identity of contig67_459 and Bg_9562 protein was 62.64% (Figure 3A). We speculated that the protein encoded by the contig67_459 gene had certain toxicity and renamed it the Bm_67459 gene. Using the genomic DNA of WS-FJ9 as a template, the target gene Bm_67459 was amplified by PCR. The result of agarose gel electrophoresis was shown in Figure 3B, with a bright band at 300 bp, consistent with the predicted size. The recovered and purified product was connected to the vector pMDTM19-T and transferred to E. coli DH5α. After colony PCR verification (Figure 3C), positive clones were sequenced, and the sequencing results were consistent with the sequence in the genome. The sequencing results were submitted to GenBank under the accession number MT742543.

3.4. Physicochemical Properties and Structural Analysis of the Phage Tail-like Protein Bm_67459 of B. multivorans WS-FJ9

We analysed the physical and chemical properties of the Bm_67459 protein of the WS-FJ9. As shown in Figure 4A, the Bm_67459 gene sequence was 336 bp in length and had a complete open reading frame (ORF). The GC content of the Bm_67459 gene was high, at 69%. The relative molecular weight was approximately 11.69 kDa with 111 amino acids. The theoretical isoelectric point (pI) was 5.49, which indicated an acidic protein. The instability index was 29.82, indicating that the protein was stable (values below 40 indicate a stable protein). The predicted hydrophilicity of the Bm_67459 protein was shown in Figure 4B: with a hydrophilic index of 0.021, the protein was comfirmed hydrophilic. NetPhos 3.1 Server software analysis results showed that the Bm_67459 protein had 5 serine (Ser) and 6 threonine (Thr) residues, which might be protein kinase phosphorylation sites (Figure 4C). Based on the protein sequence, neither a signal peptide nor a transmembrane helix domain was present in the protein, and it could not be a receptor on the membrane or located on the membrane.
We analysed the secondary structure of the Bm_67459 protein of WS-FJ9 (Figure 5A). The Bm_67459 protein contained alpha helix, beta turn, extended strand, and random coil structures. The distribution of alpha helices in the secondary structure was high, at 45.95%. The second most common structure was random coil, accounting for 45.05% of the total secondary structure. Beta turned account for the lowest proportion, at only 2.70%. SWISS-MODEL software was used to generate a Bm_67459 protein model. The three-dimensional structures of the protein (Figure 5B) and the template Bm_67459 protein exhibited a protein sequence identity of 24.24% and overlapped for 44–76 amino acids. The three-dimensional structure of the Bm_67459 protein was mainly alpha helix and random coil with a small amount of beta turn, consistent with the secondary structure prediction results. The Bm_67459 protein was mostly one domain; it is located at amino acids 19–96 and belongs to the Phage_TAC_7 superfamily, indicating that the Bm_67459 protein belongs to this family (Figure 5C).

3.5. Differential Expression Analysis of the Phage Tail-like Protein Bm_67459 Gene of B. multivorans WS-FJ9

qRT-PCR was used to analyse the expression of the Bm_67459 gene of WS-FJ9 before and after the interaction with P. cinnamomi. The relative expression of the Bm_67459 gene was significantly upregulated by 2.5-fold after contact with P. cinnamomi (Figure 6). This result indicates that the Bm_67459 gene was closely related to the antagonism of WS-FJ9 against P. cinnamomi.

3.6. Induced Expression and Purification of the Phage Tail-like Protein Bm_67459 of B. multivorans WS-FJ9

The expression host bacteria were inoculated in a medium containing 0.5 mmol·L−1 IPTG, expression was induced at 37 °C for 4 h, and the empty vector prokaryotic expression product was used as a negative control. The crude recombinant protein was extracted and then detected by SDS-PAGE. There was an obvious protein band of approximately 32 kDa in the supernatant (Figure 7A, lane 3), which was consistent with the expected protein size, indicating that the fusion protein was successfully expressed in E. coli BL21. The Bm_67459 protein in the supernatant was purified by nickel ion affinity chromatography, and the eluted protein concentration was highest when the imidazole concentration was 100 mmol·L−1 or 150 mmol·L−1. The purified target protein was detected by SDS-PAGE, and a single protein band eluted at an imidazole concentration of 150 mmol·L−1 (Figure 7B, lanes 2 and 3). The recombinant protein was detected by Western blot, the purified Bm_67459 protein specifically reacted with an anti-6-His tag antibody, and the band size was consistent with the expected size (Figure 7C).

