Genetic Diversity of Siberian Isolates of Borrelia burgdorferi Sensu Lato by the ospA Gene
by
, , , , , , ,
Yana Igolkina
1
,
Vera Rar
1,*,
Valeriy Yakimenko
2,
Alevtina Bardasheva
1,
Valeria Fedorets
1,
Alfrid Karimov
2,
Gavril Rubtsov
2,
Tamara Epikhina
1 and
Nina Tikunova
1 1
Institute of Chemical Biology and Fundamental Medicine SB RAS, 630090 Novosibirsk, Russia
2
Omsk Research Institute of Natural Foci Infections, 644080 Omsk, Russia
*
Author to whom correspondence should be addressed.
Microorganisms 2025, 13(12), 2825; https://doi.org/10.3390/microorganisms13122825
Submission received: 28 October 2025
/
Revised: 3 December 2025
/
Accepted: 9 December 2025
/
Published: 11 December 2025
(This article belongs to the Special Issue One Health Research on Zoonotic Tick-Borne Pathogens)
Abstract
The genetic diversity of the ospA gene of the Borrelia burgdorferi sensu lato species complex encoding outer surface protein A has been widely investigated. However, the information on the genetic variability of Borrelia isolates from Siberia for this gene is limited. In this study, we analyzed complete ospA gene sequences from 36 Borrelia isolates from Western Siberia, comprising 6 Borrelia afzelii, 16 Borrelia bavariensis, 1 Borrelia garinii, and 13 “Candidatus Borrelia sibirica” isolates. The obtained ospA gene sequences of B. afzelii were conserved and formed a single clade. In contrast, B. bavariensis sequences were highly variable, segregating into two distinct clades consistent with the phylogeography of Asian isolates. Notably, the B. bavariensis samples identified in molted Ixodes trianguliceps and Ixodes apronophorus were first characterized for the ospA gene; the obtained sequences corresponded to those from I. persulcatus. This study provides the first characterization of the ospA gene in “Candidatus B. sibirica”, revealing highly conserved sequences (99.8–100% intraspecific identity). The ospA gene sequences of “Candidatus B. sibirica” shared less than 88.7% identity with those of other Borrelia genospecies. Phylogenetic analysis placed “Candidatus B. sibirica” in a unique, well-supported clade, confirming its distinct phylogenetic status and suggesting potential ecological specialization in nidicolous Ixodes species.
1. Introduction
Spirochetes of the genus Borrelia, the causative agents of vector-borne diseases, namely, Lyme borreliosis (LB) and relapsing fever, are transmitted to humans and animals through the bites of ticks and lice. The Borrelia burgdorferi sensu lato (s.l.) complex comprises a group of tick-transmitted pathogens, some of which are causative agents of LB. This group includes more than 20 accepted and proposed or candidate Borrelia genospecies, at least 9 of which are known to infect humans [1,2]. Borrelia burgdorferi sensu stricto (s.s.), Borrelia afzelii, Borrelia garinii, and Borrelia bavariensis are the main etiological agents of LB in the temperate zones of the Northern Hemisphere [3].
The distribution of these genospecies varies geographically. In North America, B. burgdorferi s.s is the main causative agent of Lyme disease, whereas in Europe, most human cases are attributed to B. afzelii, B. garinii, and B. bavariensis and, less frequently, to B. burgdorferi s.s. [4]. Certain genospecies have been shown to be more frequently associated with specific symptoms, including arthritis (B. burgdorferi s.s.), neuroborreliosis (B. garinii and B. bavariensis), acrodermatitis chronica atrophicans, and borrelial lymphocytoma (B. afzelii) [5,6,7,8].
Four known species of the B. burgdorferi s.l. complex have been found in Siberia, including the widespread B. afzelii, B. bavariensis, and B. garinii, as well as rarely found B. valaisiana [9,10,11,12,13]. Of these, B. garinii is predominantly detected in Ixodes pavlovskyi, while B. bavariensis and B. afzelii are prevalent in Ixodes persulcatus [10,13]. Regarding less studied Ixodes ticks, molted Ixodes apronophorus and Ixodes trianguliceps in Siberia have been shown to be infected with B. bavariensis [12], while both B. afzelii and B. bavariensis strains have been isolated from feeding I. trianguliceps in the Urals [14].
Recently, a proposed new genospecies, “Candidatus Borrelia sibirica”, was detected in small mammals, in Ixodes spp. ticks feeding on small mammals, and in a single molted I. apronophorus at several locations within I. apronophorus distribution areas in Western Siberia [12]. This candidate genospecies was genetically characterized by a single-locus analysis of the clpA, p83/100, and 16S rRNA genes and the 5S-23S rRNA intergenic spacer (IGS) and by multi-locus sequence analysis of concatenated sequences of eight housekeeping genes [15]. Phylogenetic analyses revealed that “Candidatus B. sibirica” is highly conserved across all examined genetic loci and forms distinct, separate clades [12]. Notably, “Candidatus B. sibirica” is most genetically similar to B. garinii and B. bavariensis.
All studied B. burgdorferi s.l. genospecies produce outer surface protein A (OspA) [16]. This integral surface protein is abundantly expressed by Borrelia spp. within the midguts of unfed ticks but downregulated during blood feeding [17]. The ospA gene is located on linear plasmid 54 (lp54) [18]. Its open reading frame typically ranges from 819 to 825 base pairs in length, encoding a protein of approximately 30 kDa [16]. Initially, B. burgdoferi s.l. spirochetes were divided into eight serotypes based on their reactivity to anti-OspA monoclonal antibodies [19,20]. OspA serotypes generally correlate with specific genospecies: B. burgdorferi s.s. is typed as serotype 1; B. afzelii and B. bavariensis are typed as serotypes 2 and 4, respectively; and B. garinii, the most heterogeneous species among the B. burgdorferi s.l. complex, is typed as serotypes 3, 5, 6, 7, and 8. Recently, Lee and co-authors [21], based on analysis of 90 unique OspA protein variants, proposed a sequence-based OspA in silico typing (IST) scheme. This IST typing includes IST1–IST8, which correspond to OpsA serotypes 1–8, previously identified by traditional serological methods, and potentially novel OspA types corresponding to OspA variants of B. bavariensis from Asia (IST9, IST10), B. garinii (IST11, IST12), and other Borrelia genospecies (IST13–IST17). The ospA gene exhibits significant diversity, not only across different Borrelia genospecies but also among strains within a single species. Notably, different ISTs within a single genospecies do not always cluster together. Thus, B. bavariensis strains do not form a monophyletic group but are divided into three clades, corresponding to three different ISTs. These include the highly conserved IST4, identified in the I. ricinus distribution area, and the more variable IST9 and IST10, which are found in Asia [21].
The genetic diversity of different Borrelia genospecies for the ospA gene has been investigated in a number of studies [16,21,22,23,24,25,26]. However, data on the ospA variability of Siberian Borrelia isolates remain limited and primarily include strains isolated from I. persulcatus and I. pavlovskyi collected in the Tomsk and Novosibirsk surroundings [27].
This study aimed to investigate the genetic diversity of the recently identified species “Candidatus B. sibirica” from Omsk province for the ospA gene and compare it with the ospA gene diversity of other B. burgdorferi s.l. isolates from the same locations. Particular attention was paid to isolates from the poorly studied tick species I. trianguliceps and I. apronophorus.
2. Materials and Methods
2.1. Sampling
All experiments with animals were approved by the Animal Welfare Act of the Omsk Research Institute of Natural Foci Infections, according to the guidelines for experiments with laboratory animals (Supplement to the Order of the Russian Ministry of Health, no. 755, of 12 August 1977). The study was approved by the Bioethical Committee of the Omsk Research Institute of Natural Foci Infections (Protocol No. 4, 17 February 2016; Protocol No.1, 15 March 2024).
Sampling was conducted in 2016, 2024, and 2025 at two locations of approximately 20 km2 each within the forest zone of Omsk province, Western Siberia; the sampling locations and tick collection from small mammals have been previously described [12]. Briefly, the first site (Om-Bo) was located in Bolsheukov district (56°46′ N, 72°03′ E), and the second site (Om-Zn) was situated in Znamenskiy district (57°23′ N, 73°40′ E) (Figure 1). Small mammals were captured using live traps, and attached Ixodes spp. ticks were removed by forceps. Some engorged larvae were transported to the laboratory and allowed to molt into nymphs, while other ticks were frozen and stored at −70 °C until DNA extraction. In addition, unfed adult I. persulcatus specimens were collected by flagging from vegetation. Identification of questing ticks was carried out using a stereomicroscope, MC-800 (Micros, Sankt Veit an der Glan, Austria), according to morphological criteria [28]. To identify ticks collected from small mammals, multiplex PCR for the ITS2 locus with primers specific to I. persulcatus, I. trianguliceps, and I. apronophorus (Table 1) was conducted, as previously described [29].
Some of the molted ticks and ticks from vegetation were stored at 6–10 °C and used for cultivation of B. burgdorferi s.l. spirochetes in BSK-H medium. The remaining ticks were frozen and stored at −70 °C until DNA extraction.
2.2. Borrelia Cultivation
Ticks were washed sequentially in 4% H2O2 for 2 min, followed by two washes in 70% ethanol and two washes in sterile phosphate-buffered saline (PBS), for 5 min each. The ticks were then homogenized using sterile pestles in 80 µL of BSK-H medium. The resulting suspensions were centrifuged at 100 g for 30 s; 40 µL of each supernatant was used to cultivate the spirochetes; the remaining tick material was used for DNA extraction. Borrelia was cultured in BSK-H medium (Sigma Chemical Co., St. Louis, Mo, USA) supplemented with 6% rabbit serum (Sigma, USA) and containing 1× antibiotic mixture (HiMedia, Mumbai, India) in tightly sealed 0.6 mL tubes at 33 °C without agitation. The volume of initial cultures was 570 µL. Spirochete growth was monitored for 1–3 months under a microscope at 400× magnification (Axio Imager A1, Zeiss, Jena, Germany). To obtain stable isolates, the primary isolates were subcultured into a fresh culture medium within 1.5 mL screw cap tubes at a final working volume of 1.5 mL. From each obtained isolate, 30 µL of culture medium was collected and used for DNA extraction.
2.3. DNA Extraction
To prevent cross-contamination, DNA extraction, PCR assays, and electrophoresis were conducted in separate rooms. Total DNA was extracted from whole frozen ticks, from tick suspensions obtained during Borrelia cultivation, and from culture medium. Before DNA extraction, ticks were washed individually with bidistilled water, then with 70% ethanol, and finally with bidistilled water for 5 min each. Ticks were homogenized with a MagNA Lyser system (Roche Diagnostics, Basel, Switzerland). DNA extraction was conducted using the Proba NK kit (DNA-Technology, Moscow, Russia), according to the manufacturer’s instructions. DNA was eluted in 50 μL of elution buffer and stored at −70 °C.
2.4. Borrelia burgdorferi s.l. Detection, Genotyping, and Characterization of the ospA Gene
Borrelia burgdorferi s.l. DNA was detected by real-time PCR using a RealBest DNA Borrelia burgdorferi s.l. kit (Vector-Best, Novosibirsk, Russia). For all positive samples, the fragments of IGS, clpA, and/or p83/100 were amplified using nested PCR with primers specified in Table 1. The B. burgdorferi s.l. species were determined by sequencing clpA or IGS fragments and by comparing the lengths of the obtained PCR fragments of the p83/100 gene (336 bp for B. afzelii and 426 bp for B. bavariensis), as described previously [10]. “Candidatus B. sibirica” was identified by nested reactions with species-specific primers for the IGS region (Table 1). For a number of positive samples belonging to different genospecies, the ospA gene fragments were amplified using nested PCR with the primers indicated in Table 1 and used for subsequent sequencing.
2.5. Phylogenetic Analysis
The obtained PCR fragments were purified in 0.6% SeaKem® GTG-agarose (Lonza, Haifa, Israel). Sanger sequencing was conducted with primers indicated in Table 1 in both directions using a BigDye Terminator V. 3.1 Cycling Sequencing Kit (Applied Biosystems, Carlsbad, CA, USA). Sanger reaction products were analyzed using an ABI 3500 Genetic Analyzer (Applied Biosystems, Carlsbad, CA, USA). The quality of chromatograms was assessed by Phred quality score using the uGene v. 52.1 software [30]. The determined clpA and IGS sequences were compared with those from the NCBI website using BLASTN (https://blast.ncbi.nlm.nih.gov/Blast.cgi, accessed on 15 October 2025). The determined clpA gene sequences were also analyzed using the PubMLST website (https://pubmlst.org/organisms/borrelia-spp, accessed on 15 October 2025). Phylogenetic analysis was performed using the maximum likelihood (ML) method based on the General Time Reversible with Gamma distribution (GTR + G) model. The best-fitting substitution model was determined with the Bayesian Information Criterion (BIC) using the ML model test implemented in MEGA 7.0 [31]. Nucleotide diversity (π) and haplotype diversity (Hd) were computed for each group using standard population-genetic estimators implemented in the ape and pegas R packages (R v4.4.2; ape v5.8; pegas v1.2) [32]. Statistical comparisons between groups were performed in R with appropriate multiple-testing correction (Benjamini–Hochberg FDR). p < 0.05 was regarded as significant.
2.6. Nucleotide Sequence Accession Numbers
Nucleotide sequences determined in this study were submitted to the GenBank database (http://www.ncbi.nlm.nih.gov, accessed on 15 November 2025) under accession numbers PX461036-PX461050 and PX513318-PX513325.
3. Results
3.1. Borrelia burgdorferi s.l. Detection and Species Determination
Based on the results of PCR detection, B. burgdorferi s.l. DNA was found in 32/123 (26.0%) I. persulcatus samples collected from vegetation in 2024–2025; in 127/261 (48.7%) Ixodes spp. (121/232 I. persulcatus, 3/16 I. trianguliceps, and 3/13 I. apronophorus) collected from rodents in 2024–2025 as larvae and molted into nymphs; and in 5/44 (11.4%) Ixodes spp. (5/10 I. apronophorus) collected from rodents in 2016 (Table 2). Stable Borrelia strains or primary isolates, confirmed by microscopy, were obtained from ten PCR-positive ticks collected from vegetation and from two molted ticks: one I. persulcatus and one I. trianguliceps. Genotyping of the B. burgdorferi s.l. isolates revealed two genospecies—B. bavariensis and B. afzelii—in ticks collected from both vegetation and rodents in 2024 and 2025, with B. bavariensis predominating in both locations. In contrast, only “Candidatus B. sibirica” was identified in ticks collected from rodents at the Om-Bo site in 2016 (Table 2).
3.2. Results of ospA Characterization and Phylogenetic Analysis
Complete ospA gene sequences were determined for 36 samples, comprising 13 “Candidatus B. sibirica”, 6 B. afzelii, 1 B. garinii, and 16 B. bavariensis isolates, which were identified in Ixodes spp. ticks and a blood sample from Sorex araneus from different locations (Table 3).
Twelve of the “Candidatus B. sibirica” samples were detected in Ixodes spp. collected from rodents at the Om-Bo site in 2016. This subset included three new specimens identified in this study and nine isolates that were previously described [12]. The remaining “Candidatus B. sibirica” sample was identified in the blood of S. araneus captured in 2024 at the Om-Zn site [33] (Table 3). Of the six genotyped B. afzelii samples, five samples were identified directly in I. persulcatus from both locations, and one sample was from a strain isolated from I. persulcatus. The sixteen B. bavariensis specimens were identified from the following sources: six samples from cultured strains from I. persulcatus (n = 5) and I. trianguliceps (n = 1); three samples from questing I. persulcatus (n = 3); and seven samples from molted ticks, including I. persulcatus (n = 4), I. apronophorus (n = 2), and I. trianguliceps (n = 1) (Table 3). In addition, one B. garinii strain isolated from I. pavlovskyi from Novosibirsk Province was genotyped for the ospA gene (Table 3).
The results of B. burgdorferi s.l. species determination for the ospA gene were consistent with the results obtained from analyses of the clpA, p83/100, and IGS sequences. The ospA gene sequences of “Candidatus B. sibirica” were determined for the first time in this study. These sequences were highly conserved, with 12 of the 13 being identical. A single sequence (PX461040) differed by two nucleotide substitutions, one of which was synonymous, resulting in an intraspecific identity of 99.8–100%. The ospA gene sequences of “Candidatus B. sibirica” were genetically distant from the corresponding sequences of other Borrelia genospecies, showing the level of nucleotide identity varying from 81.5% (B. valaisiana, IST15) to 88.7% (B. bavariensis, IST4) (Table 4). Similarly, the deduced OspA amino acid sequences shared identities ranging from 69.2% (B. valaisiana) to 84.2% (B. yangtzensis). On the phylogenetic tree, the ospA gene sequences of “Candidatus B. sibirica” with a high level of support formed a separate branch, demonstrating its distinct phylogenetic status (Figure 2).
The obtained B. afzelii ospA gene sequences were also highly conserved. Five distinct sequence variants of the ospA gene were found. One variant was identical to a known sequence of B. afzelii strain, Nov1105 (DQ479293), while the other four variants differed from this sequence by 1–2 nucleotide substitutions and from each other by 1–3 substitutions, corresponding to a 99.6–99.9% identity level. The determined ospA sequences of B. afzelii, together with the known B. afzelii sequences, formed a single group on the phylogenetic tree, belonging to the IST2 cluster (Figure 2).
In contrast to the highly conserved sequences of “Candidatus B. sibirica” and B. afzelii, the determined ospA sequences of B. bavariensis exhibited considerable diversity. These sequences differed from each other by 1–128 mismatches, including six indels, demonstrating 84.4–99.9% identity. A total of eight different sequence variants were identified. Five of these variants were identical to known sequences of the strains BgVir (DQ479279), Nov 405 (DQ479276), Tom 1003 (DQ479288), Tom 5102 (DQ479284), and Arh923-2012 (NZ_JACFBD010000003), while the remaining three variants were unique and differed from the known sequences by 1–11 substitutions. Notably, 4 of the 16 ospA sequences of B. bavariensis (1 from I. trianguliceps and 3 from I. persulcatus) contained multiple polymorphic sites (ranging from 12 to over 50 single-nucleotide polymorphisms (SNPs)) and were consequently excluded from the phylogenetic analysis. The remaining sequences belonged to two well-supported clusters. The first cluster comprised known sequences corresponding to IST9 (e.g., strains BgVir and J-15) and eight novel sequences from this study, identified in various tick species from both the Om-Bo and Om-Zn sites. The second cluster consisted of sequences corresponding to IST10 (e.g., strains Fujip2 and Arh923-2012) and four novel sequences from this study, all of which were derived from I. persulcatus collected at the Om-Bo site (Figure 2, Table 3).
The sequences from the cluster IST9 obtained in this study differed from each other by 6–25 mismatches (including three indels), corresponding to a sequence identity of 96.9–99.3%, whereas sequences from the cluster IST10 differed from each other by 1–39 mismatches (including three indels), representing a 95.2–99.9% identity range. This study also reports the first determination of B. bavariensis ospA sequences from samples identified in I. trianguliceps and I. apronophorus. Notably, these sequences were not unique to these tick species. They were either identical to sequences previously found in I. persulcatus or, as in the case of one sample from I. apronophorus (PX513326), differed from them by five SNPs.
In addition to B. burgdorferi s.l. strains from Omsk province, the obtained ospA gene sequence of B. garinii (strain 72) isolated from I. pavlovskyi in Novosibirsk province was included in the phylogenetic analysis. The determined B. garinii sequence differed from the closest sequence (strain Tom 203, DQ479286) by three nucleotide substitutions and clustered with B. garinii sequences corresponding to IST5 (e.g., strain PMe, Germany) (Figure 2).
In total, the Borrelia isolates identified in Omsk province represent four distinct genospecies based on nuclear loci. Analysis of their ospA plasmid locus classifies these isolates into four separate ospA-based serotype clusters.
Analysis of ospA sequences from different Borrelia genospecies—including those obtained in this study and previously published sequences from Western Siberia—revealed that “Candidatus B. sibirica” exhibits significantly lower genetic diversity than other genospecies. Specifically, it has the lowest nucleotide (π = 0.0004) and haplotype (Hd = 0.154) diversity. The differences in nucleotide diversity were statistically significant (p < 0.05) between “Candidatus B. sibirica” and B. bavariensis from the IST9 and IST10 clusters but not between “Candidatus B. sibirica” and B. afzelii. The differences in haplotype diversity were also significant (p < 0.05) between “Candidatus B. sibirica” and all other IST clusters (Table 5).
Comparisons among other genospecies revealed that B. afzelii had lower nucleotide diversity (π = 0.0015) than B. bavariensis from both the IST9 (π = 0.0150) and IST10 (π = 0.0244) clusters, and this difference was statistically significant (p < 0.05). Haplotype diversity was significantly higher (p < 0.05) for B. bavariensis of the IST9 cluster (Hd = 0.872) than for the IST10 cluster (Hd = 0.733) and B. afzelii (Hd = 0.75) (Table 5). As expected, pooled B. bavariensis isolates from both clusters exhibited significantly higher (p < 0.05) nucleotide (π = 0.0785) and haplotype (Hd = 0.913) diversity compared to the individual IST clusters analyzed separately (Table 5).
4. Discussion
Borrelia OspA protein is crucial for bacterial survival in ticks, as it is essential for spirochete adhesion to the tick midgut and further colonization [34,35]. Due to its important role in transmission, OspA is a well-known target for LB vaccines, as antibodies against OspA can prevent transmission of bacteria from infected ticks to hosts. Consequently, the study of ospA gene diversity is important for the development of multivalent OspA-based vaccines directed against a wide range of Borrelia genospecies. Eight OspA serotypes of B. burgdorferi s.l. are known; in addition, nine potential serotypes have recently been identified based on OspA sequence typing [21].
This study provides the first data on the diversity of the ospA gene in B. burgdorferi s.l. isolates from the sympatric areas of I. persulcatus, I. trianguliceps, and I. apronophorus in Western Siberia. Particular attention is paid to characterizing ospA diversity in the recently found species “Candidatus B. sibirica,” as well as in isolates derived from the poorly studied nidicolous ticks I. trianguliceps and I. apronophorus.
The first ospA gene sequences were obtained for 13 “Candidatus B. sibirica” isolates, which were found in Ixodes spp. collected from rodents at site Om-Bo in 2016 and in the blood sample of a shrew at site Om-Zn in 2024 (Table 3). Although the examined samples varied in sampling location, collection year, and type of sample (ticks and blood samples), the obtained ospA gene sequences were highly conserved and demonstrated the lowest genotype and haplotype diversity (Table 5). On the phylogenetic tree, these sequences form a separate, well-supported clade and can be considered a potential new IST. The high genetic stability of “Candidatus B. sibirica” was previously demonstrated by an analysis of the genomic housekeeping clpA gene, the p83/100 gene that encodes the outer membrane protein, as well as the ribosomal 16S rRNA gene and 5S-23S IGS for 22 “Candidatus B. sibirica” isolates. Moreover, MLST analysis revealed an identical sequence type (ST806) for two isolates from geographically distant regions of Siberia (Altai and Omsk provinces) [12]. The observed high genetic stability at plasmid and nuclear loci may result from the adaptation of “Candidatus B. sibirica” to a narrow ecological niche due to its putative association with the scarce tick I. apronophorus.
The observed diversity of Siberian isolates of B. afzelii and B. bavariensis for the ospA gene is consistent with the data from previous publications [21,23,25,27]. The determined B. afzelii sequences were conserved and, together with other known B. afzelii sequences from Europe and Asia, formed a single well-supported clade, while B. bavariensis sequences were variable and subdivided into two distant clades corresponding to IST9 and IST10, widely spread in Asia (Figure 2).
For nidicolous I. trianguliceps and I. apronophorus ticks, whose life stages feed primarily on small mammals, examining engorged ticks collected from hosts and subsequently molted in the laboratory can provide crucial insights into specific tick–pathogen associations. In this study, Borrelia isolates from molted I. trianguliceps and I. apronophorus were genotyped for the ospA gene for the first time. Only B. bavariensis was found in these ticks, confirming our previous findings [12]. Notably, the obtained B. bavariensis sequences from I. trianguliceps and I. apronophorus were identical to the ospA sequences identified in I. persulcatus from Siberia. Previous genotyping of B. bavariensis isolates from molted I. trianguliceps and I. apronophorus for the clpA and p83/100 genes also failed to reveal any tick-specific variants [12]. Taken together, these results indicate that nidicolous ticks, along with human-biting I. persulcatus, may participate in common enzootic cycles associated with highly pathogenic species B. bavariensis.
Ixodes apronophorus is widely distributed across Europe and Western Siberia, inhabiting sympatric areas with I. ricinus in Europe and I. persulcatus in Asia [36,37]. However, because of mosaic distribution and a generally low abundance, this tick species remains poorly studied. To date, Borrelia in I. apronophorus has only been found in ticks in the Omsk province in this and previous studies. Two Borrelia species are suggested to be associated with I. apronophorus [12]. Of these, B. bavariensis isolates identified in I. apronophorus are genetically variable, while “Candidatus B. sibirica” appears to be the most genetically conserved species in the studied locations. A similar pattern of genetic stability has been observed in the European genotype of B. bavariensis (OspA serotype 4). Genetic and genomic data indicate that B. bavariensis spread from Asia to Europe and experienced a significant genetic bottleneck during this invasion. This bottleneck was likely driven by its adaptation to a new vector, shifting from I. persulcatus to I. ricinus [38,39]. We hypothesize that a similar population bottleneck may have accompanied the adaptation of “Candidatus B. sibirica” to I. apronophorus. Thus, “Candidatus B. sibirica” may have evolved from a closely related B. bavariensis or B. garinii species with a vector switch from I. ricinus or I. persulcatus to I. apronophorus. Notably, further studies of Borrelia in I. apronophorus from regions where it is sympatric with I. ricinus could elucidate both the broader geographical distribution and genetic diversity of “Candidatus B. sibirica”, as well as the evolutionary events that led to its emergence.
Author Contributions
Conceptualization, V.R.; Methodology, Y.I. and V.R.; Formal Analysis, Y.I. and V.F.; Investigation, Y.I., V.R., V.Y., A.B., V.F., A.K., G.R. and T.E.; Resources, V.Y., A.K. and G.R.; Writing—Original Draft Preparation, Y.I. and V.R.; Writing—Review and Editing, N.T.; Supervision, N.T.; Funding Acquisition, V.R. All authors have read and agreed to the published version of the manuscript.
Funding
This research was funded by the Russian Science Foundation, research project No. 24-24-00390.
Institutional Review Board Statement
All experiments with animals were conducted in compliance with the Animal Welfare Act of the Omsk Research Institute of Natural Foci Infections, according to the guidelines for experiments with laboratory animals (Supplement to the Order of the Russian Ministry of Health, no. 755, of 12 August 1977). This animal study was approved by the Bioethical Committee of the Omsk Research Institute of Natural Foci Infections (Protocol No. 4, 17 February 2016; Protocol No.1, 15 March 2024).
Informed Consent Statement
Not applicable.
Data Availability Statement
The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding author.
Acknowledgments
The authors are grateful to their colleague Bogdana Kravchuk for her assistance in the statistical treatment of data.
Conflicts of Interest
The authors declare no conflicts of interest.
