Survey on the Occurrence of Zoonotic Bacterial Pathogens in the Feces of Wolves (Canis lupus italicus) Collected in a Protected Area in Central Italy
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Area
2.2. Sampling
2.3. Bacteriological Analyses
2.3.1. Bacteriological Cultures
Listeria monocytogenes
Campylobacter spp.
Yersinia spp.
Salmonella spp.
Shiga Toxin-Producing Escherichia coli (STEC)
Extended Spectrum β-Lactamase- and Carbapenemase-Producing Enterobacteriaceae
2.3.2. Antimicrobial Susceptibility Test
2.3.3. Molecular Detection of Pathogens
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Bergström, A.; Stanton, D.W.G.; Taron, U.H.; Frantz, L.; Sinding, M.H.S.; Ersmark, E.; Pfrengle, S.; Cassatt-Johnstone, M.; Lebrasseur, O.; Girdland-Flink, L.; et al. Grey wolf genomic history reveals a dual ancestry of dogs. Nature 2022, 607, 313. [Google Scholar] [CrossRef] [Scilit]
- Martin, J.L.; Chamaillé-Jammes, S.; Waller, D.M. Deer, wolves, and people: Costs, benefits and challenges of living together. Biol. Rev. 2020, 95, 782–801. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fabbri, E.; Miquel, C.; Lucchini, V.; Santini, A.; Caniglia, R.; Duchamp, C.; Weber, J.M.; Lequette, B.; Marucco, F.; Boitani, L.; et al. From the Apennines to the Alps: Colonization genetics of the naturally expanding Italian wolf (Canis lupus) population. Mol. Ecol. 2007, 16, 1661–1671. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Galaverni, M.; Caniglia, R.; Fabbri, E.; Milanesi, P.; Randi, E. One, no one, or one hundred thousand: How many wolves are there currently in Italy? Mammal Res. 2016, 61, 13–24. [Google Scholar] [CrossRef] [Scilit]
- Boitani, L. Canis lupus (Europe Assessment) (Errata Version Published in 2019). The IUCN Red List of Threatened Species 2018; p. e.T3746A144226239. Available online: https://www.iucnredlist.org/fr/species/3746/144226239#errata (accessed on 5 November 2024).
- La Morgia, V.; Marucco, F.; Aragno, P.; Salvatori, V.; Gervasi, V.; De Angelis, D.; Fabbri, E.; Caniglia, R.; Velli, E.; Avanzinelli, E.; et al. Stima della Distribuzione e Consistenza del lupo a Scala Nazionale 2020/2021. Relazione Tecnica Realizzata Nell’ambito della Convenzione ISPRA-Ministero della Transizione Ecologica “Attività di Monitoraggio Nazionale Nell’ambito del Piano di Azione del lupo”. Available online: https://www.isprambiente.gov.it/it/attivita/biodiversita/monitoraggio-nazionale-del-lupo/link (accessed on 5 November 2024).
- Torretta, E.; Caviglia, L.; Serafini, M.; Meriggi, A. Wolf predation on wild ungulates: How slope and habitat cover influence the localization of kill sites. Curr. Zool. 2018, 64, 271. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Perrucci, S.; Maestrini, M.; Coppola, F.; Di Marco, M.; Di Rosso, A.; Pacini, M.I.; Zintu, P.; Felicioli, A. Gray wolf (Canis lupus italicus) and red fox (Vulpes vulpes) parasite survey in anthropized and natural areas of Central Italy. Vet. Sci. 2023, 10, 108. [Google Scholar] [CrossRef] [Scilit]
- Gonçalves, A.; Igrejas, G.; Radhouani, H.; Estepa, V.; Pacheco, R.; Monteiro, R.; Brito, F.; Guerra, A.; Petrucci-Fonseca, F.; Torres, C.; et al. Iberian wolf as a reservoir of extended-spectrum β-lactamase-producing Escherichia coli of the TEM, SHV, and CTX-M groups. Microb. Drug Resist. 2012, 18, 215–219. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vittecoq, M.; Godreuil, S.; Prugnolle, F.; Durand, P.; Brazier, L.; Renaud, N.; Arnal, A.; Aberkane, S.; Jean-Pierre, H.; Gauthier-Clerc, M.; et al. Antimicrobial resistance in wildlife. J. Appl. Ecol. 2016, 53, 519–529. [Google Scholar] [CrossRef] [Scilit]
- Paoletti, B.; Iorio, R.; Traversa, D.; Di Francesco, C.E.; Gentile, L.; Angelucci, S.; Amicucci, C.; Bartolini, R.; Marangi, M.; Di Cesare, A. Helminth infections in faecal samples of Apennine wolf (Canis lupus italicus) and Marsican brown bear (Ursus arctos marsicanus) in two protected national parks of central Italy. Ann. Parasitol. 2017, 63, 205–212. [Google Scholar]
- Di Francesco, C.E.; Smoglica, C.; Paoletti, B.; Angelucci, S.; Innocenti, M.; Antonucci, A.; Di Domenico, G.; Marsilio, F. Detection of selected pathogens in Apennine wolf (Canis lupus italicus) by a non-invasive GPS-based telemetry sampling of two packs from Majella National Park, Italy. Eur. J. Wildl. Res. 2019, 65, 84. [Google Scholar] [CrossRef] [Scilit]
- Badagliacca, P.; Di Sabatino, D.; Salucci, S.; Romeo, G.; Cipriani, M.; Sulli, N.; Dall’Acqua, F.; Ruggieri, M.; Calistri, P.; Morelli, D. The role of the wolf in endemic sylvatic Trichinella britovi infection in the Abruzzi region of Central Italy. Vet. Parasitol. 2016, 231, 124–127. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ricchiuti, L.; Petrini, A.; Interisano, M.; Ruberto, A.; Salucci, S.; Marino, L.; Del Riccio, A.; Cocco, A.; Badagliacca, P.; Pozio, E. First report of Trichinella pseudospiralis in a wolf (Canis lupus italicus). Int. J. Parasitol. Parasites Wildl. 2021, 15, 195. [Google Scholar] [CrossRef] [Scilit]
- Macchioni, F.; Coppola, F.; Furzi, F.; Gabrielli, S.; Baldanti, S.; Boni, C.B.; Felicioli, A. Taeniid cestodes in a wolf pack living in a highly anthropic hilly agro-ecosystem. Parasite 2021, 28, 10. [Google Scholar] [CrossRef] [Scilit]
- Tieri, E.E.; Saletti, M.A.; D’Angelo, A.R.; Parisciani, G.; Pelini, S.; Cocco, A.; Di Teodoro, G.; Di Censo, E.; D’Alterio, N.; Latrofa, M.S.; et al. Angiostrongylus vasorum in foxes (Vulpes vulpes) and wolves (Canis lupus italicus) from Abruzzo region, Italy. Int. J. Parasitol. Parasites Wildl. 2021, 15, 184–194. [Google Scholar] [CrossRef] [Scilit]
- De Macedo, M.R.P.; Zanet, S.; Bruno, S.; Tolosano, A.; Marucco, F.; Rossi, L.; Muller, G.; Ferroglio, E. Gastrointestinal helminths of wolves (Canis lupus Linnaeus, 1758) in Piedmont, north-western Italy. J. Helminthol. 2020, 94, e88. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Poglayen, G.; Gori, F.; Morandi, B.; Galuppi, R.; Fabbri, E.; Caniglia, R.; Milanesi, P.; Galaverni, M.; Randi, E.; Marchesi, B.; et al. Italian wolves (Canis lupus italicus Altobello, 1921) and molecular detection of taeniids in the Foreste Casentinesi National Park, Northern Italian Apennines. Int. J. Parasitol. Parasites Wildl. 2017, 6, 1. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Massolo, A.; Valli, D.; Wassermann, M.; Cavallero, S.; D’Amelio, S.; Meriggi, A.; Torretta, E.; Serafini, M.; Casulli, A.; Zambon, L.; et al. Unexpected Echinococcus multilocularis infections in shepherd dogs and wolves in south-western Italian Alps: A new endemic area? Int. J. Parasitol. Parasites Wildl. 2018, 7, 309. [Google Scholar] [CrossRef] [Scilit]
- Crotti, S.; Spina, S.; Cruciani, D.; Bonelli, P.; Felici, A.; Gavaudan, S.; Gobbi, M.; Morandi, F.; Piseddu, T.; Torricelli, M.; et al. Tapeworms detected in wolf populations in Central Italy (Umbria and Marche regions): A long-term study. Int. J. Parasitol. Parasites Wildl. 2023, 21, 11–16. [Google Scholar] [CrossRef] [Scilit]
- Ndiana, L.A.; Lanave, G.; Desario, C.; Berjaoui, S.; Alfano, F.; Puglia, I.; Fusco, G.; Colaianni, M.L.; Vincifori, G.; Camarda, A.; et al. Circulation of diverse protoparvoviruses in wild carnivores, Italy. Transbound. Emerg. Dis. 2021, 68, 2489–2502. [Google Scholar] [CrossRef] [Scilit]
- Ndiana, L.A.; Lanave, G.; Vasinioti, V.; Desario, C.; Martino, C.; Colaianni, M.L.; Pellegrini, F.; Camarda, A.; Berjaoui, S.; Sgroi, G.; et al. Detection and genetic characterization of Canine Adenoviruses, Circoviruses, and novel Cycloviruses from wild carnivores in Italy. Front. Vet. Sci. 2022, 9, 331. [Google Scholar] [CrossRef] [Scilit]
- Zaccaria, G.; Malatesta, D.; Scipioni, G.; Di Felice, E.; Campolo, M.; Casaccia, C.; Savini, G.; Di Sabatino, D.; Lorusso, A. Circovirus in domestic and wild carnivores: An important opportunistic agent? Virology 2016, 490, 69–74. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Amoroso, M.G.; Di Concilio, D.; D’Alessio, N.; Veneziano, V.; Galiero, G.; Fusco, G. Canine parvovirus and pseudorabies virus coinfection as a cause of death in a wolf (Canis lupus) from southern Italy. Vet. Med. Sci. 2020, 6, 600. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Di Sabatino, D.; Lorusso, A.; Di Francesco, C.E.; Gentile, L.; Di Pirro, V.; Bellacicco, A.L.; Giovannini, A.; Di Francesco, G.; Marruchella, G.; Marsilio, F.; et al. Arctic Lineage-Canine Distemper Virus as a cause of death in apennine wolves (Canis lupus) in Italy. PLoS ONE 2014, 9, 82356. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alfano, F.; Dowgier, G.; Valentino, M.P.; Galiero, G.; Tinelli, A.; Decaro, N.; Fusco, G. Identification of pantropic Canine Coronavirus in a wolf (Canis lupus italicus) in Italy. J. Wildl. Dis. 2019, 55, 504–508. [Google Scholar]
- Balboni, A.; Musto, C.; Kaehler, E.; Verin, R.; Caniglia, R.; Fabbri, E.; Carra, E.; Cotti, C.; Battilani, M.; Delogu, M. Genetic Characterization of Canine Adenovirus Type 1 Detected by Real-Time Polymerase Chain Reaction in an Oral Sample of an Italian Wolf (Canis Lupus). J. Wildl. Dis. 2019, 55, 737–741. [Google Scholar] [CrossRef] [Scilit]
- Moreno, A.; Musto, C.; Gobbi, M.; Maioli, G.; Menchetti, M.; Trogu, T.; Paniccià, M.; Lavazza, A.; Delogu, M. Detection and molecular analysis of Pseudorabies virus from free-ranging Italian wolves (Canis lupus italicus) in Italy—A case report. BMC Vet. Res. 2024, 20, 9. [Google Scholar] [CrossRef] [Scilit]
- Smoglica, C.; Di Francesco, C.E.; Angelucci, S.; Antonucci, A.; Innocenti, M.; Marsilio, F. Occurrence of the tetracycline resistance gene tetA(P) in Apennine wolves (Canis lupus italicus) from different human–wildlife interfaces. J. Glob. Antimicrob. Resist. 2020, 23, 184–185. [Google Scholar] [CrossRef] [Scilit]
- Smoglica, C.; Angelucci, S.; Di Tana, F.; Antonucci, A.; Marsilio, F.; Esmeralda Di Francesco, C. Antibiotic Resistance in the Apennine Wolf (Canis lupus italicus): Implications for Wildlife and Human Health. Antibiotics 2023, 12, 950. [Google Scholar] [CrossRef] [Scilit]
- Di Francesco, A.; Salvatore, D.; Ranucci, A.; Gobbi, M.; Morandi, B. Antimicrobial resistance in wildlife: Detection of antimicrobial resistance genes in Apennine wolves (Canis lupus italicus Altobello, 1921) from Central Italy. Vet. Res. Commun. 2024, 48, 1941–1947. [Google Scholar] [CrossRef] [Scilit]
- Parco Foreste Casentinesi Monitoraggio Della Popolazione DI Lupo Nel Parco Nazionale Delle Foreste Casentinesi. Available online: https://www.parcoforestecasentinesi.it/it/node/550 (accessed on 5 November 2024).
- Guida per il Riconoscimento delle Specie. 2020. Progetto NAT2CARE Attivazione della Cittadinanza per il Ripristino e la Conservazione delle aree Natura 2000 Transfrontaliere. Dipartimento di Scienze Agroalimentari Ambientali e Animali, Università di Udine (Ed.). Programma di Cooperazione Interreg V-A Italia-Slovenia 2014–2020, 56p. Available online: https://www.parcoprealpigiulie.it/documents/369/7.Nat2Care_Guida_riconoscimento_specie_2020.pdf (accessed on 12 April 2022).
- Doumith, M.; Buchrieser, C.; Glaser, P.; Jacquet, C.; Martin, P. Differentiation of the major listeria monocytogenes serovars by multiplex PCR. J. Clin. Microbiol. 2004, 42, 3819–3822. [Google Scholar] [CrossRef] [Scilit]
- D’Agostino, M.; Wagner, M.; Vazquez-Boland, J.A.; Kuchta, T.; Karpiskova, R.; Hoorfar, J.; Novella, S.; Scortti, M.; Ellison, J.; Murray, A.; et al. A validated PCR-based method to detect Listeria monocytogenes using raw milk as a food model—Towards an international standard. J. Food Prot. 2004, 67, 1646–1655. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Borucki, M.K.; Call, D.R. Listeria monocytogenes Serotype Identification by PCR. J. Clin. Microbiol. 2003, 41, 5537–5540. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, G.; Clark, C.G.; Taylor, T.M.; Pucknell, C.; Barton, C.; Price, L.; Woodward, D.L.; Rodgers, F.G. Colony multiplex PCR assay for identification and differentiation of Campylobacter jejuni, C. coli, C. lari, C. upsaliensis, and C. fetus subsp. fetus. J. Clin. Microbiol. 2002, 40, 4744–4747. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bottone, E.J. Yersinia enterocolitica: The charisma continues. Clin. Microbiol. Rev. 1997, 10, 257–276. [Google Scholar] [CrossRef]
- Thoerner, P.; Kingombe, C.I.B.; Bögli-Stuber, K.; Bissig-Choisat, B.; Wassenaar, T.M.; Frey, J.; Jemmi, T. PCR detection of virulence genes in Yersinia enterocolitica and Yersinia pseudotuberculosis and investigation of virulence gene distribution. Appl. Environ. Microbiol. 2003, 69, 1810. [Google Scholar] [CrossRef] [Scilit]
- Thisted Lambertz, S.; Danielsson-Tham, M.L. Identification and characterization of pathogenic Yersinia enterocolitica isolates by PCR and Pulsed-Field Gel Electrophoresis. Appl. Environ. Microbiol. 2005, 71, 3674. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bhagat, N.; Virdi, J.S. Distribution of virulence-associated genes in Yersinia enterocolitica biovar 1A correlates with clonal groups and not the source of isolation. FEMS Microbiol. Lett. 2007, 266, 177–183. [Google Scholar] [CrossRef] [Scilit]
- Bhowmick, P.P.; Devegowda, D.; Karunasagar, I. Virulotyping of seafood associated Salmonella enterica subsp. enterica isolated from Southwest coast of India. Res. Artic. Biotechnol. Bioinf. Bioeng 2011, 1, 63–69. [Google Scholar]
- Paton, A.W.; Paton, J.C. Direct detection and characterization of shiga toxigenic Escherichia coli by multiplex PCR for stx1, stx2, eae, ehxA, and saa. J. Clin. Microbiol. 2002, 40, 271–274. [Google Scholar] [CrossRef] [Scilit]
- Hasman, H.; Mevius, D.; Veldman, K.; Olesen, I.; Aarestrup, F.M. β-Lactamases among extended-spectrum β-lactamase (ESBL)-resistant Salmonella from poultry, poultry products and human patients in The Netherlands. J. Antimicrob. Chemother. 2005, 56, 115–121. [Google Scholar] [CrossRef] [Scilit]
- Dahshan, H.; Shahada, F.; Chuma, T.; Moriki, H.; Okamoto, K. Genetic analysis of multidrug-resistant Salmonella enterica serovars Stanley and Typhimurium from cattle. Vet. Microbiol. 2010, 145, 76–83. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Poirel, L.; Walsh, T.R.; Cuvillier, V.; Nordmann, P. Multiplex PCR for detection of acquired carbapenemase genes. Diagn. Microbiol. Infect. Dis. 2011, 70, 119–123. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- CLSI (Clinical and Laboratory Standards Institute). M02-A12—Performance Standards for Antimicrobial Disk Susceptibility Tests, 12th ed.; Approved Standard; CLSI: Wayne, PA, USA, 2015. [Google Scholar]
- EUCAST (The European Committee on Antimicrobial Susceptibility Testing). Breakpoint Tables for Interpretation of MICs and Zone Diameters; Version 14.0; EUCAST: Basel, Switzerland, 2024. [Google Scholar]
- CLSI (Clinical and Laboratory Standards Institute). M100 Performance Standards for Antimicrobial Susceptibility Testing A CLSI Supplement for Global Application, 30th ed.; CLSI supplement M100; CLSI: Wayne, PA, USA, 2020. [Google Scholar]
- Berri, M.; Rekiki, A.; Boumedine, K.S.; Rodolakis, A. Simultaneous differential detection of Chlamydophila abortus, Chlamydophila pecorum and Coxiella burnetii from aborted ruminant’s clinical samples using multiplex PCR. BMC Microbiol. 2009, 9, 130. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moravkova, M.; Hlozek, P.; Beran, V.; Pavlik, I.; Preziuso, S.; Cuteri, V.; Bartos, M. Strategy for the detection and differentiation of Mycobacterium avium species in isolates and heavily infected tissues. Res. Vet. Sci. 2008, 85, 257–264. [Google Scholar] [CrossRef] [Scilit]
- dos Santos, L.S.; Sá, J.C.; dos Santos Ribeiro, D.L.; Chaves, N.P.; da Silva Mol, J.P.; Santos, R.L.; da Paixão, T.A.; de Carvalho Neta, A.V. Detection of Brucella sp. infection through serological, microbiological, and molecular methods applied to buffaloes in Maranhão State, Brazil. Trop. Anim. Health Prod. 2017, 49, 675–679. [Google Scholar] [CrossRef] [Scilit]
- Milutinović, M.; Masuzawa, T.; Tomanović, S.; Radulović, Ž.; Fukui, T.; Okamoto, Y. Borrelia burgdorferi sensu lato, Anaplasma phagocytophilum, Francisella tularensis and their co-infections in host-seeking Ixodes ricinus ticks collected in Serbia. Exp. Appl. Acarol. 2008, 45, 171–183. [Google Scholar] [CrossRef] [Scilit]
- Magiorakos, A.P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, C.G.; Harbarth, S.; Hindler, J.F.; Kahlmeter, G.; Olsson-Liljequist, B.; et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yon, L.; Duff, J.P.; Ågren, E.O.; Erdélyi, K.; Ferroglio, E.; Godfroid, J.; Hars, J.; Hestvik, G.; Horton, D.; Kuiken, T.; et al. Recent changes in infectious diseases in European wildlife. J. Wildl. Dis. 2019, 55, 3–43. [Google Scholar] [CrossRef] [Scilit]
- Pereira, A.C.; Reis, A.C.; Ramos, B.; Cunha, M.V. Animal tuberculosis: Impact of disease heterogeneity in transmission, diagnosis and control. Transbound. Emerg. Dis. 2020, 67, 1828–1846. [Google Scholar] [CrossRef] [Scilit]
- Ebani, V.V.; Guardone, L.; Bertelloni, F.; Perrucci, S.; Poli, A.; Mancianti, F. Survey on the presence of bacterial and parasitic zoonotic agents in the feces of wild birds. Vet. Sci. 2021, 8, 171. [Google Scholar] [CrossRef] [Scilit]
- Yeni, D.K.; Büyük, F.; Ashraf, A.; Shah, M.S.u.D. Tularemia: A re-emerging tick-borne infectious disease. Folia Microbiol. 2021, 66, 1. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kerkhof, P.J.; Peruzy, M.F.; Murru, N.; Houf, K. Wild boars as reservoir for Campylobacter and Arcobacter. Vet. Microbiol. 2022, 270, 109462. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Celina, S.S.; Cerný, J. Coxiella burnetii in ticks, livestock, pets and wildlife: A mini-review. Front. Vet. Sci. 2022, 9, 1068129. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gambi, L.; Ravaioli, V.; Rossini, R.; Tranquillo, V.; Boscarino, A.; Mattei, S.; D’incau, M.; Tosi, G.; Fiorentini, L.; Donato, A. Di Prevalence of Different Salmonella enterica Subspecies and Serotypes in Wild Carnivores in Emilia-Romagna Region, Italy. Animals 2022, 12, 3368. [Google Scholar] [CrossRef] [Scilit]
- Mínguez-González, O.; Gutiérrez-Martín, C.B.; del Carmen Martínez-Nistal, M.; del Rosario Esquivel-García, M.; Gómez-Campillo, J.I.; Collazos-Martínez, J.Á.; Fernández-Calle, L.M.; Ruiz-Sopeña, C.; Tamames-Gómez, S.; Martínez-Martínez, S.; et al. Tularemia outbreaks in Spain from 2007 to 2020 in humans and domestic and wild animals. Pathogens 2021, 10, 892. [Google Scholar] [CrossRef] [Scilit]
- Kosoy, M.; Goodrich, I. Comparative ecology of Bartonella and Brucella infections in wild carnivores. Front. Vet. Sci. 2018, 5, 322. [Google Scholar] [CrossRef] [Scilit]
- Lutze-Wallace, C.; Berlie-Surujballi, G.; Barbeau, Y.; Bergeson, D. Strain typing of Mycobacterium bovis from a 1978 case of tuberculosis in a wolf (Canis lupis) from Manitoba. Can. Vet. J. 2005, 46, 502. [Google Scholar]
- Orłowska, B.; Augustynowicz-Kopeć, E.; Krajewska, M.; Zabost, A.; Welz, M.; Kaczor, S.; Anusz, K. Mycobacterium caprae transmission to free-living grey wolves (Canis lupus) in the Bieszczady Mountains in Southern Poland. Eur. J. Wildl. Res. 2017, 63, 1–5. [Google Scholar] [CrossRef] [Scilit]
- EFSA (European Food Safety Authority); ECDC (European Centre for Disease Prevention and Control). The European Union One Health 2021 Zoonoses Report. EFSA J. 2022, 20, 273. [Google Scholar]
- Schoder, D.; Guldimann, C.; Märtlbauer, E. Asymptomatic carriage of Listeria monocytogenes by animals and humans and its impact on the food chain. Foods 2022, 11, 3472. [Google Scholar] [CrossRef] [Scilit]
- Bagatella, S.; Tavares-Gomes, L.; Oevermann, A. Listeria monocytogenes at the interface between ruminants and humans: A comparative pathology and pathogenesis review. Vet. Pathol. 2022, 59, 186–210. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Joutsen, S.; Laukkanen-Ninios, R.; Henttonen, H.; Niemimaa, J.; Voutilainen, L.; Kallio, E.R.; Helle, H.; Korkeala, H.; Fredriksson-Ahomaa, M. Yersinia spp. in wild rodents and shrews in Finland. Vector-Borne Zoonotic Dis. 2017, 17, 303–311. [Google Scholar] [CrossRef] [Scilit]
- Syczyło, K.; Platt-Samoraj, A.; Bancerz-Kisiel, A.; Szczerba-Turek, A.; Pajdak-Czaus, J.; Łabuć, S.; Procajło, Z.; Socha, P.; Chuzhebayeva, G.; Szweda, W. The prevalence of Yersinia enterocolitica in game animals in Poland. PLoS ONE 2018, 13, e0195136. [Google Scholar] [CrossRef] [Scilit]
- Platt-Samoraj, A.; Zmudzki, J.; Pajdak-Czaus, J.; Szczerba-Turek, A.; Bancerz-Kisiel, A.; Procajło, Z.; Łabuć, S.; Szweda, W. The prevalence of Yersinia enterocolitica and Yersinia pseudotuberculosis in small wild rodents in Poland. Vector-Borne Zoonotic Dis. 2020, 20, 586–592. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Modesto, P.; De Ciucis, C.G.; Vencia, W.; Pugliano, M.C.; Mignone, W.; Berio, E.; Masotti, C.; Ercolini, C.; Serracca, L.; Andreoli, T.; et al. Evidence of antimicrobial resistance and presence of pathogenicity genes in Yersinia enterocolitica isolate from wild boars. Pathogens 2021, 10, 398. [Google Scholar] [CrossRef] [Scilit]
- Carella, E.; Romano, A.; Domenis, L.; Robetto, S.; Spedicato, R.; Guidetti, C.; Pitti, M.; Orusa, R. Characterisation of Yersinia enterocolitica strains isolated from wildlife in the Northwestern Italian Alps. J. Vet. Res. 2022, 66, 141. [Google Scholar] [CrossRef] [Scilit]
- Roulová, N.; Moťková, P.; Brožková, I.; Brzezinska, M.S.; Pejchalová, M. Detection, characterization, and antimicrobial susceptibility of Yersinia enterocolitica in different types of wastewater in the Czech Republic. J. Appl. Microbiol. 2022, 133, 2255–2266. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Platt-Samoraj, A. Toxigenic properties of Yersinia enterocolitica Biotype 1A. Toxins 2022, 14, 118. [Google Scholar] [CrossRef] [Scilit]
- Sulakvelidze, A. Yersiniae other than Y.enterocolitica, Y. pseudotuberculosis, and Y. pestis: The ignored species. Microbes Infect. 2000, 2, 497–513. [Google Scholar] [CrossRef] [Scilit]
- Alonso, C.A.; Mora, A.; Díaz, D.; Blanco, M.; González-Barrio, D.; Ruiz-Fons, F.; Simón, C.; Blanco, J.; Torres, C. Occurrence and characterization of stx and/or eae-positive Escherichia coli isolated from wildlife, including a typical EPEC strain from a wild boar. Vet. Microbiol. 2017, 207, 69–73. [Google Scholar] [CrossRef] [Scilit]
- Persad, A.K.; Lejeune, J.T. Animal Reservoirs of Shiga Toxin-Producing Escherichia coli. In Enterohemorrhagic Escherichia coli and Other Shiga Toxin-Producing E. coli; American Society of Microbiology: Washington, DC, USA, 2014; pp. 231–244. [Google Scholar]
- Dias, D.; Caetano, T.; Torres, R.T.; Fonseca, C.; Mendo, S. Shiga toxin-producing Escherichia coli in wild ungulates. Sci. Total Environ. 2019, 651, 203–209. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bertelloni, F.; Lunardo, E.; Rocchigiani, G.; Ceccherelli, R.; Ebani, V. Occurrence of Escherichia coli virulence genes in feces of wild birds from Central Italy. Asian Pac. J. Trop. Med. 2019, 12, 142–146. [Google Scholar]
- Espinoza, V.; Valdez, M.; Burcovschii, S.; Fong, I.; Petersen, G.; Heidari, A. The First Case Report of Endocarditis Caused by Serratia fonticola. J. Investig. Med. High Impact Case Rep. 2021, 9, 23247096211044916. [Google Scholar] [CrossRef] [Scilit]
- Fuentes-Castillo, D.; Power, P.; Cerdeira, L.; Cardenas-Arias, A.; Moura, Q.; Oliveira, F.A.; Levy, C.E.; Gutkind, G.; Catão-Dias, J.L.; Lincopan, N. FONA-7, a novel Extended-Spectrum β-Lactamase variant of the FONA family identified in Serratia fonticola. Microb. Drug Resist. 2021, 27, 585–589. [Google Scholar] [CrossRef] [Scilit]
- Tanimoto, K.; Nomura, T.; Hashimoto, Y.; Hirakawa, H.; Watanabe, H.; Tomita, H. Isolation of Serratia fonticola Producing FONA, a Minor Extended-Spectrum β-Lactamase (ESBL), from Imported Chicken Meat in Japan. Jpn. J. Infect. Dis. 2021, 74, 79–81. [Google Scholar] [CrossRef] [Scilit]
- EFSA, (European Food Safety Authority); ECDC, (European Centre for Disease Prevention and Control) The European Union Summary Report on Antimicrobial Resistance in zoonotic and indicator bacteria from humans, animals and food in 2019–2020. EFSA J. 2022, 20, e07209.
- Rubin, J.E.; Pitout, J.D.D. Extended-spectrum β-lactamase, carbapenemase and AmpC producing Enterobacteriaceae in companion animals. Vet. Microbiol. 2014, 170, 10–18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- EFSA BIOHAZ Panel (EFSA Panel on Biological Hazards). Scientific Opinion on the public health risks of bacterial strains producing extended-spectrum β-lactamases and/or AmpC β-lactamases in food and food-producing animals. EFSA J. 2011, 9, 2322. [Google Scholar] [CrossRef] [Scilit]
- EFSA BIOHAZ Panel (EFSA Panel on Biological Hazards). Scientific Opinion on Carbapenem resistance in food animal ecosystems. EFSA J. 2013, 11, 3501. [Google Scholar]
- Darwich, L.; Vidal, A.; Seminati, C.; Albamonte, A.; Casado, A.; López, F.; Molina-López, R.A.; Migura-Garcia, L. High prevalence and diversity of extended-spectrum β-lactamase and emergence of OXA-48 producing Enterobacterales in wildlife in Catalonia. PLoS ONE 2019, 14, e0210686. [Google Scholar] [CrossRef] [Scilit]
- Köck, R.; Daniels-Haardt, I.; Becker, K.; Mellmann, A.; Friedrich, A.W.; Mevius, D.; Schwarz, S.; Jurke, A. Carbapenem-resistant Enterobacteriaceae in wildlife, food-producing, and companion animals: A systematic review. Clin. Microbiol. Infect. 2018, 24, 1241–1250. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Matakone, M.; Founou, R.C.; Founou, L.L.; Dimani, B.D.; Koudoum, P.L.; Fonkoua, M.C.; Boum-II, Y.; Gonsu, H.; Noubom, M. Multi-drug resistant (MDR) and extended-spectrum β-lactamase (ESBL) producing Escherichia coli isolated from slaughtered pigs and slaughterhouse workers in Yaoundé, Cameroon. One Health 2024, 19, 100885. [Google Scholar] [CrossRef] [Scilit] [PubMed]
| Application | Gene | Primers | Sequences | Amplicons (bp) | Annealing Temperature °C | Ref. |
|---|---|---|---|---|---|---|
| Listeria monocytogenes confirmation and typing | prs | PRS_1 | GCTGAAGAGATTGCGAAAGAAG | 370 | 53 | [34] |
| PRS_2 | CAAAGAAACCTTGGATTTGCGG | |||||
| prfA | LIP1 | GATACAGAAACATCGGTTGGC | 274 | 53 | [35] | |
| LIP2a | GTGTAATCTTGATGCCATCAGG | |||||
| lmo0737 | LMO0737_1 | AGGGCTTCAAGGACTTACCC | 691 | 53 | [34] | |
| LMO0737_2 | ACGATTTCTGCTTGCCATTC | |||||
| lmo1118 | LMO1118_1 | AGGGGTCTTAAATCCTGGA | 906 | |||
| LMO1118_2 | CGGCTTGTTCGGCATACTTA | |||||
| ORF2819 | ORF2819_1 | AGCAAAATGCCAAAACTCGT | 471 | |||
| ORF2819_2 | CATCACTAAAGCCTCCCATTG | |||||
| ORF2110 | ORF2110_1 | AGTGGACAATTGATTGGTGAA | 597 | |||
| ORF2110_2 | CATCCATCCCTTACTTTGGAC | |||||
| flaA | FlaA-F | TTACTAGATCAAACTGCTCC | 538 | 61 | [36] | |
| FlaA-R | AAGAAAAGCCCCTCGTCC | |||||
| Campylobacter spp. confirmation | 23S rRNA | 23SF | TATACCGGTAAGGAGTGCTGGAG | 650 | 59 | [37] |
| 23SR | ATCAATTAACCTTCGAGCACCG | |||||
| Yersinia enterocolitica virulence genes detection | ail | 9A | GTTTATCAATTGCGTCTGTTAATGTGTACG | 454 | 60 | [40] |
| 10A | CTATCGAGTTTGGAGTATTCATATGAAGCG | |||||
| virF | 11A | AAGGTTGTTGAGCATTCACAAGATGG | 700 | |||
| 12A | TTTGAGTGAAATAAGACTGACTCGAGAACC | |||||
| inv | invF | TGCCTTGGTATGACTCTGCTTCA | 1114 | 63 | [41] | |
| invR | AGCGCACCATTACTGGTGGTTAT | |||||
| ystA | ystAF | ATCGACACCAATAACCGCTGAG | 79 | 61 | [39] | |
| ystAR | CCAATCACTACTGACTTCGGCT | |||||
| ystB | ystBF | GTACATTAGGCCAAGAGACG | 146 | |||
| ystBR | GCAACATACCTCACAACACC | |||||
| Salmonella spp. confirmation | invA | invAF | GTTGTACCGTGGCATGTCTG | 930 | 50 | [42] |
| invAR | GCCATGGTATGGATTTGTCC | |||||
| Shiga Toxin-Producing Escherichia coli (STEC) detection | stx1 | stx1F | ATAAATCGCCATTCGTTGACTAC | 180 | 60 | [43] |
| stx1R | GAACGCCCACTGAGATCATC | |||||
| stx2 | stx2F | GGCACTGTCTGAAACTGCTCC | 255 | |||
| stx2R | TCGCCAGTTATCTGACATTCTG | |||||
| Extended Spectrum β-Lactamase genes detection | blaTEM | blaTEMF | GCACGAGTGGGTTACATCGA | 310 | 60 | [45] |
| blaTEMR | GGTCCTCCGATCGTTGTCAG | |||||
| blaSHV | SHV-F | TTCGCCTGTGTATTATCTCCCTG | 854 | 50 | [44] | |
| SHV-R | TTAGCGTTGCCAGTGYTCG | |||||
| blaCTX-M | CTX-F | ATGTGCAGYACCAGTAARGTKATGGC | 593 | 60 | ||
| CTX-R | TGGGTRAARTARGTSACCAGAAYCAGCGG | |||||
| Carbapenemase genes detection | blaNDM | NDM-F | GGTTTGGCGATCTGGTTTTC | 621 | 52 | [46] |
| NDM-R | CGGAATGGCTCATCACGATC | |||||
| blaKPC | KPC-F | CGTCTAGTTCTGCTGTCTTG | 798 | |||
| KPC-R | CTTGTCATCCTTGTTAGGCG | |||||
| blaOXA-48 | OXA-F | GCGTGGTTAAGGATGAACAC | 438 | |||
| OXA-R | CATCAAGTTCAACCCAACCG | |||||
| blaIMP | IMP-F | GGAATAGAGTGGCTTAAYTCTC | 232 | |||
| IMP-R | GGTTTAAYAAAACAACCACC | |||||
| blaVIM | VIM-F | GATGGTGTTTGGTCGCATA | 390 | |||
| VIM-R | CGAATGCGCAGCACCAG |
| Pathogen | Gene | Primers | Sequences | Amplicons (bp) | Annealing Temperature °C | Ref. |
|---|---|---|---|---|---|---|
| Coxiella burnetii | IS1111 | Trans-1 | TATGTATCCACCGTAGCCAGT | 687 | 64 | [50] |
| Trans-2 | CCCAACAACACCTCCTTATTC | |||||
| Mycobacterium spp. | 16SrDNA | MycogenF | AGAGTTTGATCCTGGCTCAG | 1030 | 62 | [51] |
| MycogenR | TGCACACAGGCCACAAGGGA | |||||
| Brucella spp. | bcsp31 | B4 | TGGCTCGGTTGCCAATATCAA | 223 | 60 | [52] |
| B5 | CGCGCTTGCCTTTCAAGGTCTG | |||||
| Francisella tularensis | TUL4 | TUL4–435 | TCGAAGACGATCAGATACCGTCG | 400 | 55 | [53] |
| TUL4–863 | TGCCTTAAACTTCCTTGCGAT |
| Sample Number | Listeria monocytogenes | Campylobacter spp. | Yersinia spp. | Salmonella spp. | STEC | ESBL | CRE | Coxiella burnetii | Mycobacterium spp. | Brucella spp. | Francisella tularensis |
|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | + | − | + | − | − | − | − | − | − | − | − |
| 2 | − | − | + | − | − | − | − | − | − | − | − |
| 3 | − | − | − | − | − | − | − | − | − | − | − |
| 4 | − | − | − | − | − | − | − | − | − | − | − |
| 5 | − | − | − | − | − | − | − | − | − | − | − |
| 6 | − | − | + | − | − | − | − | − | − | − | − |
| 7 | − | − | + | − | − | − | − | − | − | − | − |
| 8 | − | − | − | − | − | − | − | − | − | − | − |
| 9 | − | − | − | − | − | − | − | − | − | − | − |
| 10 | − | − | − | − | − | − | − | − | − | − | − |
| 11 | − | − | − | − | − | − | − | − | − | − | − |
| 12 | − | − | − | − | + | − | − | − | − | − | − |
| 13 | − | − | − | − | − | + | − | − | − | − | − |
| 14 | − | − | − | − | − | − | − | − | − | − | − |
| 15 | − | − | − | − | − | − | − | − | − | − | − |
| 16 | − | − | − | − | − | + | − | − | − | − | − |
| Total | 1 | 0 | 4 | 0 | 1 | 2 | 0 | 0 | 0 | 0 | 0 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bertelloni, F.; Cagnoli, G.; Ebani, V.V. Survey on the Occurrence of Zoonotic Bacterial Pathogens in the Feces of Wolves (Canis lupus italicus) Collected in a Protected Area in Central Italy. Microorganisms 2024, 12, 2367. https://doi.org/10.3390/microorganisms12112367
Bertelloni F, Cagnoli G, Ebani VV. Survey on the Occurrence of Zoonotic Bacterial Pathogens in the Feces of Wolves (Canis lupus italicus) Collected in a Protected Area in Central Italy. Microorganisms. 2024; 12(11):2367. https://doi.org/10.3390/microorganisms12112367
Chicago/Turabian StyleBertelloni, Fabrizio, Giulia Cagnoli, and Valentina Virginia Ebani. 2024. "Survey on the Occurrence of Zoonotic Bacterial Pathogens in the Feces of Wolves (Canis lupus italicus) Collected in a Protected Area in Central Italy" Microorganisms 12, no. 11: 2367. https://doi.org/10.3390/microorganisms12112367
APA StyleBertelloni, F., Cagnoli, G., & Ebani, V. V. (2024). Survey on the Occurrence of Zoonotic Bacterial Pathogens in the Feces of Wolves (Canis lupus italicus) Collected in a Protected Area in Central Italy. Microorganisms, 12(11), 2367. https://doi.org/10.3390/microorganisms12112367