3.7. Antibacterial Activity of the Phage Tail-like Protein Bm_67459 of B. multivorans WS-FJ9

To detect the bactericidal activity of the phage tail protein Bm_67459, the purified Bm_67459 protein was diluted to 10, 20, 30, 40, and 50 g·mL−1. Drops of the purified Bm_67459 protein were added to the surface of test plant pathogen plugs, and PBS buffer and heat-inactivated protein were added as a control. As shown in Figure 8, there was no inhibition of the three plant pathogens in the control group, and mycelium growth was relatively vigorous. The surface hyphae of P. cinnamomi after protein treatment were significantly less abundant than those of the control group, and even completely aseptic filaments grew. However, P. macrospore and S. sapinea treated with Bm_67459 protein did not show inhibition. This result shows that the Bm_67459 protein has a good specific inhibitory effect on P. cinnamomi and that it can inhibit mycelial growth at a concentration of 10 μg·mL−1.

4. Discussion

Plant growth-promoting rhizobacteria (PGPR) affect plant growth in both direct and indirect ways. PGPR directly promote plant growth by producing substances such as plant hormones, volatile compounds, and aminocyclopropane-1-carboxylic acid (ACC) deaminases, improving plant nutritional status (such as promoting the release of insoluble phosphorus, potassium, trace elements, and non-symbiotic nitrogen fixation) in plants [26]. On the other hand, PGPR contain various effective antibacterial factors, mostly secondary metabolites or substances in volatile gases, but the role of the secretion system of PGPR in antagonising plant pathogens is unclear. Our previous research has shown that the B. multivorans WS-FJ9 was focused mainly on the phosphorus solubilizing characteristics of the strain. For example, inoculation with WS-FJ9 could significantly improve the content of NL-895 poplar phosphorus, increase nitrate nitrogen and soluble protein contents, enhance nitrate reductase and root activities, and thus promote the growth of poplar [27]. This strain had strong adaptability and phosphate-solubilizing ability at low phosphorus levels, and the amount of organic phosphorus could be more than 140 mg·L−1 [23]. However, research on the antagonistic ability of WS-FJ9 against plant pathogens has not been reported. In this study, we found that the strain had strong antagonistic activity against both pathogenic fungi and oomycetes, for example, the fermentation medium of WS-FJ9 had strong antagonistic activity against P. cinnamomi (causes cedar root rot), P. macrospore (causes poplar canker) and S. sapinea (causes pine shoot blight), indicating that the WS-FJ9 strain had great biocontrol potential for preventing and controlling plant diseases.
Studies have shown that biocontrol bacteria mainly produce some cell wall-degrading enzymes (chitinase, glucanase, and protease), bacteriocins, hydrogen cyanide, and siderophores to antagonise plant pathogens [28]. In recent years, studies found that some bacteria could produce toxic effects on plant pathogens through the secretion of tailocins. Some bacteria could produce multiple tailocins simultaneously. For example, Pseudomonas chlororaphis produced two different R-tailocins, and they had different antibacterial spectra, which helped the strain compete with other rhizosphere-related bacteria [29]. P. aeruginosa PAO1 synthesised both R2 and F2 pyocins, the gene clusters of which were located next to each other. The R2 and F2 pyocins shared a common lysis cassette and regulatory system [30]. To further detect the active components of WS-FJ9 that antagonise plant pathogens, the whole genome of the WS-FJ9 strain was mined. The analysis revealed that WS-FJ9 had multiple phage tail protein gene clusters and 21 phage tail protein genes, indicating that the bacterium could synthesise multiple phage tail proteins. Comparing these 21 genes with NCBI database genes revealed that the Bm_67459 gene was 74% similar to the reported Bg_9562 gene [16], which has antifungal activity, and that the Bm_67459 protein had the main conserved domain of the phage tail protein family, indicating that the Bm_67459 gene had potential antagonistic ability. Bioinformatics analysis showed that the Bm_67459 protein of the WS-FJ9 strain had no signal peptide or transmembrane structure, therefore we speculated that the protein is a non-classical protein [31].
