Next Article in Journal
Comparative Genomics and Biosynthetic Cluster Analysis of Antifungal Secondary Metabolites of Three Strains of Streptomyces albidoflavus Isolated from Rhizospheric Soils
Next Article in Special Issue
The Characterization of Lactic Acid Bacteria Strains as Components of a Biopreparation for Chickens for Slaughter
Previous Article in Journal
Lessons Learned from COVID-19 Pandemic in Combating Antimicrobial Resistance—Experience of Hong Kong, China
Previous Article in Special Issue
The Application of Probiotic Bacteria from Strawberry (Fragaria ananassa × Duch.) in the Fermentation of Strawberry Tree Fruit (Arbutus unedo L.) Extract
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Microorganisms
Volume 12
Issue 12
10.3390/microorganisms12122636
microorganisms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Communication

Antibiotic Susceptibility and Technological Properties of Leuconostoc citreum for Selecting Starter Candidates

by
Sumin Lee
1,†,
Sojeong Heo
1,†,
Gawon Lee
1,
Yura Moon
1,
Minkyeong Kim
1,
Mi-Sun Kwak
2 and
Do-Won Jeong
1,*
1
Department of Food and Nutrition, Dongduk Women’s University, Seoul 02748, Republic of Korea
2
Kookmin Bio Corporation, Seoul 02826, Republic of Korea
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Microorganisms 2024, 12(12), 2636; https://doi.org/10.3390/microorganisms12122636
Submission received: 20 November 2024 / Revised: 9 December 2024 / Accepted: 16 December 2024 / Published: 19 December 2024
(This article belongs to the Special Issue Microorganisms in Functional Foods)
Browse Figures
Versions Notes

Abstract

:
Antibiotic susceptibilities, hemolytic activities, and technological properties of 46 Leuconostoc citreum isolates from kimchi were evaluated to select starter candidates. All strains were susceptible to clindamycin and erythromycin, while some exhibited resistance to ampicillin, chloramphenicol, gentamicin, streptomycin, and tetracycline; all were resistant to kanamycin based on the EFSA breakpoint values for Leuconostoc species. PCR analysis did not detect resistance genes for these six antibiotics in any strain. None of the strains demonstrated clear α- or β-hemolytic activity. All strains thrived in a medium supplemented with 6% NaCl, displaying protease activity and acid in media containing 6% and 3% NaCl, respectively. Consequently, five strains, AK5T17, AK5T19, AK10M04, DMLC16, and YK10T20, were identified as starter candidates, with L. citreum strain DMLC16 emerging as the top choice due to its elevated protease and acid production capacities. These findings support the safe application of L. citreum strain DMLC16 as a starter candidate in fermented food production.

1. Introduction

The genus Leuconostoc, belonging to the order Lactobacillales, exhibits high morphological and physiological homogeneity [1]. Meanwhile, Leuconostoc citreum displays the significant characteristic of not metabolizing lactose [2] and demonstrates negative activities for α- and β-galactosidase and β-xylosidase. In contrast, L. mesenteroides, a representative species of the genus Leuconostoc, exhibits this activity [3]. L. citreum was originally isolated as a L. mesenteroides subsp. amelibiosum. Subsequently, DNA–DNA hybridization studies led to its reclassification as the new species, L. amelibiosum, from the L. mesenteroides subspecies [4]. It was later confirmed as another name for L. citreum, and ultimately classified under L. citreum [5]. Consequently, although L. citreum has been reclassified from L. mesenteroides, differences in enzyme activity suggest that L. citreum, when used as a starter culture, could produce fermentation products with characteristics distinct from those of L. mesenteroides.
The Leuconostoc genus is widely distributed in nature, including in fermented foods. Furthermore, L. citreum has been detected in various habitats, including fermented foods such as artisanal cheese [6], sourdough bread [7], and kimchi [8,9]. In industrial fermentation, L. citreum is used as a starter culture in the production of dairy products and fermented vegetables, primarily to enhance preservation through bacteriocin or acid production rather than through lactose fermentation [10,11,12]. L. citreum is a heterofermentative lactic acid bacterium that plays a crucial role in various food fermentations, enhancing flavor and texture [7,10,11,12].
Kimchi is a general term for a fermented vegetable dish that is widely consumed in Korea [13]. Among the various types of kimchi, Baechu-kimchi made from kimchi cabbage (Brassica rapa) is the most popular [14]. Kimchi is a fermented food produced through lactic acid fermentation, with microorganisms involved in this process primarily belonging to the genera Leuconostoc, Lactobacillus, and Weissella [15,16]. Among these, microorganisms of the genus Leuconostoc, particularly L. mesenteroides, are dominant during the early stages of fermentation. In the mid-fermentation stage, species from the genera Lactobacillus and Weissella dominate, while in the later stages of fermentation, acid-tolerant microorganisms such as the Pediococcus genus or yeasts become predominant [17].
In vegetable fermentation such as kimchi, heterofermentative lactic acid bacteria produce one molecule of lactic acid, one molecule of CO2, and one molecule of alcohol from one molecule of glucose. This process enhances the fresh and refreshing taste during the initial stages of fermentation. Due to this role, extensive efforts are made to promote heterofermentative bacteria in fermented vegetables like kimchi. One such strategy is employing starter cultures for fermentation [18]. The genus Leuconostoc, particularly L. mesenteroides, is frequently used as a starter culture in kimchi production. Commercial kimchi often utilizes this species. There have been recent attempts to incorporate other starter cultures alongside L. mesenteroides, such as L. citreum. In bread fermentation, L. citreum contributes to enhanced quality, nutritional profile, and sensory properties [7]. The use of L. citreum IH22 as a starter culture in kimchi was shown to delay the growth of homolactic-fermentative LAB, thereby lengthening shelf life [11]. A combination of Lactococcus lactis WiKim0098 and L. citreum WiKim0096 as a mixed starter culture has been shown to improve the shelf life and quality of kimchi [12]. Therefore, L. citreum displays strong potential as a fermentation starter culture.
It is advantageous for starter cultures in fermented foods to include a diverse range of candidates tailored to their specific purposes. For kimchi fermentation, efforts are being made to isolate and select starter cultures that can extend the optimal fermentation period, improve storage stability, and enhance health functionality, continuously [19,20]. In our previous study, 1219 LAB strains were isolated and identified from various kimchi types with added seafood to identify suitable starter cultures for kimchi fermentation [14,21]. The genus Leuconostoc was prevalent, with L. citreum (49 strains, 4.0%) being the second most frequently detected species after L. mesenteroides (482 strains, 39.5%). In this study, among previously isolated dominant species, L. citreum has been targeted for antibiotic resistance evaluation and enzyme activity assessment to isolate safe starter cultures with superior fermentation characteristics.

