Viral Metagenomics in Patients Who Underwent Allogeneic Hematopoietic Stem Cell Transplantation (HSCT): A Brazilian Experience
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Population and Study Design
2.2. Next-Generation Sequencing
2.3. Bioinformatic Analysis
2.4. Direct Confirmation of Viruses with Clinical Importance
3. Results
3.1. Demographic and Clinical Data of the Tested Patients
3.2. Viral Abundance in Allogeneic HSCT
3.3. Molecular Prevalence of the Tested Viruses and CMV/EBV Serological Pre-Transplantation Status
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ljungman, P.; Hakki, M.; Boeckh, M. Cytomegalovirus in hematopoietic stem cell transplant recipients. Hematol. Oncol. Clin. N. Am. 2011, 25, 151–169. [Google Scholar] [CrossRef] [PubMed]
- Wormser, V.R.; Agudelo Higuita, N.I.; Ramaswami, R.; Melendez, D.P. Hematopoietic stem cell transplantation and the non cytomegalovirus herpesviruses. Transpl. Infect. Dis. 2023, 25 (Suppl. S1), e14201. [Google Scholar] [CrossRef] [PubMed]
- Pochon, C.; Voigt, S. Respiratory Virus Infections in Hematopoietic Cell Transplant Recipients. Front. Microbiol. 2019, 9, 3294. [Google Scholar] [CrossRef] [PubMed]
- Rauwolf, K.K.; Pichler, H. Virus infections after allogeneic stem cell transplantation in children. Rev. EJC Paediatr. Oncol. 2023, 2, 100131. [Google Scholar] [CrossRef]
- Wingard, J.R.; Hsu, J.; Hiemenz, J.W. Hematopoietic stem cell transplantation: An overview of infection risks and epidemiology. Hematol. Oncol. Clin. N. Am. 2011, 25, 101–116. [Google Scholar] [CrossRef] [PubMed]
- Ljungman, P. Viral Infections in Hematopoietic Stem Cell Transplant Recipients. Allogeneic Stem Cell Transplant. 2009, 27, 505–532. [Google Scholar] [CrossRef]
- Stanojevic, M.; Bertaina, A.; Bonfim, C.; Ciccocioppo, R.; Cohen, S.; Purtill, D.; Ruggeri, A.; Russell, A.; Sharma, A.; Wynn, R.; et al. Viral infection in hematopoietic stem cell transplantation: An International Society for Cell & Gene Therapy Stem Cell Engineering Committee review on the role of cellular therapy in prevention and treatment. Cytotherapy 2022, 9, 884–891. [Google Scholar] [CrossRef]
- Fan, J.; Jing, M.; Yang, M.; Xu, L.; Liang, H.; Huang, Y.; Yang, R.; Gui, G.; Wang, H.; Gong, S.; et al. Herpesvirus infections in hematopoietic stem cell transplant recipients seropositive for human cytomegalovirus before transplantation. Int. J. Infect. Dis. 2016, 46, 89–93. [Google Scholar] [CrossRef]
- Noviello, M.; Lorentino, F.; Xue, E.; Racca, S.; Furnari, G.; Valtolina, V.; Campodonico, E.; Dvir, R.; Lupo-Stanghellini, M.T.; Giglio, F.; et al. Human herpesvirus 6-specific T-cell immunity in allogeneic hematopoietic stem cell transplant recipients. Blood Adv. 2023, 18, 5446–5457. [Google Scholar] [CrossRef]
- Vermont, C.L.; Jol-van der Zijde, E.C.; Hissink Muller, P.; Ball, L.M.; Bredius, R.G.; Vossen, A.C.; Lankester, A.C. Varicella zoster reactivation after hematopoietic stem cell transplant in children is strongly correlated with leukemia treatment and suppression of host T-lymphocyte immunity. Transpl. Infect. Dis. 2014, 2, 188–194. [Google Scholar] [CrossRef]
- Lin, R.; Liu, Q. Diagnosis and treatment of viral diseases in recipients of allogeneic hematopoietic stem cell transplantation. J. Hematol. Oncol. 2013, 6, 94. [Google Scholar] [CrossRef] [PubMed]
- Pradier, A.; Cordey, S.; Zanella, M.C.; Melotti, A.; Wang, S.; Mamez, A.C.; Chalandon, Y.; Masouridi-Levrat, S.; Kaiser, L.; Simonetta, F.; et al. Human pegivirus-1 replication influences NK cell reconstitution after allogeneic hematopoietic stem cell transplantation. Front. Immunol. 2023, 14, 1170106. [Google Scholar] [CrossRef]
- Forqué, L.; Albert, E.; Piñana, J.L.; Pérez, A.; Hernani, R.; Solano, C.; Navarro, D.; Giménez, E. Monitoring of plasma Torque teno virus, total Anelloviridae and Human Pegivirus 1 viral load for the prediction of infectious events and acute graft versus host disease in the allogeneic hematopoietic stem cell transplantation setting. J. Med. Virol. 2023, 9, e29107. [Google Scholar] [CrossRef] [PubMed]
- De Vlaminck, I.; Khush, K.K.; Strehl, C.; Kohli, B.; Luikart, H.; Neff, N.F.; Okamoto, J.; Snyder, T.M.; Cornfield, D.N.; Nicolls, M.R.; et al. Temporal response of the human virome to immunosuppression and antiviral therapy. Cell 2013, 5, 1178–1187. [Google Scholar] [CrossRef]
- Fernández-Ruiz, M.; Albert, E.; Giménez, E.; Ruiz-Merlo, T.; Parra, P.; López-Medrano, F.; San Juan, R.; Polanco, N.; Andrés, A.; Navarro, D.; et al. Monitoring of alphatorquevirus DNA levels for the prediction of immunosuppression-related complications after kidney transplantation. Am. J. Transplant. 2019, 4, 1139–1149. [Google Scholar] [CrossRef]
- Strassl, R.; Schiemann, M.; Doberer, K.; Görzer, I.; Puchhammer-Stöckl, E.; Eskandary, F.; Kikic, Ž.; Gualdoni, G.A.; Vossen, M.G.; Rasoul-Rockenschaub, S.; et al. Quantification of Torque Teno Virus Viremia as a Prospective Biomarker for Infectious Disease in Kidney Allograft Recipients. J. Infect. Dis. 2018, 8, 1191–1199. [Google Scholar] [CrossRef]
- Bhattarai, N.; Stapleton, J.T. GB virus C: The good boy virus? Trends Microbiol. 2012, 3, 124–130. [Google Scholar] [CrossRef]
- N’Guessan, K.F.; Anderson, M.; Phinius, B.; Moyo, S.; Malick, A.; Mbangiwa, T.; Choga, W.T.; Makhema, J.; Marlink, R.; Essex, M.; et al. The Impact of Human Pegivirus on CD4 Cell Count in HIV-Positive Persons in Botswana. Open Forum Infect. Dis. 2017, 4, ofx222. [Google Scholar] [CrossRef]
- de Miranda, B.K.B.; de Sá, K.S.G.; da Silva, A.N.R.; Feitosa, R.N.M.; Cayres-Vallinoto, I.M.V.; Ishak, R.; Vallinoto, A.C.R. GBV-C/HIV-1 coinfection is associated with low HIV-1 viral load and high CD4+ T lymphocyte count. Arch. Virol. 2017, 11, 3431–3438. [Google Scholar] [CrossRef]
- Andrews, S. FastQC: A Quality Control Tool for High Throughput Sequence Data. 2010. Available online: http://www.bioinformatics.babraham.ac.uk/projects/fastqc (accessed on 17 October 2024).
- Bolger, A.M.; Loshe, M.; Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef]
- Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. Embnet J. 2011, 17, 10–12. [Google Scholar] [CrossRef]
- Chen, S.; Huang, T.; Zhou, Y.; Han, Y.; Xu, M.; Gu, J. AfterQC: Automatic filtering, trimming, error removing and quality control for fastq data. BMC Bioinform. 2017, 18, 80. [Google Scholar] [CrossRef] [PubMed]
- Wood, D.E.; Lu, J.; Langmead, B. Improved metagenomic analysis with Kraken 2. Genome Biol. 2019, 20, 257. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Durbin, R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 2009, 25, 1754–1760. [Google Scholar] [CrossRef]
- Bankevich, A.; Nurk, S.; Antipov, D.; Gurevich, A.A.; Dvorkin, M.; Kulikov, A.S.; Lesin, V.M.; Nikolenko, S.I.; Pham, S.; Prjibelski, A.D.; et al. SPAdes: A new genome assembly algorithm and its applications to single-cell sequencing. J. Comput. Biol. 2012, 19, 455–477. [Google Scholar] [CrossRef]
- Buchfink, B.; Xie, C.; Huson, D. Fast and sensitive protein alignment using DIAMOND. Nat. Methods 2015, 12, 59–60. [Google Scholar] [CrossRef]
- Allard, A.; Albinsson, B.; Wadell, G. Rapid typing of human adenoviruses by a general PCR combined with restriction endonuclease analysis. J. Clin. Microbiol. 2001, 39, 498–505. [Google Scholar] [CrossRef]
- Biasolo, M.A.; Calistri, A.; Cesaro, S.; Gentile, G.; Mengoli, C.; Palù, G. Case report: Kinetics of Epstein-Barr virus load in a bone marrow transplant patient with no sign of lymphoproliferative disease. J. Med. Virol. 2003, 69, 220–224. [Google Scholar] [CrossRef] [PubMed]
- Peker, B.O.; Daloğlu, A.E.; Görzer, I.; Puchhammer-Stöckl, E.; Parkan, Ö.M.; Akbaş, H.; Kintrup, G.T.; Mutlu, D.; Küpesiz, O.A.; Çolak, D. Investigation of Torque Teno Virus (TTV) DNA as an immunological and virological marker in pediatric hematopoietic stem cell transplantation (HSCT) patients. Microb. Pathog. 2020, 149, 104397. [Google Scholar] [CrossRef]
- Zanella, M.-C.; Vu, D.-L.; Hosszu-Fellous, K.; Neofytos, D.; Van Delden, C.; Turin, L.; Poncet, A.; Simonetta, F.; Masouridi-Levrat, S.; Chalandon, Y.; et al. Longitudinal Detection of Twenty DNA and RNA Viruses in Allogeneic Hematopoietic Stem Cell Transplant Recipients Plasma. Viruses 2023, 15, 928. [Google Scholar] [CrossRef]
- Spandole, S.; Cimponeriu, D.; Berca, L.M.; Mihăescu, G. Human anelloviruses: An update of molecular, epidemiological and clinical aspects. Arch. Virol. 2015, 160, 893–908. [Google Scholar] [CrossRef]
- Giménez, E.; Monzó, C.; Albert, E.; Fuentes-Trillo, A.; Seda, E.; Piñana, J.L.; Hernández Boluda, J.C.; Solano, C.; Chaves, J.; Navarro, D. Diversity and dynamic changes of anelloviruses in plasma following allogeneic hematopoietic stem cell transplantation. J. Med. Virol. 2021, 93, 5167–5172. [Google Scholar] [CrossRef] [PubMed]
- Pradier, A.; Masouridi-Levrat, S.; Bosshard, C.; Dantin, C.; Vu, D.L.; Zanella, M.C.; Boely, E.; Tapparel, C.; Kaiser, L.; Chalandon, Y.; et al. Torque Teno Virus as a Potential Biomarker for Complications and Survival After Allogeneic Hematopoietic Stem Cell Transplantation. Front. Immunol. 2020, 11, 998. [Google Scholar] [CrossRef] [PubMed]
- Mouton, W.; Conrad, A.; Bal, A.; Boccard, M.; Malcus, C.; Ducastelle-Lepretre, S.; Balsat, M.; Barraco, F.; Larcher, M.-V.; Fossard, G.; et al. Torque Teno Virus Viral Load as a Marker of Immune Function in Allogeneic Haematopoietic Stem Cell Transplantation Recipients. Viruses 2020, 12, 1292. [Google Scholar] [CrossRef] [PubMed]
- Rezahosseini, O.; Drabe, C.H.; Sørensen, S.S.; Rasmussen, A.; Perch, M.; Ostrowski, S.R.; Nielsen, S.D. Torque-Teno virus viral load as a potential endogenous marker of immune function in solid organ transplantation. Transpl. Rev. 2019, 33, 137–144. [Google Scholar] [CrossRef]
- Diaz, L.; Rosales, J.; Rosso, F.; Rosales, M.; Estacio, M.; Manzi, E.; Jaramillo, F.J. Cytomegalovirus disease in patients with hematopoietic stem cell transplantation, experience over 8 years. Hematol. Transfus. Cell Ther. 2020, 42, 18–24. [Google Scholar] [CrossRef]
- Jakharia, N.; Howard, D.; Riedel, D.J. CMV Infection in Hematopoietic Stem Cell Transplantation: Prevention and Treatment Strategies. Curr. Treat. Options Infect. Dis. 2021, 13, 123–140. [Google Scholar] [CrossRef]
- Lindemans, C.A.; Leen, A.M.; Boelens, J.J. How I treat adenovirus in hematopoietic stem cell transplant recipients. Blood. 2010, 25, 5476–5485. [Google Scholar] [CrossRef]
- Ison, M.G. Adenovirus infections in transplant recipients. Clin. Infect. Dis. 2006, 43, 331–339. [Google Scholar] [CrossRef]
- Al-Heeti, O.M.; Cathro, H.P.; Ison, M.G. Adenovirus Infection and Transplantation. Transplantation 2022, 106, 920–927. [Google Scholar] [CrossRef]
- Taniguchi, K.; Yoshihara, S.; Tamaki, H.; Fujimoto, T.; Ikegame, K.; Kaida, K.; Nakata, J.; Inoue, T.; Kato, R.; Fujioka, T.; et al. Incidence and treatment strategy for disseminated adenovirus disease after haploidentical stem cell transplantation. Ann. Hematol. 2012, 8, 1305–1312. [Google Scholar] [CrossRef]
- Shirley, J.; Yao, J. Laboratory diagnosis of adenoviral infections in transplant recipients. Clin. Microbiol. Newsl. 2023, 45, 189–199. [Google Scholar] [CrossRef]
- Tsushima, T.; Masuda, S.I.; Yoda, N.; Kainuma, S.; Kimeda, C.; Konno, S.; Tanaka, K.; Matsuo, K.; Shimoji, S.; Kimura, K.; et al. Clinical characteristics and outcomes of Epstein-Barr virus viral load after allogeneic hematopoietic stem cell transplantation. Ann. Hematol. 2024, 103, 935–946. [Google Scholar] [CrossRef] [PubMed]
- Law, N.; Logan, C.; Taplitz, R. EBV Reactivation and Disease in Allogeneic Hematopoietic Stem Cell Transplant (HSCT) Recipients and Its Impact on HSCT Outcomes. Viruses 2024, 16, 1294. [Google Scholar] [CrossRef] [PubMed]
Virus | Primers (5′-3′) | Probe FAM-MGB (5′-3′) | Genomic Localization * |
---|---|---|---|
Cytomegalovirus (CMV) | Forward: ACCGTCTGCGCGAATGTTA Reverse: TCGCAGATGAGCAGCTTCTG | CACCCTGCTTTCCGAC | FP 143,285–143,303 RP 143,332–143,351 Probe 143,305–143,320 (KU221100) |
Epstein-Barr virus (EBV) [29] | Forward: TCAACCTCTTCCATGTCACTGAGA Reverse: TGGGTGAGCGGAGGTTAGTAA | TCAGCCCCTCCACCAGTGACAATTC | FP 77,792–77,812 RP 77,876–77,899 Probe 77,829–77,853 (MK973061) |
Adenovirus type 7 (in-house designed) | Forward: CGCCGGACAGGATGCTT Reverse: CTACGGTCGGTGGTCAC | AGTCCGGGTCTGGTGCAGTTCGCC | FP 18,438–18,454 RP 18,559–18,757 Probe 18,466–18,489 (OP270254) |
Demographic and Clinical Parameters | Frequency |
---|---|
Gender | |
Male | n = 12/60% |
Female | n = 8/40% |
Age | |
Mean | 38.85 |
Range | 18–66 years |
Clinical condition | |
Sickle cell disease | n = 1/5% |
Chronic myeloid leukemia | n = 3/25% |
Acute lymphoblastic leukemia | n = 5/25% |
Acute myeloid leukemia | n = 5/25% |
Aplastic anemia | n = 6/30% |
Type of transplant | |
Haploidentical | n = 6/30% |
HLA identical | n = 11/55% |
Unrelated donor | n = 3/25% |
Patient ID | D + 0 | D + 30 | D + 100 |
---|---|---|---|
RP3 | - | CMV (Ct = 39.1) | - |
RP5 | - | CMV (Ct = 38.7) | Death |
RP9 | - | - | CMV (Ct = 38.7) |
RP10 | - | - | CMV (Ct = 38.8) |
RP18 | CMV (Ct = 26.7) | - | EBV (Ct = 38.3) |
RP19 | - | CMV (Ct = 38.7), Adenovirus B (Ct = 31.2) | Death |
RP21 | - | CMV (Ct = 35.6) | - |
ID | Date of Testing | Date of Transplantation | CMV IgG | CMV IgM | EBV IgG | EBV IgM |
---|---|---|---|---|---|---|
RP3 | 26 September 2018 | 17 May 2019 | + | − | + | − |
RP5 | 3 October 2018 | 4 July 2019 | + | − | + | − |
RP9 | 16 July 2019 | 31 October 2019 | + | − | + | − |
RP10 | 5 November 2019 | 22 November 2019 | + | − | + | − |
RP18 | 17 December 2018 | 3 September 2020 | + | − | + | − |
RP19 | 6 August 2020 | 23 October 2020 | + | − | + | − |
RP21 | 31 July 2020 | 29 October 2020 | + | − | + | − |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
de Campos, G.M.; de Mello Costa, T.C.; Silveira, R.M.; Valença, I.N.; Bezerra, R.d.S.; Darrigo Junior, L.G.; Vieira, A.C.d.J.; Mesquita, C.C.; Laurindo, P.d.S.; Cunha, R.G.; et al. Viral Metagenomics in Patients Who Underwent Allogeneic Hematopoietic Stem Cell Transplantation (HSCT): A Brazilian Experience. Microorganisms 2024, 12, 2557. https://doi.org/10.3390/microorganisms12122557
de Campos GM, de Mello Costa TC, Silveira RM, Valença IN, Bezerra RdS, Darrigo Junior LG, Vieira ACdJ, Mesquita CC, Laurindo PdS, Cunha RG, et al. Viral Metagenomics in Patients Who Underwent Allogeneic Hematopoietic Stem Cell Transplantation (HSCT): A Brazilian Experience. Microorganisms. 2024; 12(12):2557. https://doi.org/10.3390/microorganisms12122557
Chicago/Turabian Stylede Campos, Gabriel Montenegro, Thalita Cristina de Mello Costa, Roberta Maraninchi Silveira, Ian Nunes Valença, Rafael dos Santos Bezerra, Luiz Guilherme Darrigo Junior, Ana Carolina de Jesus Vieira, Camila Campos Mesquita, Patrícia da Silva Laurindo, Renato Guerino Cunha, and et al. 2024. "Viral Metagenomics in Patients Who Underwent Allogeneic Hematopoietic Stem Cell Transplantation (HSCT): A Brazilian Experience" Microorganisms 12, no. 12: 2557. https://doi.org/10.3390/microorganisms12122557
APA Stylede Campos, G. M., de Mello Costa, T. C., Silveira, R. M., Valença, I. N., Bezerra, R. d. S., Darrigo Junior, L. G., Vieira, A. C. d. J., Mesquita, C. C., Laurindo, P. d. S., Cunha, R. G., Kashima, S., Covas, D. T., Simões, B. P., Sampaio, S. C., Elias, M. C., Giovanetti, M., & Slavov, S. N. (2024). Viral Metagenomics in Patients Who Underwent Allogeneic Hematopoietic Stem Cell Transplantation (HSCT): A Brazilian Experience. Microorganisms, 12(12), 2557. https://doi.org/10.3390/microorganisms12122557