Bacteriocins are ribosomally encoded peptides or proteins that exhibit high specificity [8,32]. Most tailocins exhibit narrow bactericidal spectra, displaying antibacterial activity against species of bacteria that are closely related to the producer [33]. Maltocin P28, an R-type tailocin produced by Stenotrophomonas maltophilia P28, is the only bacteriocin reported so far, and it killed only a fraction of the tested S. maltophilia strains [34]. Since bacteriocins can kill bacteria phylogenetically related to bacteriocin-producing strains without altering the remaining microflora, high specificity has become one of the advantages of bacteriocins. Therefore, bacteriocins are emerging as a promising alternative for reducing the application of agrochemicals in agriculture [35]. Príncipe investigated the efficacy of foliar application of tailocins to control bacterial spot disease in tomato caused by Xanthomonas vesicatoria Xcv Bv5-4a. The disease severity and incidence index were reduced by 44 and 36%, respectively [16]. To explore how the WS-FJ9 phage tail-like protein Bm_67459 functions in biological control against plant pathogens and to further develop Bm_67459 application in protein pesticide production, this study first used qRT-PCR to analyse the differential expression of the Bm_67459 gene. It found that the gene was significantly upregulated during WS-FJ9 inhibition of P. cinnamomi, indicating that the protein played a certain role in the antagonism process.
When the purified Bm_67459 protein (10 μg·mL−1) was used to treat the oomycete P. cinnamomea, the growth of its hyphae could be significantly inhibited, but inhibitory effects on the plant pathogenic fungi P. macrospore and S. sapinea were not obvious, implying that the Bm_67459 protein had specificity against the oomycete P. cinnamomi and that the WS-FJ9 strain had potential for bio-controlling plant root rot caused by P. cinnamomi. P. cinnamomi is a soilborne pathogen that is widely distributed worldwide and harmful to trees and crops. It can cause root rot in trees and uses a wide range of plants, mainly Camphora, Eucalyptus robusta, Persea lamericanal, Cedrus deodara, and Cupressus, as hosts [36]. Maintaining high microbial activity in the soil could effectively control the occurrence of soilborne diseases. Some fungi and bacteria have antibiosis, competition, and mycoparasitism effects on P. cinnamomi [37]. A volatile organic compound produced by Bacillus acidiceler A8a inhibits the growth of P. cinnamomi by 76% [38]. Rahnella aquatilis JZ-GX1 ferrophilic fermentation broth also has a good inhibitory effect on P. cinnamomi [39]. Moreover, this study found that the WS-FJ9 strain can produce a tailocin and antagonise the growth of P. cinnamomi, which not only reveals the molecular mechanism of this strain’s bacteriostasis but also provides a resource for the biological control of P. cinnamomi. Bacterial strain resources lay the foundation for the development of new biological pesticides from microorganisms. Fermentation and cultivation of WS-FJ9 strain, collecting bacterial cells and placing them in suitable vector plasmids, could be used to produce bio-pesticides, and combined use with other pesticides can reduce the resistance of pathogenic bacteria and enhance drug efficacy. However, the environmental adaptability of the WS-FJ9 strain as a bio-pesticide still needs further consideration, and its effectiveness against other pathogenic fungi needs to be further improved. We performed only prokaryotic expression and purification of a tailocin from the WS-FJ9 strain. However, the antagonistic test of the fermentation broth suggested that some other antibacterial substances or mechanisms existed in the strain to exert antagonistic effects on the pathogenic fungi P. macrospore and S. sapinea. Esmaeel discovered multiple antibacterial genes and gene clusters in several genomes of Bcc strains [40]. Therefore, we need to further explore the genome of B. multivorans WS-FJ9 to identify more antibacterial genes and better analyse the antibacterial mechanism of this bacterium’s broad-spectrum activity.