2. Materials and Methods

2.1. Bacterial Strains and Culture Conditions

A total of 46 L. citreum strains were utilized in this research after being definitively identified as L. citreum through reconfirmation of the entire 16S rRNA gene sequence from 49 L. citreum isolates (Table S1). These strains were obtained from commercial and traditional kimchi in previous studies analyzing the microbial community [14,21]. Additionally, the type strain L. citreum KACC 11860 was employed as a control. Leuconostoc species were cultured in de Man–Rogosa–Sharpe (MRS) broth (Becton, Dickinson and Co., Franklin Lakes, NJ, USA) at 30 °C for 24 h.

2.2. Antibiotic Susceptibility

Antibiotic susceptibility was assessed using the broth microdilution method [22] with eight antibiotics (Sigma-Aldrich, St. Louis, MO, USA): ampicillin, chloramphenicol, clindamycin, erythromycin, gentamicin, kanamycin, streptomycin, and tetracycline. Antibiotics were prepared in serial twofold working dilutions using deionized water, and antibiotic concentrations in each well of the 96-microwell plate ranged from 0.5 to 1024 mg/L. Bacterial strains were cultured twice in MRS broth and adjusted to a 0.5 McFarland turbidity standard (bioMérieux, Marcy L’Étoile, France). Subsequently, each suspension was diluted 1:100 in cation-adjusted Brain Heart Infusion (BHI) broth (Becton, Dickinson and Co.) to reach the appropriate inoculum concentration. The final inoculum density was 5 × 105 colony-forming units/mL, and 200 µL were added to each well of the 96-microwell plate. The MICs of the antibiotics were identified as the lowest concentration preventing visible growth in the wells after incubation at 35 °C for 16 h. MIC results were verified by at least three independent tests. All experiments were performed at least three times on different days. Strains with MICs exceeding the breakpoint are considered resistant [23].

2.3. Identification of Antibiotic Resistance Gene

Genomic DNA from L. citreum strains was extracted using the DNeasy Tissue Kit (Qiagen, Hilden, Germany). Amplification of acquired antibiotic resistance genes was carried out using specific primer sets as listed in Table 1 with the T-3000 Thermocycler (Biometra, Göttingen, Germany). The PCR mixture comprised template DNA, 0.5 μM of each primer, 1.25 units of Inclone™ Taq polymerase (Inclone Biotech, Daejeon, Republic of Korea), 100 mM dNTPs, and 2.5 mM MgCl2. Samples were first preheated at 95 °C for 5 min and then subjected to 30 cycles of 1 min at 95 °C, 30 s at 57 °C, and 1 min at 72 °C. The PCR products were verified via migration on a 1.5% agarose gel stained with ethidium bromide. Additionally, for 4 out of the 9 genes, plasmids containing the genes were used as positive controls: pCL55 for blaZ gene, and cat gene [24]; pSSTET1 for tetK gene [25]; and pIMAY for tetM gene [26].

2.4. Hemolysis

The α- and β-hemolytic activities were assessed using Tryptic Soy Agar (TSA; Becton, Dickinson and Co.) supplemented with 5% (v/v) rabbit blood (MB Cell, Seoul, Republic of Korea) and 5% (v/v) sheep blood, respectively. α-Hemolytic activity was assessed after incubation at 30 °C for 24 h, while β-hemolytic activity was evaluated following a 24 h incubation at 30 °C with a subsequent cold shock at 4 °C. Hemolysis was identified by observing a clear lytic zone surrounding the colonies on each blood-containing TSA plate. Clinical strains Staphylococcus aureus USA300-p23 and RN4220 served as positive and negative controls, respectively. This experiment was repeated three times.