References
- Wolcott, K.A.; Margos, G.; Fingerle, V.; Becker, N.S. Host association of Borrelia burgdorferi sensu lato: A review. Ticks Tick Borne Dis. 2021, 12, 101766. [Google Scholar] [CrossRef] [PubMed]
- Bergamo, S.; Trevisan, G.; Ruscio, M.; Bonin, S. Borrelial Diseases Across Eurasia. Biology 2025, 14, 1357. [Google Scholar] [CrossRef] [PubMed]
- Mead, P. Epidemiology of Lyme Disease. Infect. Dis. Clin. N. Am. 2022, 36, 495–521. [Google Scholar] [CrossRef] [PubMed]
- Strle, F.; Maraspin, V.; Lotrič-Furlan, S.; Ogrinc, K.; Rojko, T.; Kastrin, A.; Strle, K.; Wormser, G.P.; Bogovič, P. Lower Frequency of Multiple Erythema Migrans Skin Lesions in Lyme Reinfections, Europe. Emerg. Infect. Dis. 2025, 31, 662–668. [Google Scholar] [CrossRef]
- Marques, A.R.; Strle, F.; Wormser, G.P. Comparison of Lyme Disease in the United States and Europe. Emerg. Infect. Dis. 2021, 27, 2017–2024. [Google Scholar] [CrossRef]
- Strle, F.; Nadelman, R.B.; Cimperman, J.; Nowakowski, J.; Picken, R.N.; Schwartz, I.; Maraspin, V.; Aguero-Rosenfeld, M.E.; Varde, S.; Lotric-Furlan, S.; et al. Comparison of culture-confirmed erythema migrans caused by Borrelia burgdorferi sensu stricto in New York State and by Borrelia afzelii in Slovenia. Ann. Intern. Med. 1999, 130, 32–36. [Google Scholar] [CrossRef]
- Strle, F.; Ružić-Sabljić, E.; Logar, M.; Maraspin, V.; Lotrič-Furlan, S.; Cimperman, J.; Ogrinc, K.; Stupica, D.; Nadelman, R.B.; Nowakowski, J.; et al. Comparison of erythema migrans caused by Borrelia burgdorferi and Borrelia garinii. Vector Borne Zoonotic Dis. 2011, 11, 1253–1258. [Google Scholar] [CrossRef]
- Strnad, M.; Hönig, V.; Růžek, D.; Grubhoffer, L.; Rego, R.O.M. Europe-Wide Meta-Analysis of Borrelia burgdorferi Sensu Lato Prevalence in Questing Ixodes ricinus Ticks. Appl. Environ. Microbiol. 2017, 83, e00609-17. [Google Scholar] [CrossRef]
- Fomenko, N.V.; Livanova, N.N.; Romanova, E.V.; Karavaeva, I.I.; Panov, V.V.; Chernousova, N.I. Detection of DNA of borrelia circulating in Novosibirsk region. J. Microbiol. Epidemiol. Immunobiol. 2006, 7, 22–28. (In Russian) [Google Scholar]
- Rar, V.; Livanova, N.; Tkachev, S.; Kaverina, G.; Tikunov, A.; Sabitova, Y.; Igolkina, Y.; Panov, V.; Livanov, S.; Fomenko, N.; et al. Detection and genetic characterization of a wide range of infectious agents in Ixodes pavlovskyi ticks in Western Siberia, Russia. Parasit. Vectors 2017, 10, 258. [Google Scholar] [CrossRef]
- Sabitova, Y.; Fomenko, N.; Tikunov, A.; Stronin, O.; Khasnatinov, M.; Abmed, D.; Danchinova, G.; Golovljova, I.; Tikunova, N. Multilocus sequence analysis of Borrelia burgdorferi sensu lato isolates from Western Siberia, Russia and Northern Mongolia. Infect. Genet. Evol. 2018, 62, 160–169. [Google Scholar] [CrossRef] [PubMed]
- Sabitova, Y.; Rar, V.; Tikunov, A.; Yakimenko, V.; Korallo-Vinarskaya, N.; Livanova, N.; Tikunova, N. Detection and genetic characterization of a putative novel Borrelia genospecies in Ixodes apronophorus/Ixodes persulcatus/Ixodes trianguliceps sympatric areas in Western Siberia. Ticks Tick Borne Dis. 2023, 14, 102075. [Google Scholar] [CrossRef] [PubMed]
- Mukhacheva, T.A.; Kovalev, S.Y. Borrelia spirochetes in Russia: Genospecies differentiation by real-time PCR. Ticks Tick Borne Dis. 2014, 5, 722–726. [Google Scholar] [CrossRef] [PubMed]
- Korenberg, E.I.; Kovalevskii, Y.V.; Gorelova, N.B.; Nefedova, V.V. Comparative analysis of the roles of Ixodes persulcatus and I. trianguliceps ticks in natural foci of ixodid tick-borne borrelioses in the Middle Urals, Russia. Ticks Tick Borne Dis. 2015, 6, 316–321. [Google Scholar] [CrossRef]
- Margos, G.; Gatewood, A.G.; Aanensen, D.M.; Hanincová, K.; Terekhova, D.; Vollmer, S.A.; Cornet, M.; Piesman, J.; Donaghy, M.; Bormane, A.; et al. MLST of housekeeping genes captures geographic population structure and suggests a European origin of Borrelia burgdorferi. Proc. Natl. Acad. Sci. USA 2008, 24, 8730–8735. [Google Scholar] [CrossRef]
- Will, G.; Jauris-Heipke, S.; Schwab, E.; Busch, U.; Rössler, D.; Soutschek, E.; Wilske, B.; Preac-Mursic, V. Sequence analysis of ospA genes shows homogeneity within Borrelia burgdorferi sensu stricto and Borrelia afzelii strains but reveals major subgroups within the Borrelia garinii species. Med. Microbiol. Immunol. 1995, 184, 73–80. [Google Scholar] [CrossRef]
- Templeton, T.J. Borrelia outer membrane surface proteins and transmission through the tick. J. Exp. Med. 2004, 199, 603–606. [Google Scholar] [CrossRef]
- Wallich, R.; Jahraus, O.; Stehle, T.; Tran, T.T.; Brenner, C.; Hofmann, H.; Gern, L.; Simon, M.M. Artificial-infection protocols allow immunodetection of novel Borrelia burgdorferi antigens suitable as vaccine candidates against Lyme disease. Eur. J. Immunol. 2003, 33, 708–719. [Google Scholar] [CrossRef]
- Wilske, B.; Preac-Mursic, V.; Göbel, U.B.; Graf, B.; Jauris, S.; Soutschek, E.; Schwab, E.; Zumstein, G. An OspA serotyping system for Borrelia burgdorferi based on reactivity with monoclonal antibodies and OspA sequence analysis. J. Clin. Microbiol. 1993, 31, 340–350. [Google Scholar] [CrossRef]
- Wilske, B.; Busch, U.; Fingerle, V.; Jauris-Heipke, S.; Preac Mursic, V.; Rössler, D.; Will, G. Immunological and molecular variability of OspA and OspC. Implications for Borrelia vaccine development. Infection 1996, 24, 208–212. [Google Scholar] [CrossRef]
- Lee, J.T.; Li, Z.; Nunez, L.D.; Katzel, D.; Perrin, B.S., Jr.; Raghuraman, V.; Rajyaguru, U.; Llamera, K.E.; Andrew, L.; Anderson, A.S.; et al. Development of a sequence-based in silico OspA typing method for Borrelia burgdorferi sensu lato. Microb. Genom. 2024, 10, 001252. [Google Scholar] [CrossRef]
- Anderson, J.M.; Norris, D.E. Genetic diversity of Borrelia burgdorferi sensu stricto in Peromyscus leucopus, the primary reservoir of Lyme disease in a region of endemicity in southern Maryland. Appl. Environ. Microbiol. 2006, 72, 5331–5341. [Google Scholar] [CrossRef] [PubMed]
- Ćakić, S.; Veinović, G.; Cerar, T.; Mihaljica, D.; Sukara, R.; Ružić-Sabljić, E.; Tomanović, S. Diversity of Lyme borreliosis spirochetes isolated from ticks in Serbia. Med. Vet. Entomol. 2019, 33, 512–520. [Google Scholar] [CrossRef] [PubMed]
- Ryffel, K.; Péter, O.; Dayer, E.; Bretz, A.G.; Godfroid, E. OspA heterogeneity of Borrelia valaisiana confirmed by phenotypic and genotypic analyses. BMC Infect. Dis. 2003, 3, 14. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Mediannikov, O.Y.; Ivanov, L.; Zdanovskaya, N.; Vorobyova, R.; Sidelnikov, Y.; Fournier, P.E.; Tarasevich, I.; Raoult, D. Diversity of Borrelia burgdorferi sensu lato in Russian Far East. Microbiol. Immunol. 2005, 49, 191–197. [Google Scholar] [CrossRef]
- Colunga-Salas, P.; Hernández-Canchola, G.; Sánchez-Montes, S.; Lozano-Sardaneta, Y.N.; Becker, I. Genetic diversity of Borrelia burgdorferi sensu stricto: Novel strains from Mexican wild rodents. Transbound. Emerg. Dis. 2021, 68, 1263–1274. [Google Scholar] [CrossRef]
- Fomenko, N.V.; Stronin, O.V.; Khasnatinov, M.N.; Danchinova, G.A.; Bataa, J.; Gol’tsova, N.A. Heterogeneity of the ospA gene structure from isolates of Borrelia garinii and Borrelia afzelii from Western Siberia and Mongolia. Mol. Genet. Microbiol. Virol. 2009, 24, 183–188. [Google Scholar] [CrossRef]
- Filippova, N.A. Fauna of the USSR. In Arachnida, New Ser. 4: Ixodid Ticks of the Subfamily Ixodinae; Nauka: Leningrad, Russia, 1977; 396p. (In Russian) [Google Scholar]
- Rar, V.; Yakimenko, V.; Tikunov, A.; Vinarskaya, N.; Tancev, A.; Babkin, I.; Epikhina, T.; Tikunova, N. Genetic and morphological characterization of Ixodes apronophorus from Western Siberia, Russia. Ticks Tick Borne Dis. 2020, 11, 101284. [Google Scholar] [CrossRef]
- Okonechnikov, K.; Golosova, O.; Fursov, M. UGENE team. Unipro UGENE: A unified bioinformatics toolkit. Bioinformatics 2012, 28, 1166–1167. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef]
- R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2025; Available online: https://www.r-project.org/ (accessed on 1 December 2025).
- Rar, V.; Yakimenko, V.; Igolkina, Y.; Sabitova, Y.; Fedorets, V.; Karimov, A.; Rubtsov, G.; Epikhina, T.; Tikunova, N. The first study of Borrelia burgdorferi sensu lato persistence in small mammals captured in the Ixodes persulcatus distribution area in Western Siberia. Pathogens 2025, 14, 1200. [Google Scholar] [CrossRef]
- Pal, U.; de Silva, A.M.; Montgomery, R.R.; Fish, D.; Anguita, J.; Anderson, J.F.; Lobet, Y.; Fikrig, E. Attachment of Borrelia burgdorferi within Ixodes scapularis mediated by outer surface protein A. J. Clin. Investig. 2000, 106, 561–569. [Google Scholar] [CrossRef]
- Trezel, P.; Guérin, M.; Da Ponte, H.; Maffucci, I.; Octave, S.; Avalle, B.; Padiolleau-Lefèvre, S. Borrelia surface proteins: New horizons in Lyme disease diagnosis. Appl. Microbiol. Biotechnol. 2025, 109, 156. [Google Scholar] [CrossRef]
- Fedorov, D.; Hornok, S. Checklist of hosts, illustrated geographical range and ecology of tick species from the genus Ixodes (Acari, Ixodidae) in Russia and other post-Soviet countries. Zookeys 2024, 1201, 255–343. [Google Scholar] [CrossRef]
- Sándor, A. Ixodes apronophorus Schulze, 1924. In Ticks of Europe and North Africa; Estrada-Peña, A., Mihalca, A., Petney, T., Eds.; Springer: Cham, Switzerland, 2017; pp. 179–181. [Google Scholar]
- Margos, G.; Fingerle, V.; Reynolds, S. Borrelia bavariensis: Vector Switch, Niche Invasion, and Geographical Spread of a Tick-Borne Bacterial Parasite. Front. Ecol. Evol. 2019, 7, 401. [Google Scholar] [CrossRef]
- Rollins, R.E.; Sato, K.; Nakao, M.; Tawfeeq, M.T.; Herrera-Mesías, F.; Pereira, R.J.; Kovalev, S.; Margos, G.; Fingerle, V.; Kawabata, H.; et al. Out of Asia? Expansion of Eurasian Lyme borreliosis causing genospecies display unique evolutionary trajectories. Mol. Ecol. 2023, 32, 786–799. [Google Scholar] [CrossRef]
Figure 1.
Map showing the location of sampling sites. Sampling sites are marked by stars.
Figure 2.
Phylogenetic tree constructed by the ML method based on sequences of ospA gene fragments (length, 819–825 bp) of B. burgdorferi s.l. Sequences obtained in this study are marked in red. ●—I. persulcatus; ■—I. apronophorus; ▲—I. trianguliceps; ♦—I. pavlovskyi; Δ—a specimen from a small mammal. The scale-bar indicates an evolutionary distance of 0.02 nucleotides per position. Significant bootstrap values (>70%) are shown on the nodes.
Figure 2.
Phylogenetic tree constructed by the ML method based on sequences of ospA gene fragments (length, 819–825 bp) of B. burgdorferi s.l. Sequences obtained in this study are marked in red. ●—I. persulcatus; ■—I. apronophorus; ▲—I. trianguliceps; ♦—I. pavlovskyi; Δ—a specimen from a small mammal. The scale-bar indicates an evolutionary distance of 0.02 nucleotides per position. Significant bootstrap values (>70%) are shown on the nodes.
Table 1.
Primers used for identification and genotyping of Ixodes spp. and B. burgdorferi s.l.
| Locus | Organism | Reaction | Primer Name | Primer Sequences 5′-3′ | T # (°C) | Size (bp) | References |
|---|---|---|---|---|---|---|---|
| ITS2 | Ixodes spp. | Multiplex | dITS29 | ccttcccgtggcttcgtctgt | 60 | [29] | |
| ITS2 | I. persulcatus | IP_rev | ctgtacatccgtccatttaggc | 412–413 | |||
| ITS2 | I. trianguliceps | IT_rev | cggcaatcgaacgacgt | 222 | |||
| ITS2 | I. apronophorus | IA_rev | tggcgaagatcatttgagttg | 706–709 | |||
| IGS | B. burgdorferi s.l. | Primary | NC1 | cctgttatcattccgaacacag | 50 | 350–384 | [10] |
| NC2 | tactccattcggtaatcttggg | ||||||
| Nested | NC3 | tactgcgagttcgcgggag | 50 | 237–271 | |||
| NC4 | cctaggcattcaccatagac | ||||||
| “Ca. B. sibirica” | Nested | Bsib | ataaaacattctaaaaaaatgaaca | 50 | 172 | This study | |
| NC4 | cctaggcattcaccatagac | [10] | |||||
| clpA | B. burgdorferi s.l. | Primary | clpAF1237 | aaagatagatttcttccagac | 50 | 982 | [15] |
| clpAR2218 | gaatttcatctattaaaagctttc | ||||||
| Nested | clpAF1255 | gacaaagcttttgatattttag | 50 | 850 | |||
| clpAR2104 | caaaaaaaacatcaaattttctatctc | ||||||
| p83/100 | B. burgdorferi s.l. | Primary | F7 | ttcaaagggatactgttagagag | 50 | 438–528 | [10] |
| F10 | aagaaggcttatctaatggtgatg | ||||||
| Nested | F5 | acctggtgatgtaagttctcc | 54 | 336–426 | |||
| F12 | ctaacctcattgttgttagactt | ||||||
| ospA | B. burgdorferi s.l. | Primary | pA3 | ctatttgttatttgttaatcttatac | 48 | 935–944 | [27] |
| pA4 | gcaaatcctagtaaatattgtttc | ||||||
| Nested | ospA91F | aaaaggagaatatattatgaaaa | 48 | 855–862 | This study | ||
| ospA924R | tattktttcataaattctcctt | ||||||
| ospA | B. burgdorferi s.l. | Sequencing | ospA561F * | ccggaaaagctaaagaagtt | This study | ||
| ospA561R * | aacttctttagcttttccgg |
* Primers used only for sequencing. # Annealing temperature.
Table 2.
Results of Borrelia burgdorferi s.l. detection.
| Site | Sampling Period | Source of Isolation | No. of Ticks | No. (%) of Ticks Containing Bbsl DNA | Results of Bbsl Species Determination | Samples Used for ospA Genotyping | |||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| B.a | B.bav | Ca.B.sib | Mixed | B.a | B.bav | Ca.B.sib | |||||
| Om-Bo | June 2024 | I. persulcatus, flagging | 28 | 8 (28.6) | 2 | 5 | 0 | 1 | 0 | 1 | 0 |
| Om-Bo | May 2025 | I. persulcatus, flagging | 95 | 24 (25.3) | 8 | 9 | 0 | 7 | 2 | 6 | 0 |
| Om-Zn | September 2024 | Ixodes spp, from rodents, molted: | 90 | 28 (31.1) | 5 | 20 | 0 | 3 | 4 | 5 | 0 |
| I. apronophorus | 8 | 3 (37.5) | 0 | 3 | 0 | 0 | 0 | 2 | 0 | ||
| I. trianguliceps | 14 | 2 (14.3) | 0 | 2 | 0 | 0 | 0 | 2 | 0 | ||
| I. persulcatus | 68 | 23 (33.8) | 5 | 15 | 0 | 3 | 4 | 1 | 0 | ||
| Om-Bo | September 2024 | Ixodes spp, from rodents, molted: | 69 | 41 (59.4) | 11 | 13 | 0 | 17 | 0 | 1 | 0 |
| I. persulcatus | 69 | 41 (59.4) | 11 | 13 | 0 | 17 | 0 | 1 | 0 | ||
| Om-Bo | June 2025 | Ixodes spp, from rodents, molted: | 102 | 58 (56.8) | 4 | 41 | 0 | 13 | 0 | 3 | 0 |
| I. apronophorus | 5 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | ||
| I. trianguliceps | 2 | 1 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | ||
| I. persulcatus | 95 | 57 (60.0) | 4 | 40 | 0 | 13 | 0 | 2 | 0 | ||
| Om-Bo | June 2016 | Ixodes spp. from rodents: | 44 | 5 (11.4) | 0 | 0 | 5 | 0 | 0 | 0 | 3 |
| I. apronophorus | 10 | 5 (50.0) | 0 | 0 | 5 | 0 | 0 | 0 | 3 | ||
| I. trianguliceps | 5 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | ||
| I. persulcatus | 29 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | ||
Abbr. Bbsl—B. burgdorferi s.l., B.a—B. afzelii, B.bav—B. bavariensis; Ca.B.sib—“Candidatus B. sibirica”; mixed—B. afzelii and B. bavariensis mixed infection.
Table 3.
Results of B. burgdorferi s.l. genotyping for the ospA gene.
| Isolate | Site | Source of Isolation | Results of Borrelia Genotyping by | Cluster by ospA Gene | GenBank Accession No. | |
|---|---|---|---|---|---|---|
| clpA | ospA | |||||
| Om16-76_Iapr | Om-Bo | I.apr, F; from A. agrarius | Ca.B.sib | Ca.B.sib | new | PX461036 |
| Om16-61_Iapr | Om-Bo | I.apr, N; from C. glareolus | Ca.B.sib | Ca.B.sib | new | PX461037 |
| Om16-101/2-Ipr * | Om-Bo | I.pers, N; from C. glareolus | Ca.B.sib | Ca.B.sib | new | PX461038 |
| Om16-103-Iapr * | Om-Bo | I.apr, F; from Ar. amphibious | Ca.B.sib | Ca.B.sib | new | PX461040 |
| Om16-75-Iapr * | Om-Bo | I.apr, N; from C. glareolus | Ca.B.sib | Ca.B.sib | new | |
| Om16-79/2-Iapr * | Om-Bo | I.apr; F; from M. oeconomus | Ca.B.sib | Ca.B.sib | new | |
| Om16-101/1-Ipr * | Om-Bo | I.pers, L; from C. glareolus | Ca.B.sib | Ca.B.sib | new | |
| Om16-132/2-Ipr * | Om-Bo | I.pers, L; from C. glareolus | Ca.B.sib | Ca.B.sib | new | |
| Om16-132/4-Ipr * | Om-Bo | I.pers, L; from C. glareolus | Ca.B.sib | Ca.B.sib | new | |
| Om16-132/5-Ipr * | Om-Bo | I.pers, L; from C. glareolus | Ca.B.sib | Ca.B.sib | new | |
| Om16-132/7-Ipr * | Om-Bo | I pers, L; from C. glareolus | Ca.B.sib | Ca.B.sib | new | |
| Om16-147_Iapr | Om-Bo | I.apr, F; from Ar. amphibious | Ca.B.sib | Ca.B.sib | new | |
| Om24-105_Sorex ** | Om-Zn | Sorex araneus, blood | Ca.B.sib | Ca.B.sib | new | PX461039 |
| Om25-93_Ipr | Om-Bo | I.pers, F; flag | B.bav | B.bav | IST9 | PX461045 |
| Om24-Zn1_Ipr | Om-Zn | I.pers, L molted into N; from C. rutilus | B.bav | B.bav | IST9 | PX461043 |
| Om24-Zn10_Iapr | Om-Zn | I.apr, L molted into N; from C. rutilus | B.bav | B.bav | IST9 | PX461044 |
| Om24-Zn37_Iapr | Om-Zn | I.apr, L molted into N; from C. rutilus | B.bav | B.bav | IST9 | PX513326 |
| Om24-Zn43_Itr | Om-Zn | I.tr, L molted into N; from C. rutilus | B.bav | mixed | n.d. | |
| Om25-23_Itr | Om-Bo | I.tr, L molted into N; from M. oeconomys | B.bav | B.bav | IST9 | PX461042 |
| Om25-50_Ipr | Om-Bo | I.pers, L molted into N; from A. agrarius | B.bav | B.bav | IST9 | PX461041 |
| Om25-64_Ipr | Om-Bo | I.pers, L molted into N; from C. rutilus | B.bav | mixed | n.d. | |
| Om25 34_Ipr | Om-Bo | I.pers, F; flag | B.bav | mixed | n.d. | |
| Om25 51_Ipr | Om-Bo | I.pers, M; flag | B.bav | B.bav | IST10 | PX513323 |
| Om25-10_Ipr | Om-Bo | I.pers, F; flag | B.bav | B.bav | IST10 | PX513321 |
| Om25-44_Ipr | Om-Bo | I.pers, F; flag | B.bav | B.bav | IST9 | PX513320 |
| Om25-73_Ipr | Om-Bo | I.pers, F; flag | B.bav | mixed | n.d. | |
| Om24-Zn_25_Itr | Om-Zn | I.tr, L molted into N; from C. rutilus | B.bav | B.bav | IST9 | PX513318 |
| Om24-45_Ipr | Om-Bo | I.pers, M; flag | B.bav | B.bav | IST10 | PX513319 |
| Om24-25_Ipr | Om-Bo | I.pers, L molted into N; from C. rutilus | B.bav | B.bav | IST10 | PX513322 |
| Om24-Zn23_Ipr | Om-Zn | I.pers, L molted into N; from C. rutilus | B. afzelii | B. afzelii | IST2 | PX461046 |
| Om24-Zn32_Ipr | Om-Zn | I.pers, L molted into N; from C. rutilus | B. afzelii | B. afzelii | IST2 | PX461047 |
| Om24-Zn45_Ipr | Om-Zn | I.pers, L molted into N; from C rutilus | B. afzelii | B. afzelii | IST2 | PX461048 |
| Om24-Zn88_Ipr | Om-Zn | I.pers, L molted into N; from C. rutilus | B. afzelii | B. afzelii | IST2 | PX461049 |
| Om25-82_Ipr | Om-Bo | I.pers, M; flag | B. afzelii | B. afzelii | IST2 | PX461050 |
| Om25-95_Ipr | Om-Bo | I.pers, F; flag | B. afzelii | B. afzelii | IST2 | PX513324 |
| Nov25-72_Ipav | Nov | I.pavl; F; flag | B. garinii | B. garinii | IST5 | PX513325 |
The names of isolates include the year of tick/animal collection–ID_source of isolation. Borrelia strains are in boldface. *—isolates were described in [12]; **—an isolate was described in [33]; Abbrs.: n.d.—not determined; L—larva; N—nymph; F—female; M—female; I.pers—I. persulcatus; I.tr—I. trianguliceps; I.apr—I. apronophorus; I.pavl—I. pavlovskyi; Ca.B.sib—“Candidatus B. sibirica”; B.bav—B. bavariensis; C. rutilus—Clethrionomys rutilus; C. glareolus—Clethrionomys rutilus; Ar. amphibious—Arvicola amphibious; A. agrarius—Apodemus agrarius; M. oeconomus—Microtus oeconomus.
Table 4.
Identity levels of “Candidatus B. sibirica” ospA gene nucleotide sequences with those of other B. burgdorferi s.l. species.
Table 4.
Identity levels of “Candidatus B. sibirica” ospA gene nucleotide sequences with those of other B. burgdorferi s.l. species.
| Species, Strain | Serotype/IST | % Identity |
|---|---|---|
| B. afzelii, VS461 (Z29087) | 2 | 85.4 |
| B. bavariensis, PBi (CP000015) | 4 | 88.7 |
| B. bavariensis BgVir (CP003202) | 9 | 87.9 |
| B. bavariensis FujiP2 (NZ_JACGTX010000003) | 10 | 84.8 |
| B. burgdorferi, B31 (AE000790) | 1 | 86.4 |
| B. garinii, 20047 (CP028862) | 3 | 84.0 |
| B. garinii, PBr (CP001308) | 3 | 84.0 |
| B. garinii, PMe (PubMLST 2738) | 5 | 87.2 |
| B. garinii, PHez (PubMLST 2736) | 6 | 86.5 |
| B. garinii, PBes (CP119347) | 7 | 83.0 |
| B. garinii, PKi (PubMLST 2737) | 8 | 85.8 |
| B. garinii, HT59 (PubMLST 2728) | 11 | 85.0 |
| B. garinii, J-21 (PubMLST 2729) | 12 | 86.8 |
| B. mayonii MN14-1420 (NZ_CP015795) | 14 | 87.6 |
| B. spielmanii A14S (CP001469) | 13 | 86.8 |
| B. turdi Ya501 (AB016975) | 16 | 85.9 |
| B. valaisiana, VS116 (CP001433) | 15 | 81.5 |
| B. yangtzensis Okinawa-CW62 (PubMLST 2758) | 17 | 87.1 |
The highest level of identity is marked in bold.
Table 5.
Summary statistics for intraspecific divergences caused by complete ospA gene for B. burgdorferi s.l. identified in Western Siberia.
Table 5.
Summary statistics for intraspecific divergences caused by complete ospA gene for B. burgdorferi s.l. identified in Western Siberia.
| “Candidatus B. sibirica” | B. afzelii, IST2 | B. bavariensis, IST9 | B. bavariensis, IST10 | All B. bavariensis | |
|---|---|---|---|---|---|
| No. of isolates | 13 | 24 | 13 | 10 | 23 |
| Size (bp) | 819 | 822 | 822 | 822 | 822 |
| No. of haplotypes | 2 | 7 | 7 | 4 | 11 |
| No. of polymorphic sites | 2 | 6 | 37 | 37 | 150 |
| Nucleotide diversity, π ± S.D. | 0.0004 ± 0.0003 | 0.0015 ± 0.0002 | 0.0150 ± 0.0015 | 0.0244 ± 0.0031 | 0.0785 ± 0.0056 |
| Haplotype diversity, Hd ± S.D. | 0.154 ± 0.126 | 0.7500 ± 0.073 | 0.872 ± 0.067 | 0.733 ± 0.120 | 0.913 ± 0.033 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
MDPI and ACS Style
Igolkina, Y.; Rar, V.; Yakimenko, V.; Bardasheva, A.; Fedorets, V.; Karimov, A.; Rubtsov, G.; Epikhina, T.; Tikunova, N. Genetic Diversity of Siberian Isolates of Borrelia burgdorferi Sensu Lato by the ospA Gene. Microorganisms 2025, 13, 2825. https://doi.org/10.3390/microorganisms13122825
AMA Style
Igolkina Y, Rar V, Yakimenko V, Bardasheva A, Fedorets V, Karimov A, Rubtsov G, Epikhina T, Tikunova N. Genetic Diversity of Siberian Isolates of Borrelia burgdorferi Sensu Lato by the ospA Gene. Microorganisms. 2025; 13(12):2825. https://doi.org/10.3390/microorganisms13122825
Chicago/Turabian StyleIgolkina, Yana, Vera Rar, Valeriy Yakimenko, Alevtina Bardasheva, Valeria Fedorets, Alfrid Karimov, Gavril Rubtsov, Tamara Epikhina, and Nina Tikunova. 2025. "Genetic Diversity of Siberian Isolates of Borrelia burgdorferi Sensu Lato by the ospA Gene" Microorganisms 13, no. 12: 2825. https://doi.org/10.3390/microorganisms13122825
APA StyleIgolkina, Y., Rar, V., Yakimenko, V., Bardasheva, A., Fedorets, V., Karimov, A., Rubtsov, G., Epikhina, T., & Tikunova, N. (2025). Genetic Diversity of Siberian Isolates of Borrelia burgdorferi Sensu Lato by the ospA Gene. Microorganisms, 13(12), 2825. https://doi.org/10.3390/microorganisms13122825
Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.