5. Conclusions

The results showed that B. multivorans WS-FJ9 had a strong inhibitory effect on the growth of plant pathogenic fungi and oomycetes. The phage tail-like protein Bm_67459 of the WS-FJ9 strain is an important effector and has a specific antagonistic effect on P. cinnamomi. These findings provide insights into the antioomycete mechanism of B. multivorans. They also provide a new idea for the prevention and treatment of root rot disease and the study of new protein pesticide targets. In the future, we will further investigate the specific antibacterial substances of WS-FJ9 and test its inhibitory effect on P. cinnamomi in natural environments.

Author Contributions

T.-Y.W. and X.-L.X. analysed the data and prepared manuscript, conducted the experiments with the help of W.-L.K. and X.-Q.W. contributed reagents, materials and analysis tools, and supervised the whole process and reviewed the paper. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Key Research and Development Program of China (2017YFD0600104) and the Priority Academic Program Development of the Jiangsu Higher Education Institutions (PAPD).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in the study are included in the article, further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Holland, R.A.; Crossthwaite, A. Alkylsulfones: Novel chemical scaffolds targeting the vesicular acetylcholine transporter usher in a new generation of insecticides. Pest. Manag. Sci. 2024. [Google Scholar] [CrossRef] [PubMed]
  2. Mani, K.; Vitenberg, T.; Khatib, S.; Opatovsky, I. Effect of entomopathogenic fungus Beauveria bassiana on the growth characteristics and metabolism of black soldier fly larvae. Pestic. Biochem. Physiol. 2023, 197, 105684. [Google Scholar] [CrossRef] [PubMed]
  3. Haas, D.; Défago, G. Biological control of soil-borne pathogens by fluorescent pseudomonads. Nat. Rev. Microbiol. 2005, 3, 307–319. [Google Scholar] [CrossRef]
  4. Santhanam, R.; Menezes, R.C.; Grabe, V.; Li, D.; Baldwin, I.T.; Groten, K. A suite of complementary biocontrol traits allows a native consortium of root-associated bacteria to protect their host plant from a fungal sudden-wilt disease. Mol. Ecol. 2019, 28, 1154–1169. [Google Scholar] [CrossRef]
  5. Sugrue, I.; Ross, R.P.; Hill, C. Bacteriocin diversity, function, discovery and application as antimicrobials. Nat. Rev. Microbiol. 2024, 22, 556–571. [Google Scholar] [CrossRef]
  6. Kumariya, R.; Garsa, A.K.; Rajput, Y.S.; Sood, S.K.; Akhtar, N.; Patel, S. Bacteriocins: Classification, synthesis, mechanism of action and resistance development in food spoilage causing bacteria. Microb. Pathog. 2019, 128, 171–177. [Google Scholar] [CrossRef]
  7. Woudstra, C.; Sørensen, A.N.; Sørensen MC, H.; Brøndsted, L. Strategies for developing phages into novel antimicrobial tailocins. Trends Microbiol. 2024, 32, 996–1006. [Google Scholar] [CrossRef]
  8. Ghequire, M.G.K.; Dillen, Y.R.; Lambrichts, V.; Proost, P.; Wattiez, R.; De Mo, R. Different Ancestries of R Tailocins in Rhizospheric Pseudomonas Isolates. Genome Biol. Evol. 2015, 7, 2810–2828. [Google Scholar] [CrossRef]
  9. Scholl, D. Phage Tail-Like Bacteriocins. Annu. Rev. Virol. 2017, 4, 453–467. [Google Scholar] [CrossRef]
  10. Nakayama, K.; Takashima, K.; Ishihara, H.; Shinomiya, T.; Kageyama, M.; Kanaya, S.; Ohnishi, M.; Murata, T.; Mori, H.; Hayashi, T. The R-type pyocin of Pseudomonas aeruginosa is related to P2 phage, and the F-type is related to lambda phage. Mol. Microbiol. 2000, 38, 213–231. [Google Scholar] [CrossRef]
  11. Canchaya, C.; Fournous, G.; Brüssow, H. The impact of prophages on bacterial chromosomes. Mol. Microbiol. 2004, 53, 9–18. [Google Scholar] [CrossRef] [PubMed]
  12. Salmond, G.P.C.; Fineran, P.C. A century of the phage: Past, present and future. Nat. Rev. Microbiol. 2015, 13, 777–786. [Google Scholar] [CrossRef] [PubMed]
  13. Godino, A.; Príncipe, A.; Fischer, S. A ptsP deficiency in PGPR Pseudomonas fluorescens SF39a affects bacteriocin production and bacterial fitness in the wheat rhizosphere. Res. Microbiol. 2016, 167, 178–189. [Google Scholar] [CrossRef] [PubMed]
  14. Fischer, S.; Godino, A.; Quesada, J.M.; Cordero, P.; Jofré, E.; Mori, G.; Espinosa-Urgel, M. Characterization of a phage-like pyocin from the plant growth-promoting rhizobacterium Pseudomonas fluorescens SF4c. Microbiology 2012, 158, 1493–1503. [Google Scholar] [CrossRef]
  15. Fernandez, M.; Godino, A.; Príncipe, A.; Morales, G.M.; Fischer, S. Effect of a Pseudomonas fluorescens tailocin against phytopathogenic Xanthomonas observed by atomic force microscopy. J. Biotechnol. 2017, 256, 13–20. [Google Scholar] [CrossRef]
  16. Príncipe, A.; Fernandez, M.; Torasso, M.; Godino, A.; Fischer, S. Effectiveness of tailocins produced by Pseudomonas fluorescens SF4c in controlling the bacterial-spot disease in tomatoes caused by Xanthomonas vesicatoria. Microbiol. Res. 2018, 212–213, 94–102. [Google Scholar] [CrossRef]
  17. Yao, G.W.; Duarte, I.; Le, T.T.; Carmody, L.; LiPuma, J.J.; Young, R.; Gonzalez, C.F. A Broad-Host-Range Tailocin from Burkholderia cenocepacia. Appl. Environ. Microb. 2017, 83, e03414-16. [Google Scholar] [CrossRef]
  18. Morse, S.A.; Jones, B.V.; Lysko, P.G. Pyocin inhibition of Neisseria gonorrhoeae: Mechanism of action. Antimicrob. Agents Chemother. 1980, 18, 416–423. [Google Scholar] [CrossRef]
  19. Swain, D.M.; Yadav, S.K.; Tyagi, I.; Kumar, R.; Kumar, R.; Ghosh, S.; Das, J.; Jha, G. A prophage tail-like protein is deployed by Burkholderia bacteria to feed on fungi. Nat. Commun. 2017, 8, 404. [Google Scholar] [CrossRef]
  20. Hou, L. Studies on Screening of Efficient Phosphate-Solubilizing Bacteria in the Rhizosphere of Pine Trees and on Their Characteristics; Nanjing Forestry University: Nanjing, China, 2012. [Google Scholar]
  21. Zeng, Q.; Wu, X.; Wang, J. Burkholderia multivorans Phosphate Solubilization and Gene Expression of Phosphate-Solubilizing Bacterium WS-FJ9 under Different Levels of Soluble Phosphate. J. Microbiol. Biotechnol. 2017, 27, 844–855. [Google Scholar] [CrossRef]
  22. Li, G.; Wu, X.; Ye, J.; Yang, H. Characteristics of Organic Acid Secretion Associated with the Interaction between Burkholderia multivorans WS-FJ9 and Poplar Root System. Biomed. Res. Int. 2018, 2018, 9619724. [Google Scholar] [CrossRef] [PubMed]
  23. Liu, Y.; Wang, Y.; Kong, W.; Liu, W.; Xie, X.; Wu, X. Identification, cloning and expression patterns of the genes related to phosphate solubilization in Burkholderia multivorans WS-FJ9 under different soluble phosphate levels. Amb Express 2020, 10, 108. [Google Scholar] [CrossRef] [PubMed]
  24. Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  25. Zhang, Y.; Chen, W.; Li, M.; Yang, L.; Chen, X. Cloning, phylogenetic research, and prokaryotic expression study of the metabolic detoxification gene EoGSTs1 in Empoasca onukii Matsuda. PEERJ 2019, 7, e7641. [Google Scholar] [CrossRef]
  26. Beneduzi, A.; Ambrosini, A.; Passaglia, L.M. Plant growth-promoting rhizobacteria (PGPR): Their potential as antagonists and biocontrol agents. Genet. Mol. Biol. 2012, 35, 1044–1051. [Google Scholar] [CrossRef]
  27. Li, G.; Wu, X.; Ye, J. Effects of Burkholderia multivorans WS-FJ9 on Nutrient Metabolism and Root Activity of Poplar. Acta Agric. Univ. Jiangxiensis 2014, 36, 531–535. [Google Scholar]
  28. Bhattacharyya, P.N.; Jha, D.K. Plant growth-promoting rhizobacteria (PGPR): Emergence in agriculture. World J. Microb. Biot. 2011, 28, 1327–1350. [Google Scholar] [CrossRef]
  29. Dorosky, R.J.; Yu, J.M.; Pierson, L.S., III; Pierson, E.A. Pseudomonas chlororaphis Produces Two Distinct R-Tailocins That Contribute to Bacterial Competition in Biofilms and on Roots. Appl. Environ. Microb. 2017, 83, e00706-17. [Google Scholar] [CrossRef]
  30. Matsui, H.; Sano, Y.; Ishihara, H.; Shinomiya, T. Regulation of pyocin genes in Pseudomonas aeruginosa by positive (prtN) and negative (prtR) regulatory genes. J. Bacteriol. 1993, 175, 1257–1263. [Google Scholar] [CrossRef]
  31. Lloubes, R.; Bernadac, A.; Houot, L.; Pommier, S. Non classical secretion systems. Res. Microbiol. 2013, 164, 655–663. [Google Scholar] [CrossRef]
  32. Ahmad, V.; Khan, M.S.; Jamal, Q.M.S.; Alzohairy, M.A.; Al Karaawi, M.A.; Siddiqui, M.U. Antimicrobial potential of bacteriocins: In therapy, agriculture and food preservation. Int. J. Antimicrob. Agents 2017, 49, 1–11. [Google Scholar] [CrossRef] [PubMed]
  33. Chen, J.; Zhu, Y.; Yin, M.; Xu, Y.; Liang, X.; Huang, Y.P. Characterization of maltocin S16, a phage tail-like bacteriocin with antibacterial activity against Stenotrophomonas maltophilia and Escherichia coli. J. Appl. Microbiol. 2019, 127, 78–87. [Google Scholar] [CrossRef] [PubMed]
  34. Liu, J.; Chen, P.; Zheng, C.Y.; Huang, Y.P. Characterization of Maltocin P28, a Novel Phage Tail-Like Bacteriocin from Stenotrophomonas maltophilia. Appl. Environ. Microb. 2013, 79, 5593–5600. [Google Scholar] [CrossRef] [PubMed]
  35. Mills, S.; Ross, R.P.; Hill, C. Bacteriocins and bacteriophage; a narrow-minded approach to food and gut microbiology. Fems Microbiol. Rev. 2017, 41, S129–S153. [Google Scholar] [CrossRef]
  36. Hansen, E. Phytophthora in North American forests. In Sudden Oak Death Online Symposium; American Phytopathological Society: St Paul, MN, USA, 2003. [Google Scholar]
  37. Wang, M.S.; Zhang, S.H.; Chen, X.D. Research Progress on Biological Characteristics and Control Techniques of Phytophthora cinnamomi. J. Anhui Agric. Sci. 2018, 46, 21–24. [Google Scholar]
  38. Méndez-Bravo, A.; Cortazar-Murillo, E.M.; Guevara-Avendaño, E.; Ceballos-Luna, O.; Rodríguez-Haas, B.; Kiel-Martínez, A.L.; Hernández-Cristóbal, O.; Guerrero-Analco, J.A.; Reverchon, F. Plant growth-promoting rhizobacteria associated with avocado display antagonistic activity against Phytophthora cinnamomi through volatile emissions. PLoS ONE 2018, 13, e194665. [Google Scholar] [CrossRef]
  39. Kong, W.L.; Zhou, M.; Wu, X.Q. Characteristics of siderophores production by Rahnella aquatilis JZ-GX1 and its antagonism against forest pathogens. Microbiol. China 2019, 46, 3278–3285. [Google Scholar]
  40. Esmaeel, Q.; Pupin, M.; Kieu, N.P.; Chataigne, G.; Bechet, M.; Deravel, J.; Krier, F.; Hofte, M.; Jacques, P.; Leclere, V. Burkholderia genome mining for nonribosomal peptide synthetases reveals a great potential for novel siderophores and lipopeptides synthesis. Microbiologyopen 2016, 5, 512–526. [Google Scholar] [CrossRef]
Microorganisms 13 00853 g001
Figure 1. Detection of the activity of Burkholderia multivorans WS-FJ9 against plant pathogens. (A/a): Phytophthora cinnamomi, (B/b): Phomopsis macrospore, (C/c): Rhizoctonia solani, (D/d): Sphaeropsis sapinea.
Figure 1. Detection of the activity of Burkholderia multivorans WS-FJ9 against plant pathogens. (A/a): Phytophthora cinnamomi, (B/b): Phomopsis macrospore, (C/c): Rhizoctonia solani, (D/d): Sphaeropsis sapinea.
Microorganisms 13 00853 g001
Microorganisms 13 00853 g002
Figure 2. Mycelium of plant pathogens treated with normal saline and. Burkholderia multivorans WS-FJ9 observed by scanning electron microscopy. (A/a) P. cinnamomi; (B/b) P. macrospore; (C/c) S. sapinea; (A–C) Control: normal saline; (a–c) Treatment: WS-FJ9 suspension. (Note: The red arrow indicates damage to the mycelium). Scale bars = 50 µm.
Figure 2. Mycelium of plant pathogens treated with normal saline and. Burkholderia multivorans WS-FJ9 observed by scanning electron microscopy. (A/a) P. cinnamomi; (B/b) P. macrospore; (C/c) S. sapinea; (A–C) Control: normal saline; (a–c) Treatment: WS-FJ9 suspension. (Note: The red arrow indicates damage to the mycelium). Scale bars = 50 µm.
Microorganisms 13 00853 g002
Microorganisms 13 00853 g003
Figure 3. Amino acid sequence alignment between the Bm_67459 and Bg_9562 proteins and cloning of the Bm_67459 gene. (A) Amino acid sequence alignment between the Bm_67459 and Bg_9562 proteins. (B) PCR amplification of the Bm_67459 gene (M: DL2000 marker; 1,2: target gene Bm_67459). (C) PCR identification of Bm_67459 colonies (M: DL5000 marker; 1~4: PCR identification of Bm_67459 positive clones).
Figure 3. Amino acid sequence alignment between the Bm_67459 and Bg_9562 proteins and cloning of the Bm_67459 gene. (A) Amino acid sequence alignment between the Bm_67459 and Bg_9562 proteins. (B) PCR amplification of the Bm_67459 gene (M: DL2000 marker; 1,2: target gene Bm_67459). (C) PCR identification of Bm_67459 colonies (M: DL5000 marker; 1~4: PCR identification of Bm_67459 positive clones).
Microorganisms 13 00853 g003
Microorganisms 13 00853 g004
Figure 4. Bioinformatics analysis of the Bm_67459 gene of Burkholderia multivorans WS-FJ9. (A) Physical and chemical parameters of the Bm_67459 gene. (B) Hydrophobicity prediction for the Bm_67459 protein. (C) Phosphorylation site prediction for the Bm_67459 protein.
Figure 4. Bioinformatics analysis of the Bm_67459 gene of Burkholderia multivorans WS-FJ9. (A) Physical and chemical parameters of the Bm_67459 gene. (B) Hydrophobicity prediction for the Bm_67459 protein. (C) Phosphorylation site prediction for the Bm_67459 protein.
Microorganisms 13 00853 g004
Microorganisms 13 00853 g005
Figure 5. Secondary structure and tertiary structure prediction for the Bm_67459 protein. (A) Blue: alpha helix, red: extended strand, green: beta turn, purple: random coil. (B) Tertiary structure prediction for the Bm_67459 protein. (C) Prediction of the conserved domain of the Bm_67459 protein.
Figure 5. Secondary structure and tertiary structure prediction for the Bm_67459 protein. (A) Blue: alpha helix, red: extended strand, green: beta turn, purple: random coil. (B) Tertiary structure prediction for the Bm_67459 protein. (C) Prediction of the conserved domain of the Bm_67459 protein.
Microorganisms 13 00853 g005
Microorganisms 13 00853 g006
Figure 6. Differential expression analysis of the phage tail-like protein Bm_67459 gene of Burkholderia multivorans WS-FJ9 upon Phytophthora cinnamomi contact. The significance was represented by a and b.
Figure 6. Differential expression analysis of the phage tail-like protein Bm_67459 gene of Burkholderia multivorans WS-FJ9 upon Phytophthora cinnamomi contact. The significance was represented by a and b.
Microorganisms 13 00853 g006
Microorganisms 13 00853 g007
Figure 7. Prokaryotic expression, purification and Western blot analysis of the phage tail-like protein Bm_67459 of B. multivorans WS-FJ9. (A) Prokaryotic expression of the Bm_67459 protein; (M: protein molecular weight markers; 1: unpurified pET32a-carrying strain lysate supernatant; 2: unpurified pET-32a-carrying strain lysate supernatant; 3: unpurified pET32a-Bm_67459-carrying strain lysate supernatant; 4: unpurified pET-32a-Bm_67459-carrying strain lysate supernatant. (B) Purification of Bm_67459 protein (M: protein molecular weight markers; 1: purified lysate supernatant of pET32a; 2, 3-carrying strain: wash of Bm_67459 protein with 150 mmol·L−1 imidazole buffer). (C) Western blot detection of Bm_67459 protein; (1: purified pET32a-carrying strain lysate supernatant; 2: purified Bm_67459 protein).
Figure 7. Prokaryotic expression, purification and Western blot analysis of the phage tail-like protein Bm_67459 of B. multivorans WS-FJ9. (A) Prokaryotic expression of the Bm_67459 protein; (M: protein molecular weight markers; 1: unpurified pET32a-carrying strain lysate supernatant; 2: unpurified pET-32a-carrying strain lysate supernatant; 3: unpurified pET32a-Bm_67459-carrying strain lysate supernatant; 4: unpurified pET-32a-Bm_67459-carrying strain lysate supernatant. (B) Purification of Bm_67459 protein (M: protein molecular weight markers; 1: purified lysate supernatant of pET32a; 2, 3-carrying strain: wash of Bm_67459 protein with 150 mmol·L−1 imidazole buffer). (C) Western blot detection of Bm_67459 protein; (1: purified pET32a-carrying strain lysate supernatant; 2: purified Bm_67459 protein).
Microorganisms 13 00853 g007
Microorganisms 13 00853 g008
Figure 8. Antibacterial activity of the phage tail-like protein Bm_67459 of B. multivorans WS-FJ9. (A) Phytophthora cinnamomi; (B) Phomopsis macrospore; (C) Sphaeropsis sapinea. Scale bars = 50 µm.
Figure 8. Antibacterial activity of the phage tail-like protein Bm_67459 of B. multivorans WS-FJ9. (A) Phytophthora cinnamomi; (B) Phomopsis macrospore; (C) Sphaeropsis sapinea. Scale bars = 50 µm.
Microorganisms 13 00853 g008
Table 1. PCR primers used in the study.
Table 1. PCR primers used in the study.
Primers NameSecquences (5′ to 3′)Bases Number/bpFuncion
Bm_67459-FATGACGAACCACGCTCAACACG22Bm_67459 clone
Bm_67459-RCGCAGACGGGGATGCCAT18
qBm_67459-FATGACGAACCACGCTCAACACG22Bm_67459 clone
qBm_67459-RGACCTCGAATTCCGTCAGCGA21
16s rDNA-FGGGGAGTACGGTCGCAAGAT20Reference genes
16s rDNA-RCATGTCAAGGGTAGGTAAGGTTT23
Table 2. Prophage tail-like protein genes of Burkholderia multivorans WS-FJ9.
Table 2. Prophage tail-like protein genes of Burkholderia multivorans WS-FJ9.
Orf NameLocationProtein LengthPredicted Function
contig67_4579087–11,729880phage tail tape measure protein
contig67_45811,726–11,84238GpE family phage tail protein
contig67_45911,851–12,186111phage tail assembly protein
contig67_46012,214–12,717167phage major tail tube protein
contig67_46112,756–13,928390phage tail protein
contig67_46213,982–14,587201phage tail protein
contig430_294125,664–26,125153phage tail protein
contig430_294429,164–30,354396phage tail protein
contig430_294530,773–31,993406phage tail protein
contig430_294632,388–33,608406phage tail protein
contig430_294733,679–34,128149phage tail protein
contig597_40086070–7005311phage tail protein
contig1014_60854909–5319136phage tail protein
contig1014_60876935–7384149phage tail protein
contig1014_60908856–9344162phage tail protein
contig1120_65841388–2494368phage tail protein
contig1120_65863847–6261804phage tail protein
contig1120_65886748–7125125phage tail protein
contig1120_65897155–8576473tail sheath protein
contig1519_7719106–23743phage tail protein
contig1519_7720351–806151phage tail protein
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wen, T.-Y.; Xie, X.-L.; Kong, W.-L.; Wu, X.-Q. Expression and Antagonistic Activity Against Plant Pathogens of the Phage Tail-like Protein from Burkholderia multivorans WS-FJ9. Microorganisms 2025, 13, 853. https://doi.org/10.3390/microorganisms13040853

AMA Style

Wen T-Y, Xie X-L, Kong W-L, Wu X-Q. Expression and Antagonistic Activity Against Plant Pathogens of the Phage Tail-like Protein from Burkholderia multivorans WS-FJ9. Microorganisms. 2025; 13(4):853. https://doi.org/10.3390/microorganisms13040853

Chicago/Turabian Style

Wen, Tong-Yue, Xing-Li Xie, Wei-Liang Kong, and Xiao-Qin Wu. 2025. "Expression and Antagonistic Activity Against Plant Pathogens of the Phage Tail-like Protein from Burkholderia multivorans WS-FJ9" Microorganisms 13, no. 4: 853. https://doi.org/10.3390/microorganisms13040853

APA Style

Wen, T.-Y., Xie, X.-L., Kong, W.-L., & Wu, X.-Q. (2025). Expression and Antagonistic Activity Against Plant Pathogens of the Phage Tail-like Protein from Burkholderia multivorans WS-FJ9. Microorganisms, 13(4), 853. https://doi.org/10.3390/microorganisms13040853

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop