Development and Comparison of Visual LAMP and LAMP-TaqMan Assays for Colletotrichum siamense
Abstract
1. Introduction
2. Materials and Methods
2.1. Strains
2.2. Visualization of LAMP and LAMP-TaqMan Primer Design
2.3. Visualizing LAMP and Conditional Optimization
2.4. LAMP-TaqMan System Assay and Condition Optimization
2.5. Specificity Detection and Sensitivity Analysis of LAMP and LAMP-TaqMan
2.6. Application of Testing to Real Samples
3. Results
3.1. Visualization of LAMP and LAMP-TaqMan Primer Design
3.2. Optimization and Validation of the Visual LAMP Assay and LAMP-TaqMan Assay
3.3. Specificity and Sensitivity of the Visual LAMP and LAMP-TaqMan Assays
3.4. Application of Testing to Real Samples
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Liu, Z.; Liang, T.; Kang, C. Molecular Bases of Strawberry Fruit Quality Traits: Advances, Challenges, and Opportunities. Plant Physiol. 2023, 193, 900–914. [Google Scholar] [CrossRef] [PubMed]
- Jeffries, P.; Dodd, J.C.; Jeger, M.J.; Plumbley, R.A. The Biology and Control of Colletotrichum Species on Tropical Fruit Crops. Plant Physiol. 1990, 39, 343–366. [Google Scholar] [CrossRef]
- Talhinhas, P.; Baroncelli, R. Colletotrichum Species and Complexes: Geographic Distribution, Host Range and Conservation Status. Fungal Divers. 2021, 110, 109–198. [Google Scholar]
- Auyong, A.S.M.; Ford, R.; Taylor, P.W.J. Genetic Transformation of Colletotrichum truncatum Associated with Anthracnose Disease of Chili by Random Insertional Mutagenesis. J. Basic Microbiol. 2012, 52, 372–382. [Google Scholar] [CrossRef] [PubMed]
- Dean, R.; Van Kan, J.A.L.; Pretorius, Z.A.; Hammond-Kosack, K.E.; Di Pietro, A.; Spanu, P.D.; Rudd, J.J.; Dickman, M.; Kahmann, R.; Ellis, J.; et al. The Top 10 Fungal Pathogens in Molecular Plant Pathology. Mol. Plant Pathol. 2012, 13, 414–430. [Google Scholar] [CrossRef] [PubMed]
- Denoyes-Rothan, B.; Guérin, G.; Délye, C.; Smith, B.; Minz, D.; Maymon, M.; Freeman, S. Genetic Diversity and Pathogenic Variability Among Isolates of Colletotrichum Species from Strawberry. Phytopathology 2003, 93, 219–228. [Google Scholar] [CrossRef]
- Dowling, M.; Peres, N.; Villani, S.; Schnabel, G. Managing Colletotrichum on Fruit Crops: A “Complex” Challenge. Plant Dis. 2020, 104, 2301–2316. [Google Scholar] [CrossRef] [PubMed]
- Ji, Y.; Li, X.; Gao, Q.-H.; Geng, C.; Duan, K. Colletotrichum Species Pathogenic to Strawberry: Discovery History, Global Diversity, Prevalence in China, and the Host Range of Top Two Species. Phytopathol. Res. 2022, 4, 42. [Google Scholar] [CrossRef]
- Zhang, L.; Song, L.; Xu, X.; Zou, X.; Duan, K.; Gao, Q. Characterization and Fungicide Sensitivity of Colletotrichum Species Causing Strawberry Anthracnose in Eastern China. Plant Dis. 2020, 104, 1960–1968. [Google Scholar] [CrossRef]
- Mills, P.R.; Sreenivasaprasad, S.; Brown, A.E. Detection and Differentiation of Colletotrichum gloeosporioides Isolates Using PCR. FEMS Microbiol. Lett. 1992, 98, 137–143. [Google Scholar] [CrossRef]
- Hu, S.; Zhang, S.; Xiao, W.; Liu, Y.; Yu, H.; Zhang, C. Diversity and Characterization of Resistance to Pyraclostrobin in Colletotrichum Spp. from Strawberry. Agronomy 2023, 13, 2824. [Google Scholar] [CrossRef]
- Fang, H.; Liu, X.; Dong, Y.; Feng, S.; Zhou, R.; Wang, C.; Ma, X.; Liu, J.; Yang, K.Q. Transcriptome and Proteome Analysis of Walnut (Juglans regia L.) Fruit in Response to Infection by Colletotrichum gloeosporioides. BMC Plant Biol. 2021, 21, 249. [Google Scholar] [CrossRef] [PubMed]
- Le, D.T.; Vu, N.T. Progress of Loop-Mediated Isothermal Amplification Technique in Molecular Diagnosis of Plant Diseases. Appl. Biol. Chem. 2017, 60, 169–180. [Google Scholar] [CrossRef]
- Notomi, T. Loop-Mediated Isothermal Amplification of DNA. Nucleic Acids Res. 2000, 28, e63. [Google Scholar] [CrossRef] [PubMed]
- Nagamine, K.; Hase, T.; Notomi, T. Accelerated Reaction by Loop-Mediated Isothermal Amplification Using Loop Primers. Mol. Cell. Probes 2002, 16, 223–229. [Google Scholar] [CrossRef] [PubMed]
- Tomita, N.; Mori, Y.; Kanda, H.; Notomi, T. Loop-Mediated Isothermal Amplification (LAMP) of Gene Sequences and Simple Visual Detection of Products. Nat. Protoc. 2008, 3, 877–882. [Google Scholar] [CrossRef] [PubMed]
- Goto, M.; Honda, E.; Ogura, A.; Nomoto, A.; Hanaki, K.-I. Colorimetric Detection of Loop-Mediated Isothermal Amplification Reaction by Using Hydroxy Naphthol Blue. BioTechniques 2009, 46, 167–172. [Google Scholar] [CrossRef]
- Tanner, N.A.; Zhang, Y.; Evans, T.C., Jr. Visual Detection of Isothermal Nucleic Acid Amplification Using pH-Sensitive Dyes. BioTechniques 2015, 58, 59–68. [Google Scholar] [CrossRef]
- Lee, S.H.; Baek, Y.H.; Kim, Y.-H.; Choi, Y.-K.; Song, M.-S.; Ahn, J.-Y. One-Pot Reverse Transcriptional Loop-Mediated Isothermal Amplification (RT-LAMP) for Detecting MERS-CoV. Front. Microbiol. 2017, 7, 2166. [Google Scholar] [CrossRef]
- Kim, S.-H.; Lee, S.-Y.; Kim, U.; Oh, S.-W. Diverse Methods of Reducing and Confirming False-Positive Results of Loop-Mediated Isothermal Amplification Assays: A Review. Anal. Chim. Acta 2023, 1280, 341693. [Google Scholar] [CrossRef]
- Liu, W.; Huang, S.; Liu, N.; Dong, D.; Yang, Z.; Tang, Y.; Ma, W.; He, X.; Ao, D.; Xu, Y.; et al. Establishment of an Accurate and Fast Detection Method Using Molecular Beacons in Loop-Mediated Isothermal Amplification Assay. Sci. Rep. 2017, 7, 40125. [Google Scholar] [CrossRef]
- Holland, P.M.; Abramson, R.D.; Watson, R.; Gelfand, D.H. Detection of Specific Polymerase Chain Reaction Product by Utilizing the 5′----3′ Exonuclease Activity of Thermus Aquaticus DNA Polymerase. Proc. Natl. Acad. Sci. USA 1991, 88, 7276–7280. [Google Scholar] [CrossRef]
- Yu, Y.; Li, R.; Ma, Z.; Han, M.; Zhang, S.; Zhang, M.; Qiu, Y. Development and Evaluation of a Novel Loop Mediated Isothermal Amplification Coupled with TaqMan Probe Assay for Detection of Genetically Modified Organism with NOS Terminator. Food Chem. 2021, 356, 129684. [Google Scholar] [CrossRef]
- Liu, Y.; Zhang, Y.; Wang, M.; Shi, G.; Dong, Z.; Ye, L.; Shi, L. Modified Loop-Mediated Isothermal Amplification Method Combined with a TaqMan Probe for the Detection of Mycoplasma gallisepticum. Eur. Food Res. Technol. 2023, 249, 1469–1477. [Google Scholar] [CrossRef]
- Toumazou, C.; Shepherd, L.M.; Reed, S.C.; Chen, G.I.; Patel, A.; Garner, D.M.; Wang, C.-J.A.; Ou, C.-P.; Amin-Desai, K.; Athanasiou, P.; et al. Simultaneous DNA Amplification and Detection Using a pH-Sensing Semiconductor System. Nat. Methods 2013, 10, 641–646. [Google Scholar] [CrossRef]
- He, J.; Sun, M.-L.; Li, D.-W.; Zhu, L.-H.; Ye, J.-R.; Huang, L. A Real-Time PCR for Detection of Pathogens of Anthracnose on Chinese Fir Using TaqMan Probe Targeting ApMat Gene. Pest Manag. Sci. 2023, 79, 980–988. [Google Scholar] [CrossRef]
- Wang, S.; Ye, W.; Tian, Q.; Dong, S.; Zheng, X. Rapid Detection of Colletotrichum gloeosporioides Using a Loop-Mediated Isothermal Amplification Assay. Australas. Plant Pathol. 2017, 46, 493–498. [Google Scholar] [CrossRef]
- Tian, Q.; Lu, C.; Wang, S.; Xiong, Q.; Zhang, H.; Wang, Y.; Zheng, X. Rapid Diagnosis of Soybean Anthracnose Caused by Colletotrichum truncatum Using a Loop-Mediated Isothermal Amplification (LAMP) Assay. Eur. J. Plant Pathol. 2017, 148, 785–793. [Google Scholar] [CrossRef]
- Liu, Y.; Ji, Y.; Han, Y.; Song, L.; Zhang, L.; Ning, Z.; Yan, W.; Gao, Q.; Duan, K. Loop-Mediated Isothermal Amplification and PCR Combined Assay to Detect and Distinguish Latent Colletotrichum Spp. Infection on Strawberry. J. Plant Pathol. 2021, 103, 887–899. [Google Scholar] [CrossRef]
- Yuan, H.; Hou, H.; Zhou, Z.; Tu, H.; Wang, L. Rapid Detection of the E198A Mutation of Carbendazim-Resistant Isolates in Colletotrichum gloeosporioides by Loop-Mediated Isothermal Amplification. Hortic. Plant J. 2022, 8, 289–296. [Google Scholar] [CrossRef]
Number | Fungal Species | Isolate |
---|---|---|
1 | Colletotrichum siamense | CM9 |
2 | Colletotrichum gloeosporioides | GJ4 |
3 | Colletotrichum fragariae | CM10 |
4 | Mucor irregularis | G121 |
5 | Mucor circinelloides | G122 |
6 | Fusarium solani | T1X2 |
7 | Fusarium oxysporum | T1X3 |
8 | Acremonium egyptiacum | T6T3 |
9 | Botrytis cinerea | G61 |
10 | Didymella bellidis | T1X32 |
11 | Dactylonectria macrodidyma | T1X4 |
12 | Paraconiothyrium brasiliense | T6T2 |
13 | Trichoderma atroviride | HB20111 |
14 | Botryosphaeria dothidea | Bd5 |
15 | Alternaria alternata | d1 |
16 | Rizoctonia solani | Rs21 |
17 | Fusarium pseudograminearum | Fp30 |
18 | Fusarium equiseti | Fe9 |
Primer Name | Sequence 5′-3′ | Length (bp) |
---|---|---|
CS-F3 | CTGGTACGTGACGAGACC | 18 |
CS-B3 | GTACTTGTTGCCGGAAGC | 18 |
CS-FIP | CACTCCATTGCTGTCGAGGCGAGGACGGCAGATGTTGA | 38 |
CS-BIP | CCTCTGAGCTCCAGCTCGAGCTCTGGGGGGCTATAAGGTAA | 41 |
CS-LF | GCTCGCCAGAAATGTTTTGCCTA | 23 |
CS-LB | CGCATGAGCGTCTACTTCAACG | 22 |
CS-probe | GTTGACCGCTAAACTCGAACAGC | 23 |
CS-TaqF | AAACATTTCTGGCGAGCACG | 20 |
Sample Name | Sample Size | LAMP | LAMP-TaqMan | ||
---|---|---|---|---|---|
Positive Sample | Negative Sample | Positive Sample | Negative Sample | ||
Soil samples | 38 | 3 | 35 | 4 | 34 |
Strawberry Sample | 20 | 3 | 17 | 3 | 17 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cui, S.; Ma, H.; Wang, X.; Yang, H.; Wu, Y.; Wei, Y.; Li, J.; Hu, J. Development and Comparison of Visual LAMP and LAMP-TaqMan Assays for Colletotrichum siamense. Microorganisms 2024, 12, 1325. https://doi.org/10.3390/microorganisms12071325
Cui S, Ma H, Wang X, Yang H, Wu Y, Wei Y, Li J, Hu J. Development and Comparison of Visual LAMP and LAMP-TaqMan Assays for Colletotrichum siamense. Microorganisms. 2024; 12(7):1325. https://doi.org/10.3390/microorganisms12071325
Chicago/Turabian StyleCui, Shuning, Haoze Ma, Xinyue Wang, Han Yang, Yuanzheng Wu, Yanli Wei, Jishun Li, and Jindong Hu. 2024. "Development and Comparison of Visual LAMP and LAMP-TaqMan Assays for Colletotrichum siamense" Microorganisms 12, no. 7: 1325. https://doi.org/10.3390/microorganisms12071325
APA StyleCui, S., Ma, H., Wang, X., Yang, H., Wu, Y., Wei, Y., Li, J., & Hu, J. (2024). Development and Comparison of Visual LAMP and LAMP-TaqMan Assays for Colletotrichum siamense. Microorganisms, 12(7), 1325. https://doi.org/10.3390/microorganisms12071325