2.5. Determination of Salt Tolerance, Enzyme Activities, and Acid Production

Salt tolerance in L. citreum strains was evaluated by observing their growth on MRS media supplemented with 0–9% NaCl (w/v) as the final concentration. Growth was monitored over periods of 2, 4, 6, and 8 days.
Enzymatic activity for proteases and lipases was determined on TSA containing 0.5% (w/v) glucose and 2% (w/v) skim milk, and on tributyrin-agar containing 1% (v/v) tributyrin, respectively. The ability to produce acid was analyzed on TSA containing 0.5% (w/v) glucose and 0.7% (w/v) CaCO3. L. citreum cultures incubated at 30 °C for 24 h in MRS broth were applied to MRS agar to assess enzyme activity and acid productivity. The presence of enzyme activities and acid production were indicated by a clear halo around the disk containing the cultures. Additionally, the activity experiments were conducted independently with three repetitions, and the same results were obtained.

2.6. Strain Deposit

Strain L. citreum DMLC16 was deposited at the Korean Culture Center of Microorganisms under the accession number KFCC12011P.

3. Results

3.1. Antibiotic Resistance Profiles in Leuconostoc citreum Strains Were Analyzed

To select antibiotic-sensitive strains, in accordance with the EFSA guidelines [23], resistance against eight antibiotics—ampicillin, chloramphenicol, clindamycin, erythromycin, gentamicin, kanamycin, streptomycin, and tetracycline—was determined for 46 L. citreum strains in this study. The antibiotic resistances, based on minimal inhibitory concentrations (MICs), were summarized (Figure 1). All 46 L. citreum strains were sensitive to clindamycin and erythromycin, while 30, 34, 7, 4, and 5 strains exhibited growth at concentrations exceeding the EFSA’s breakpoint values for ampicillin, chloramphenicol, gentamicin, streptomycin, and tetracycline, respectively (Figure 1). Notably, over half of the strains were resistant to ampicillin and chloramphenicol. Furthermore, all strains showed resistance to kanamycin, indicating that they all exceeded the EFSA breakpoint values for Leuconostoc species [23]. Consequently, five strains—AK5T17, AK5T19, AK10M04, DMLC16, and YK10T20—were identified that exhibited sensitivity to seven antibiotics, excluding kanamycin.

3.2. Absence of Acquired Antibiotic Resistance Genes in Leuconostoc citreum Strains

In the antibiotic susceptibility test, strain-specific resistance was observed for six out of the eight tested antibiotics (Figure 1). To determine whether these strains harbor acquired antibiotic resistance genes contributing to resistance against these six antibiotics, amplification was performed using primer sets designed to detect known acquired antibiotic resistance genes [27,28,29,30,31,32]. Nine genes associated with resistance to six antibiotics, known to be located on mobile elements such as plasmids and capable of being transferred to other strains, were targeted (Table 1). The presence of antibiotic resistance genes in 46 strains was examined using PCR amplification; however, none of the target genes were detected in any of the strains, including the five antibiotic-sensitive strains (Figure S1). These findings suggest that the 46 strains did not harbor the nine acquired antibiotic resistance genes that confer resistance to the six antibiotics.

3.3. Hemolysis of Leuconostoc citreum Strains

The EFSA QPS guidelines for microorganisms used in food and feed, confirm that the absence of acquired antibiotic resistance is sufficient for L. citreum. However, typically, industrial practices also assess hemolytic activity in strains intended for food use. Therefore, we evaluated both α-hemolysis and β-hemolysis [33]. None of the strains, including the five antibiotic-sensitive strains, demonstrated hemolysis, unlike the positive control, S. aureus USA300-p23 (Figure 2).

3.4. Technological Property of Leuconostoc citreum Strains; Salt Tolerance, Protease, Lipase, and Amylase Activities, and Acid Production

According to the European Food & Feed Cultures Association, starter cultures are safe live bacteria, yeasts, or molds used in food production that contribute to storage and food quality, including sensory properties in the food [34]. Hence, it is essential that starter candidates not only be safe but also possess specific technological properties. To enhance the sensory attributes of fermented food, they must withstand the food environment and generate exoenzymes like amylase, proteases, and lipases. We assessed the salt tolerance, amylase activity, protease activity, lipase activity, and acid production capabilities of our L. citreum strains.
Salt tolerance is critical for applications in high-salt fermented foods such as doenjang (fermented soybean pastes) and jeotgal (fermented seafood). All the L. citreum strains grew well on MRS, with a 6% final concentration of NaCl (w/w) (Table 2), but failed to grow on media with 9% NaCl.
Amylase, protease, and lipase activities contribute to the sensory properties of fermented foods by producing taste and aroma compounds from starch, protein, and lipid constituents of food [35,36,37,38]. None of the strains exhibited amylase or lipase activity (Table 2). The protease activity of L. citreum was strain-specific, and fewer strains displayed protease activity as the NaCl concentration increased (Table 2). At 3% salt concentration, all but one strain showed protease activity; at 6% salt concentration, 31 strains (W, 16 strains; +, 13 strains; ++, 1 strain; +++, 1 strain) exhibited protease activity.
Acid production in fermented foods enhances both flavor and preservation. Similar to protease activity, acid production displayed strain-specific variations. When no additional salt was added, all strains showed some level of acid production. However, at a final concentration of 3% salt, 35 strains (W, 3 strains; +, 14 strains; ++, 18 strains) demonstrated acid production (Table 2).

4. Discussion

This study aimed to select starter culture candidate strains from L. citreum isolated from kimchi, focusing on strains that are antibiotic-sensitive, non-hemolytic, and exhibit desirable traits such as enzymatic activity and salt tolerance.
Food microorganisms used as starters, ingredients, and functional foods must not exhibit antibiotic resistance, particularly acquired antibiotic resistance [23,39]. The kimchi-derived L. citreum employed in this experiment is intended for use as a starter in fermented foods, requiring these strains to be antibiotic-sensitive. Consequently, we investigated the antibiotic resistance of L. citreum strains against eight antibiotics recommended by EFSA for Leuconostoc spp. [23], due to the absence of specific guidelines, such as those from the Clinical and Laboratory Standards Institute, the European Committee on Antimicrobial Susceptibility Testing, and the United States Committee on Antimicrobial Susceptibility Testing, for assessing antibiotic resistance in L. citreum [23]. Although five strains did not exhibit resistance to seven antibiotics, all L. citreum strains showed resistance to kanamycin, indicating that they all exceeded the EFSA breakpoint values for Leuconostoc species [23]. Findings similar to those concerning kanamycin resistance of L. citreum have been reported by Iosca et al. [40] and Flórez et al. [41], where all examined strains from both studies showed values surpassing EFSA’s kanamycin breakpoints for Leuconostoc spp. Both our current findings and prior research indicate that the EFSA kanamycin breakpoint for Leuconostoc spp. may vary for L. citreum. Consequently, it is essential to compile antibiotic resistance data specifically for L. citreum to determine more precise breakpoint values for this species.
Through MIC experiments, it was demonstrated that even if values exceed the cut-off, the strain can be used as a starter culture if the resistance is intrinsic [23,39]. Similarly, resistance due to genomic mutations is generally considered acceptable. However, if resistance is caused by the introduction of genes, it is classified as acquired and cannot be used. Gene introduction typically occurs through horizontal transfer involving mobile genetic elements like plasmids, making it a strain-specific characteristic [42,43,44]. In this study, certain strains exhibited values higher than the cut-off for six of the eight tested antibiotics. To investigate whether this resistance was due to the presence of acquired resistance genes, nine genes known to confer resistance to these six antibiotics were targeted and checked via PCR (Table 1). None of the strains were found to harbor these nine genes. However, it is important to note that the genes responsible for resistance are not limited to the nine tested. Further research is needed to identify resistance-contributing genes in L. citreum for these six antibiotics. In particular, identifying resistance genes for kanamycin is essential to determine whether the strains can be applied in the food industry.
Based on the results of the antibiotic sensitivity assessment and hemolysis, five strains assumed safe were selected (Table 3). However, since all selected strains exhibited resistance to kanamycin, it will be necessary to elucidate the mechanism of kanamycin resistance in future studies. All five strains grew on TSA medium containing 6% NaCl (w/v) and displayed protease activity and acid production in media containing 6% and 3% NaCl (w/v), respectively. Among these, DMLC16 was identified as the best candidate due to its lower MIC values for the seven antibiotics tested and its efficient technological properties (Figure 3 and Table 3).

5. Conclusions

The selected strain DMLC16, isolated from kimchi, has been confirmed to be safe, and its enzymatic activity is expected to be useful as a starter culture in fermented foods. In particular, the protease is expected to contribute to the sensory characteristics of protein-rich foods when used as a starter culture by producing amino acids through protein degradation. Therefore, further studies are recommended to evaluate the effects of DMLC16 in fermented foods as a starter culture. Additionally, if the health benefits of this strain are demonstrated, it may also have potential as a probiotic. Verifying these experimental results through genomic analysis would provide meaningful support for the findings. Furthermore, since there are no established resistance criteria for L. citreum, further research is needed to develop accurate standards for antibiotic resistance in this species.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/microorganisms12122636/s1, Table S1: List of 46 Strains of Leuconostoc citreum Isolated from Various Regions and Types of Kimchi; Figure S1: Identification of antibiotic resistance gene using PCR amplification.

Author Contributions

Conceptualization, D.-W.J.; methodology, S.L., S.H., G.L., Y.M., M.K. and D.-W.J.; validation, S.L., S.H., M.-S.K. and D.-W.J.; formal analysis, S.L. and S.H.; investigation, G.L., Y.M. and M.K.; writing—original draft preparation, S.L., S.H. and D.-W.J.; writing—review and editing, S.L., S.H., M.-S.K. and D.-W.J.; visualization, S.L. and S.H.; supervision, D.-W.J.; project administration, D.-W.J.; funding acquisition, D.-W.J. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Korea Institute of Planning and Evaluation for Technology in Food, Agriculture, and Forestry (IPET) through the High Value-added Food Technology Development Program, funded by the Ministry of Agriculture, Food and Rural Affairs (MAFRA) [RS-2022-IP322014], and the National Research Foundation of Korea (NRF) [NRF-RS-2024-00334769].

Data Availability Statement

The original contributions presented in this study are included in the article/Supplementary Materials. Further inquiries can be directed to the corresponding author.

Conflicts of Interest

Author Mi-Sun Kwak is employed by the company KookminBio Cooperation. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

References

  1. Björkroth, J.; Holzapfel, W. Genera Leuconostoc, Oenococcus and Weissella. Prokaryotes 2006, 4, 267–319. [Google Scholar] [CrossRef]
  2. Lee, S.H.; Chang, H.C. Isolation of antifungal activity of Leuconostoc mesenteroides TA from kimchi and characterization of its antifungal compounds. Food Sci. Biotechnol. 2016, 25, 213–219. [Google Scholar] [CrossRef] [PubMed]
  3. Farrow, J.M.; Facklam, R.R.; Collins, M.D. Nucleic Acid Homologies of Some Vancomycin-Resistant Leuconostocs and Description of Leuconostoc citreum sp. nov. and Leuconostoc pseudomesenteroides sp. nov. Int. J. Syst. Bacteriol. 1989, 39, 279–283. [Google Scholar] [CrossRef]
  4. Schillinger, U.; Holzapfel, W.; Kandler, O. Nucleic Acid Hybridization Studies on Leuconostoc and Heterofermentative Lactobacilli and Description of Leuconostoc amelihiosum sp. nov. Syst. Appl. Microbiol. 1989, 12, 48–55. [Google Scholar] [CrossRef]
  5. Takahashi, M.; Okada, S.; Uchimura, T.; Kozaki, M. Leuconostoc amelibiosum Schillinger, Holzapfel, and Kandler 1989 Is a Later Subjective Synonym of Leuconostoc citreum Farrow, Facklam, and Collins 1989. Int. J. Syst. Bacteriol. 1992, 42, 649–651. [Google Scholar] [CrossRef]
  6. Domingos-Lopes, M.; Lamosa, P.; Stanton, C.; Ross, R.; Silva, C. Isolation and characterization of an exopolysaccharide-producing Leuconostoc citreum strain from artisanal cheese. Lett. Appl. Microbiol. 2018, 67, 570–578. [Google Scholar] [CrossRef]
  7. Roșca, M.F.; Păucean, A.; Man, S.M.; Chiș, M.S.; Pop, C.R.; Pop, A.; Fărcaș, A.C. Leuconostoc citreum: A Promising Sourdough Fermenting Starter for Low-Sugar-Content Baked Goods. Foods 2024, 13, 96. [Google Scholar] [CrossRef]
  8. Kwon, M.; Shin, M.; Lim, S.K.; Lee, J.; Park, H.K.; Kim, N.; Yun, M.; Jo, H.E.; Oh, Y.J.; Choi, H. Leuconostoc citreum isolated from kimchi suppresses the development of collagen-induced arthritis in DBA/1 mice. J. Funct. Foods 2019, 63, 103579. [Google Scholar] [CrossRef]
  9. Choi, H.; Kim, Y.W.; Hwang, I.; Kim, J.; Yoon, S. Evaluation of Leuconostoc citreum HO12 and Weissella koreensis HO20 isolated from kimchi as a starter culture for whole wheat sourdough. Food Chem. 2012, 134, 2208–2216. [Google Scholar] [CrossRef]
  10. Chang, J.Y.; Chang, H.C. Improvements in the Quality and Shelf Life of Kimchi by Fermentation with the Induced Bacteriocin-Producing Strain, Leuconostoc citreum GJ7 as a Starter. J. Food Sci. 2010, 75, M103–M110. [Google Scholar] [CrossRef]
  11. Choi, I.K.; Jung, S.H.; Kim, B.J.; Park, S.Y.; Kim, J.; Han, H.U. Novel Leuconostoc citreum starter culture system for the fermentation of kimchi, a fermented cabbage product. Antonie Van Leeuwenhoek 2003, 84, 247–253. [Google Scholar] [CrossRef] [PubMed]
  12. Kim, M.J.; Lee, H.W.; Lee, M.E.; Roh, S.W.; Kim, T.W. Mixed starter of Lactococcus lactis and Leuconostoc citreum for extending kimchi shelf-life. J. Microbiol. 2019, 57, 479–484. [Google Scholar] [CrossRef] [PubMed]
  13. Patra, J.K.; Das, G.; Paramithiotis, S.; Shin, H.S. Kimchi and other widely consumed traditional fermented foods of Korea: A review. Front. Microbiol. 2016, 7, 149. [Google Scholar] [CrossRef] [PubMed]
  14. Park, J.; Heo, S.; Lee, G.; Hong, S.W.; Jeong, D.W. Bacterial community of kimchi added with seafood based on culture-dependent investigations. Heliyon 2024, 10, e34153. [Google Scholar] [CrossRef]
  15. Cho, J.; Lee, D.; Yang, C.; Jeon, J.; Kim, J.; Han, H. Microbial population dynamics of kimchi, a fermented cabbage product. FEMS Microbiol. Lett. 2006, 257, 262–267. [Google Scholar] [CrossRef]
  16. Jung, J.Y.; Lee, S.H.; Lee, H.J.; Seo, H.Y.; Park, W.S.; Jeon, C.O. Effects of Leuconostoc mesenteroides starter cultures on microbial communities and metabolites during kimchi fermentation. Int. J. Food Microbiol. 2012, 153, 378–387. [Google Scholar] [CrossRef]
  17. Lee, S.H.; Whon, T.W.; Roh, S.W.; Jeon, C.O. Unraveling microbial fermentation features in kimchi: From classical to meta-omics approaches. Appl. Microbiol. Biotechnol. 2020, 104, 7731–7744. [Google Scholar] [CrossRef]
  18. Moon, S.H.; Kim, C.R.; Chang, H.C. Heterofermentative lactic acid bacteria as a starter culture to control kimchi fermentation. LWT-Food Sci. Technol. 2018, 88, 181–188. [Google Scholar] [CrossRef]
  19. Lee, M.E.; Jang, J.Y.; Lee, J.H.; Park, H.W.; Choi, H.J.; Kim, T.W. Starter Cultures for Kimchi Fermentation. J. Microbiol. Biotechnol. 2015, 25, 559–568. [Google Scholar] [CrossRef]
  20. Kim, H.J.; Kwon, M.S.; Hwang, H.; Choi, H.-S.; Lee, W.; Choi, S.-P.; Jo, H.; Hong, S.W. A review of the health benefits of kimchi functional compounds and metabolites. Microbiol. Biotechnol. Lett. 2023, 51, 353–373. [Google Scholar] [CrossRef]
  21. Park, J.; Heo, S.; Na, H.-E.; Lee, G.; Kim, T.; Sung, M.-H.; Jeong, D.W. Culture-dependent and -independent investigations of the effect of addition of jogi on the bacterial community of kimchi. Food Biosci. 2023, 54, 102832. [Google Scholar] [CrossRef]
  22. Clinical and Laboratory Standards Institute (CLSI). Performance Standards for Antimicrobial Susceptibility Testing, 30th ed.; CLSI Supplement M100; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2020. [Google Scholar]
  23. EFSA Panel on Additives and Products or Substances used in Animal Feed (FEEDAP). Guidance on the assessment of bacterial susceptibility to antimicrobials of human and veterinary importance. EFSA J. 2012, 10, 2740. [Google Scholar] [CrossRef]
  24. Lee, C.Y.; Buranen, S.L.; Zhi-Hai, Y. Construction of single-copy integration vectors for Staphylococcus aureus. Gene 1991, 103, 101–105. [Google Scholar] [CrossRef] [PubMed]
  25. Lee, J.-H.; Heo, S.; Jeong, M.; Jeong, D.-W. Transfer of a mobile Staphylococcus saprophyticus plasmid isolated from fermented seafood that confers tetracycline resistance. PLoS ONE 2019, 14, e0213289. [Google Scholar] [CrossRef]
  26. Monk, I.R.; Shah, I.M.; Xu, M.; Tan, M.W.; Foster, T.J. Transforming the untransformable: Application of direct transformation to manipulate genetically Staphylococcus aureus and Staphylococcus epidermidis. mBio 2012, 3, e00277-11. [Google Scholar] [CrossRef]
  27. Liu, C.; Zhang, Z.Y.; Dong, K.; Yuan, J.P.; Guo, X.K. Antibiotic resistance of probiotic strains of lactic acid bacteria isolated from marketed foods and drugs. Biomed. Environ. Sci. 2009, 22, 401–412. [Google Scholar] [CrossRef]
  28. Jeong, D.W.; Han, S.; Lee, J.H. Safety and technological characterization of Staphylococcus equorum isolates from jeotgal, a Korean high-salt-fermented seafood, for starter development. Int. J. Food Microbiol. 2014, 188, 108–115. [Google Scholar] [CrossRef]
  29. Kobayashi, N.; Alam, M.; Nishimoto, Y.; Urasawa, S.; Uehara, N.; Watanabe, N. Distribution of aminoglycoside resistance genes in recent clinical isolates of Enterococcus faecalis, Enterococcus faecium and Enterococcus avium. Epidemiol. Infect. 2001, 126, 197–204. [Google Scholar] [CrossRef]
  30. Gibreel, A.; Skold, O.; Taylor, D.E. Characterization of plasmid-mediated aphA-3 kanamycin resistance in Campylobacter jejuni. Microb. Drug Resist. 2004, 10, 98–105. [Google Scholar] [CrossRef]
  31. Rojo-Bezares, B.; Saenz, Y.; Poeta, P.; Zarazaga, M.; Ruiz-Larrea, F.; Torres, C. Assessment of antibiotic susceptibility within lactic acid bacteria strains isolated from wine. Int. J. Food Microbiol. 2006, 111, 234–240. [Google Scholar] [CrossRef]
  32. Ouoba, L.I.; Lei, V.; Jensen, L.B. Resistance of potential probiotic lactic acid bacteria and bifidobacteria of African and European origin to antimicrobials: Determination and transferability of the resistance genes to other bacteria. Int. J. Food Microbiol. 2008, 121, 217–224. [Google Scholar] [CrossRef] [PubMed]
  33. Berube, B.; Wardenburg, J. Staphylococcus aureus α-Toxin: Nearly a Century of Intrigue. Toxins 2013, 5, 1140–1166. [Google Scholar] [CrossRef] [PubMed]
  34. Heo, S.; Kim, T.; Na, H.E.; Lee, G.; Park, J.H.; Park, H.J.; Jeong, D.W. Safety Assessment Systems for Microbial Starters Derived from Fermented Foods. J. Microbiol. Biotechnol. 2022, 32, 1219–1225. [Google Scholar] [CrossRef] [PubMed]
  35. Chandra, P.; Enespa, N.; Singh, R.; Arora, P.K. Microbial lipases and their industrial applications: A comprehensive review. Microb. Cell Fact. 2020, 19, 169. [Google Scholar] [CrossRef]
  36. Gao, X.; Liu, E.; Yin, Y.; Yang, L.; Huang, Q.; Chen, S.; Ho, C. Enhancing Activities of Salt-Tolerant Proteases Secreted by Aspergillus oryzae Using Atmospheric and Room-Temperature Plasma Mutagenesis. J. Agric. Food Chem. 2020, 68, 2757–2764. [Google Scholar] [CrossRef]
  37. Gao, X.; Liu, E.; Zhang, J.; Yang, L.; Huang, Q.; Chen, S.; Ma, H.; Ho, C.; Liao, L. Accelerating aroma formation of raw soy sauce using low intensity sonication. Food Chem. 2020, 329, 127118. [Google Scholar] [CrossRef]
  38. Solanki, P.; Putatunda, C.; Kumar, A.; Bhatia, R.; Walia, A. Microbial proteases: Ubiquitous enzymes with innumerable uses. 3 Biotech. 2021, 11, 428. [Google Scholar] [CrossRef]
  39. FAO/WHO. Joint FAO/WHO. (Food and Agriculture Organization/World Health Organization). Working Group Report on Drafting Guidelines for the Evaluation of Probiotics in Food; FAO: Rome, Italy; WHO: Geneva, Switzerland, 2002. [Google Scholar]
  40. Iosca, G.; De Vero, L.; Di Rocco, G.; Perrone, G.; Gullo, M.; Pulvirenti, A. Anti-Spoilage Activity and Exopolysaccharides Production by Selected Lactic Acid Bacteria. Foods 2022, 11, 1914. [Google Scholar] [CrossRef]
  41. Flórez, A.B.; Campedelli, I.; Delgado, S.; Alegria, Á.; Salvetti, E.; Felis, G.E.; Mayo, B.; Torriani, S. Antibiotic Suscepti.bility Profiles of Dairy Leuconostoc, Analysis of the Genetic Basis of Atypical Resistances and Transfer of Genes In Vitro and in a Food Matrix. PLoS ONE 2016, 11, e0145203. [Google Scholar] [CrossRef]
  42. Lee, J.H.; Jeong, D.W. Characterization of mobile Staphylococcus equorum plasmids isolated from fermented seafood that confer lincomycin resistance. PLoS ONE 2015, 10, e0140190. [Google Scholar] [CrossRef]
  43. Jeong, D.-W.; Heo, S.; Ryu, S.; Blom, J.; Lee, J.-H. Genomic insights into the virulence and salt tolerance of Staphylococcus equorum. Sci. Rep. 2017, 7, 5383. [Google Scholar] [CrossRef]
  44. Mathur, S.; Singh, R. Antibiotic resistance in food lactic acid bacteria—A review. Int. J. Food Microbiol. 2005, 105, 281–295. [Google Scholar] [CrossRef]
Microorganisms 12 02636 g001
Figure 1. Minimum inhibitory concentration distributions for eight antibiotics and 46 Leuconostoc citreum strains isolated from kimchi, determined by the broth microdilution method. The vertical red dotted line represents the breakpoint for Leuconostoc spp., as established by EFSA [23].
Figure 1. Minimum inhibitory concentration distributions for eight antibiotics and 46 Leuconostoc citreum strains isolated from kimchi, determined by the broth microdilution method. The vertical red dotted line represents the breakpoint for Leuconostoc spp., as established by EFSA [23].
Microorganisms 12 02636 g001
Microorganisms 12 02636 g002
Figure 2. α-Hemolytic activity and β-hemolytic activity of five Leuconostoc citreum strains showing sensitivity to seven antibiotics. Staphylococcus aureus strains USA300-p23 and RN4220 were used as positive and negative controls, respectively.
Figure 2. α-Hemolytic activity and β-hemolytic activity of five Leuconostoc citreum strains showing sensitivity to seven antibiotics. Staphylococcus aureus strains USA300-p23 and RN4220 were used as positive and negative controls, respectively.
Microorganisms 12 02636 g002
Microorganisms 12 02636 g003
Figure 3. Salt tolerance and enzymatic activities of Leuconostoc citreum DMLC16. Acid and protease activities, along with salt tolerance, were assessed on TSA and MRS agar containing 0.5%, 3%, and 6% NaCl (w/v) as final concentrations.
Figure 3. Salt tolerance and enzymatic activities of Leuconostoc citreum DMLC16. Acid and protease activities, along with salt tolerance, were assessed on TSA and MRS agar containing 0.5%, 3%, and 6% NaCl (w/v) as final concentrations.
Microorganisms 12 02636 g003
Table 1. Oligonucleotides for the identification of acquired antibiotic resistance genes.
Table 1. Oligonucleotides for the identification of acquired antibiotic resistance genes.
AntibioticTarget GeneOligonucleotide Sequence (5′-3′)Size
(bp)		Reference
ForwardReverse
AmpicillinblaZTACTTCAACACCTGCTGCTTTCGATTACACTCTTGGCGGTTTCAC325[27]
ChloramphenicolcatCCAGCAAACTACGTATAGCATTACGATGAAGCTGCAAGGCAACTGG499[28]
Gentamicinaac(6′)-aph(2″)CCAAGAGCAATAAGGGCATACCACCCTCAAAAACTGTTGTTGC675[29]
KanamycinaphA-3GGGACCACCTATGATGTGGAACGCAGGCTTGATCCCCAGTAAGTC600[30]
Streptomycinant(6)ACTGGCTTAATCAATTTGGGGCCTTTCCGCCACCTCACCG597[31]
str(A)CTTGGTGATAACGGCAATTCCCAATCGCAGATAGAAGGC500[32]
str(B)ATCGTCAAGGGATTGAAACCGGATCGTAGAACATATTGGC500[32]
TetracyclinetetKTTAGGTGAAGGGTTAGGTCCGCAAACTCATTCCAGAAGCA718[28]
tetMACAGAAAGCTTATTATATAACTGGCGTGTCTATGATGTTCAC171[28]
Table 2. Number of Leuconostoc citreum strains showing salt tolerance and enzyme activities under different NaCl concentrations.
Table 2. Number of Leuconostoc citreum strains showing salt tolerance and enzyme activities under different NaCl concentrations.
Growth or Zone of HaloNaCl (w/v) ToleranceProtease ActivityAcid Production
3%6%0.5% a3%6%0.5% a3%
G 4646
— 115 11
W 181613
+ 112513314
++ 29714218
+++ 551
Total46464646464646
a The NaCl concentration in TSA is 0.5% (w/v), and other values indicate the final concentration of NaCl in the medium. Abbreviations: G, growth. Diameter of growth-inhibition zone: —, 0.0 mm; W, <0.5 mm; +, 0.5–2.0 mm; ++, 2.0–4.0 mm; +++, >4.0 mm.
Table 3. Technological properties of five selected Leuconostoc citreum strains.
Table 3. Technological properties of five selected Leuconostoc citreum strains.
StrainNaCl (w/v) ToleranceProtease aAcid a
3%6%0.5% b3%6%0.5%3%
AK5T17GG+++++++++W
AK5T19GG++++++W++W
AK10M04GG+++++++++++
DMLC16GG+++++++++++++
YK10T20GG++++++W+++
a Diameter of clear zone: W, <0.5 mm; +, 0.5–2.0 mm; ++, 2.0–4.0 mm; +++, >4.0 mm; b The NaCl concentration in TSA is 0.5% (w/v), with other values reflecting the final NaCl concentration in the medium. Abbreviations: G, growth.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Lee, S.; Heo, S.; Lee, G.; Moon, Y.; Kim, M.; Kwak, M.-S.; Jeong, D.-W. Antibiotic Susceptibility and Technological Properties of Leuconostoc citreum for Selecting Starter Candidates. Microorganisms 2024, 12, 2636. https://doi.org/10.3390/microorganisms12122636

AMA Style

Lee S, Heo S, Lee G, Moon Y, Kim M, Kwak M-S, Jeong D-W. Antibiotic Susceptibility and Technological Properties of Leuconostoc citreum for Selecting Starter Candidates. Microorganisms. 2024; 12(12):2636. https://doi.org/10.3390/microorganisms12122636

Chicago/Turabian Style

Lee, Sumin, Sojeong Heo, Gawon Lee, Yura Moon, Minkyeong Kim, Mi-Sun Kwak, and Do-Won Jeong. 2024. "Antibiotic Susceptibility and Technological Properties of Leuconostoc citreum for Selecting Starter Candidates" Microorganisms 12, no. 12: 2636. https://doi.org/10.3390/microorganisms12122636

APA Style

Lee, S., Heo, S., Lee, G., Moon, Y., Kim, M., Kwak, M.-S., & Jeong, D.-W. (2024). Antibiotic Susceptibility and Technological Properties of Leuconostoc citreum for Selecting Starter Candidates. Microorganisms, 12(12), 2636. https://doi.org/10.3390/microorganisms12122636

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop