Next Article in Journal
Eukaryotic Microalgae Communities from Tropical Karstic Freshwater Lagoons in an Anthropic Disturbance Gradient Microscopic and Metagenomic Analysis
Next Article in Special Issue
Antimicrobial Resistance Genes and Clonal Relationships of Duck-Derived Salmonella in Shandong Province, China in 2023
Previous Article in Journal
Recombinant SAG2A Protein from Toxoplasma gondii Modulates Immune Profile and Induces Metabolic Changes Associated with Reduced Tachyzoite Infection in Peritoneal Exudate Cells from Susceptible C57BL/6 Mice
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Survey on the Occurrence of Zoonotic Bacterial Pathogens in the Feces of Wolves (Canis lupus italicus) Collected in a Protected Area in Central Italy

by
Fabrizio Bertelloni
1,
Giulia Cagnoli
1 and
Valentina Virginia Ebani
1,2,*
1
Department of Veterinary Science, University of Pisa, Viale delle Piagge 2, 56124 Pisa, Italy
2
Centre for Climate Change Impact, University of Pisa, 56124 Pisa, Italy
*
Author to whom correspondence should be addressed.
Microorganisms 2024, 12(11), 2367; https://doi.org/10.3390/microorganisms12112367
Submission received: 6 November 2024 / Revised: 13 November 2024 / Accepted: 18 November 2024 / Published: 20 November 2024
(This article belongs to the Special Issue Advances in Veterinary Microbiology)

Abstract

Previous investigations have explored the involvement of wolves in parasitic and viral diseases, but data on the zoonotic bacteria are limited. The aim of this study was to assess the occurrence of bacterial zoonotic agents in 16 wolf (Canis lupus italicus) fecal samples collected in a protected area in Central Italy. Campylobacter spp., Salmonella spp., Yersinia spp., Listeria monocytogenes, and Shiga Toxin-Producing Escherichia coli (STEC) were investigated by culture, while polymerase chain reaction (PCR) was employed to detect Coxiella burnetii, Mycobacterium spp., Brucella spp., and Francisella tularensis. The presence of Extended Spectrum β-Lactamase (ESBL)- and carbapenemase-producing Enterobacteriaceae was also evaluated, using selective isolation media and detection of antimicrobial resistance genes. All samples were negative for Campylobacter spp., Salmonella spp., C. burnetii, Mycobacterium spp., Brucella spp., F. tularensis, and carbapenemase-producing Enterobacteriaceae. One sample tested positive for Yersinia aldovae and three for Yersinia enterocolitica BT1A. One L. monocytogenes (serogroup IIa) and one STEC, carrying the stx1 gene, were isolated. Two ESBL isolates were detected: one Serratia fonticola, carrying blaFONA-3/6 gene, and one Escherichia coli, carrying blaCTX-M-1 gene. Both ESBL isolates were resistant to different antimicrobials and therefore classified as multi-drug-resistant. Our data suggest that wolves are potential carriers of zoonotic bacteria and may contribute to the environmental contamination through their feces.

1. Introduction

The wolf (Canis lupus) is an adaptable wild animal species, distributed in many parts of the world [1]. It was the first domesticated species, but over the centuries, wolves have posed a constant problem for human populations [2]. In Western Europe, in particular in Central Italy and Spain, by the 1970s, only few individuals survived [3]. Since then, conservation and reintroduction programs have been established, leading to a constant growth in the wolf population [4]. Recent data show the wide spread of this species in many parts of Italy, with recolonization of several habitats [4]. Currently, the Italian wolf (Canis lupus italicus) is a protected species in Italy [5], with an estimated population of about 3300 individuals [6].
Wolves are generalist apex predators, mainly preying on wild ungulates [7]; therefore, it is plausible that wolves could be exposed to various pathogens and undergo an accumulation process [8,9,10]. Many recent studies conducted in Italy support this hypothesis. In particular, most of these surveys were focused on parasites [8,11,12,13,14,15,16,17,18,19,20] and viral agents [12,21,22,23,24,25,26,27,28].
Conversely, only few studies have been carried out to investigate the presence of bacterial pathogens in the feces of these animals [29,30,31]. Wolves’ feces may contaminate the environment and become sources of pathogens for other animals contributing to the amplification of the epidemiological scenario of given agents. This amplification can become a public health issue considering that most of them may cause zoonoses.
In view of the scarce data on bacterial infections in wolves, the aim of the present survey was to investigate the occurrence of the most important zoonotic bacterial pathogens in feces, collected from the environment, of wolves living in a national park located in Central Italy. For this purpose, Listeria monocytogenes, Campylobacter spp., Salmonella spp., Yersinia spp., Shiga Toxin-Producing Escherichia coli (STEC), Extended Spectrum β-Lactamase (ESBL)-producing and carbapenemase-producing Enterobacteriaceae were investigated using traditional bacteriological examinations. In addition, presence of Coxiella burnetii, Mycobacterium spp., Brucella spp., and Francisella tularensis was assessed by molecular investigations.

2. Materials and Methods

2.1. Study Area

The study was conducted in the Foreste Casentinesi National Park, located in the Northern Italian Apennines, between the Tuscany and Emilia-Romagna regions, and covering an area of about 36,000 hectares of woodland. The park is the home of many animal species, such as wild ungulates, small mammals, wild birds, amphibians, and reptiles. About 100 wolves have been estimated to be present throughout the park [32]. The park is a protected area with decreased anthropic pressure. However, medium-size towns and small villages are present, as well as some extensive or semi-extensive breeding of small ruminants, bovine, and swine. The park is frequently visited by tourists for recreational activities.

2.2. Sampling

Samples were collected for 14 consecutive days in April 2022. Only intact feces (with an evident mucous layer on the surface, still soft, not covered with dust and/or molds), identified as wolf scat on the basis of their shape, size, and smell [33], were taken; about 10–50 g of feces was collected in sterile 300 mL jars and stored in refrigerated condition. The samples were sent to the Laboratory of Infectious Diseases of the Department of Veterinary Science, University of Pisa, and analyzed within 24 h from sampling. Since the collected samples could not be attributed to known animals, it cannot be excluded that they came from the same wolves.

2.3. Bacteriological Analyses

Each fecal sample was divided into five smaller portions, in a biosafety cabinet and using sterile instruments. Each aliquot contained approximately from 1 to 10 g of feces, depending on the total available amount of the samples. Four aliquots were used for enrichment cultures to isolate specific pathogens, namely L. monocytogenes, Campylobacter spp., Yersinia spp., Salmonella spp., Shiga Toxin-Producing Escherichia coli (STEC), Extended Spectrum β-Lactamase (ESBL)-producing and carbapenemase-producing Enterobacteriaceae. All obtained isolates were stored at −80 °C in Brain Heart Infusion (BHI, Oxoid Ltd., Basingstoke, UK) by the addition of 20% glycerol as cryoprotectant for successive analyses.
The remaining aliquot was used in molecular investigations to detect Coxiella burnetii, Mycobacterium spp., Brucella spp., and Francisella tularensis.
All polymerase chain reaction (PCR) assays described below were performed using the EconoTaq PLUS 2x Master Mix (Lucigen Corporation, Middleton, WI, USA) and the automated thermal cycler SimpliAmp™ Thermal Cycler (Applied Biosystems, Waltham, MA, USA). The PCR products were analyzed by electrophoresis on 1.5% agarose gel stained with Ethidium bromide. A 100 bp DNA Ladder Ready to Load (Solis BioDyne, Tartu, Estonia) was used as a DNA marker.

2.3.1. Bacteriological Cultures

Listeria monocytogenes

Feces were diluted 1:10 in ONE Broth-Listeria (Oxoid Ltd.) and, after mixing by stomacher, incubated at 30 °C for 24 h. Then, one loopful from each culture was stretched on Agar Listeria Ottaviani Agosti (ALOA) (Biolife, Milan, Italy) and incubated at 37 °C for 48 h. Suspected colonies were subcultured on Tryptic Soy Agar (TSA) (Biolife) and initially confirmed as Listeria spp. and suspected L. monocytogenes by Gram staining, catalase, oxidase, CAMP test with Staphylococcus aureus (ATCC 25923) and Rhodococcus equi (ATCC 6939), and acid production from mannitol, rhamnose and xylose. After DNA extraction from an overnight culture using a commercial kit, DNA Plus Kits (Zymo Research, Irvine, CA, USA) and following the manufacturer’s instructions, presumptive L. monocytogenes isolates were confirmed by PCR assays searching for the genes prs and prfA, as previously described [34,35]. Moreover, PCR assays were carried out to type the obtained L. monocytogenes isolate, searching for the genes lmo1118, ORF2819, ORF2110, and flaA that allow to identify the serogroup [34,36].

Campylobacter spp.

Feces were diluted 1:10 in Bolton Selective Enrichment Broth (Bolton Broth, plus Bolton Broth Selective Supplement and Laked Horse Blood) (Oxoid Ltd.), mixed by stomacher and incubated in microaerobic environment (5% oxygen, 10% CO2), for 4 h at 37 °C, and subsequently for 44 h at 42 °C. Then, one loopful was subcultured on Campylobacter Blood-Free Selective Medium (formally “modified Charcoal Cefoperazone Deoxycholate Agar, mCCDA) (Oxoid Ltd.) and incubated for 48 h at 42 °C in microaerobic environment (5% oxygen, 10% CO2). Specific PCR targeting the gene 23SrRNA was carried out to confirm the genus Campylobacter for suspected colonies [37].

Yersinia spp.

Feces were diluted 1:10 in Peptone Sorbitol Bile (PSB) broth (Biolife), mixed by stomacher and incubated at 4 °C for 21 days. Subsequently, one loopful from each sample was stretched on Cefsulodin Irgasan Novobiocin (CIN) agar (Biolife) and incubated at 30 °C for 24 h. Suspected colonies were screened with Triple Sugar Iron (TSI) agar (Biolife) and for urease activity with Urea Broth (Oxoid Ltd.); Yersinia species were identified with API20E (Biomerieux, Marcy l’Etoile, France). Yersinia enterocolitica isolates were successively characterized on the basis of biochemical tests to distinguish the biotype, as previously described [38]. The isolates were analyzed with singular PCR assays to detect the following virulence genes: ail, virF, ystA, ystB and inv. DNA analyzed in PCR was extracted from overnight culture with a commercial kit, DNA Plus Kits (Zymo Research, Irvine, CA, USA), following manufacturer’s instructions; primers and PCR protocols previously reported by other authors were adopted [39,40,41].

Salmonella spp.

Feces were diluted 1:10 in Buffered Peptone Water (BPW) (Biolife) and, after mixing by stomacher, incubated at 37 °C for 24 h. Subsequently, 1 and 0.1 mL from BPW were subcultured in Selenite Broth (Biolife) and Rappaport Vassiliadis Broth (Biolife), respectively; Selenite Broth was incubated at 37 °C for 24 h, whereas Rappaport Vassiliadis Broth was incubated at 41.5 °C for 24 h. After incubation, 1 loopful from each broth was cultured on both Salmonella Shigella (SS) agar (Biolife) and Brilliant Green Agar (BGA) (Biolife) and incubated at 37 °C for 24 h. Suspected colonies were evaluated with conventional biochemical tests (TSI, urease, o-nitrofenil-β-D-galattopiranoside (ONPG), indole, Voges-Proskauer (VP), Lisyne decarboxylases and malonate) and confirmed as Salmonella spp. by PCR detection of invA gene [42].

Shiga Toxin-Producing Escherichia coli (STEC)

One loopful from BPW, after incubation, was cultured on Tryptone Bile X-glucuronide (TBX) agar (Biolife) and incubated at 42 °C for 24 h. Three distinct colonies were selected and subcultured on Tryptone Soy Agar (TSA) (Biolife) to be confirmed as E. coli by Api20E (Biomerieux). Identified isolates were tested for the presence of the genes stx1 and stx2, coding Shiga-toxin 1 and Shiga-toxin 2, respectively, with PCR, using primers and protocol previously described [43].

Extended Spectrum β-Lactamase- and Carbapenemase-Producing Enterobacteriaceae

After incubation in BPW as previously described, one loopful from each sample was stretched on both ChromArt ESBL AGAR (Biolife) and ChromArt CRE AGAR (Biolife); both media were incubated at 37 °C for 48 h. From each medium, 1 to 3 colonies different in color, size and morphology were subcultured on Violet Red Bile Glucose Agar (VRBGA) (Biolife), and glucose fermenting isolates were tested for oxidase production. Oxidase negative isolates were further identified at species level with API20E (Biomeriux).
Enterobacteriaceae isolated on ChromArt ESBL AGAR were tested for the presence of the antimicrobial resistance genes blaTEM, blaSHV, blaCTX-M, whereas Enterobacteriaceae isolated on ChromArt CRE AGAR were tested to detect the antimicrobial resistance genes blaNDM, blaKPC, blaOXA-48, blaIMP, blaVIM. After DNA extraction from overnight cultures using the commercial kit, DNA Plus Kits (Zymo Research, Irvine, CA, USA), PCR assays were carried out using primers and protocols previously described by other authors [44,45,46].
The positive PCR products were sequenced (BMR Genomics, Padova, Italy), and the obtained sequences were compared with a gene bank database using Basic Local Alignment Search Tool (BLAST) and FASTA (https://www.ebi.ac.uk/Tools/sss/fasta/, accessed on 30 September 2023).
All primers and conditions of the PCR assays employed to characterize the bacterial isolates are reported in Table 1.

2.3.2. Antimicrobial Susceptibility Test

All obtained bacterial isolates were submitted to the disc diffusion test to evaluate their antimicrobial susceptibility, following the line guide by Clinical Laboratory Standard Institute (CLSI) [47]. The following antimicrobials (Oxoid) were tested for L. monocytogenes: ampicillin (2 μg), meropenem (10 μg), erythromycin (5 μg), and trimethoprim-sulfamethoxazole (1.25/23.75 μg); the results were interpreted according to European Committee on Antimicrobial Susceptibility Testing (EUCAST) [48]. The isolates belonging to Enterobacteriaceae were tested with the following antimicrobials (Oxoid): ampicillin (10 μg), amoxicillin-clavulonate (20/10 μg), cefoxitin (30 μg), cefotaxime (30 μg), ceftiofur (30 μg), imipenem (10 μg), ertapenem (10 μg), aztreonam (30 μg), chloramphenicol (30 μg), tetracycline (30 μg), enrofloxacin (5 μg), ciprofloxacin (5 μg), gentamicin (10 μg), amikacin (30 μg), and trimethoprim-sulfamethoxazole (1.25/23.75 μg); the results were read according to CLSI [49]. Yersinia spp. isolates were tested with the same antimicrobials used for Enterobacteriaceae but not against ampicillin and amoxicillin-clavulonate, due to their intrinsic resistance.

2.3.3. Molecular Detection of Pathogens

DNA was extracted from approximately 150 mg of each fecal sample using a commercial kit, Quick-DNA Fecal/Soil Microbe Miniprep Kit (Zymo Research, Irvine, CA, USA), following the manufacturer’s instructions, and stored at −20 °C.
To detect a 687 bp portion of the gene IS1111a of C. burnetii, the primers Trans-1 and Trans-2, along with the protocol proposed by Berri et al. [50], were utilized.
The presence of bacteria belonging to the Mycobacterium genus was assessed using the primers MycogenF and MycogenR, which allowed for the amplification of 1030 bp portion of the 16SrDNA [51].
In order to detect Brucella spp. DNA, a PCR with the primers B4 and B5, targeting a 223 bp fragment of the gene bcsp31 was performed [52].
Lastly, the presence of F. tularensis was evaluated using the primers TUL4–435 and TUL4–863, which allowed the amplification of a 400 bp fragment of the gene TUL4 [53].
Primers and PCR conditions of the employed protocols are reported in Table 2.

3. Results

A total of 16 distinct wolf fecal samples were collected and analyzed. Of these, 7 (43.75%; 95% CI: 19.44.00–68.06%) samples were positive for at least one of the investigated bacteria, and among them, 1/16 (6.25%) sample was positive to two different pathogens (L. monocytogenes and Y. enterocolitica) (Table 3).
No samples were positive for Salmonella spp., Campylobacter spp., and carbapenemases-producing Enterobacteriaceae. One strain of L. monocytogenes was isolated (sample 1), and the subsequent molecular characterization revealed that it belonged to the IIa serogroup having the genes lmo0737 and flaA.
Four Yersinia spp. isolates were obtained: one Yersinia aldovae (sample 2) and three Yersinia enterocolitica Biotype 1A (samples 1, 6, 7). PCR detected no virulence genes in Y. enterocolitica isolates.
A total of 48 E. coli strains were isolated, three from each fecal sample; among them, one strain (sample 12) tested positive for the gene stx1, categorizing it as belonging to the pathotype STEC.
Listeria monocytogenes and all Yersinia spp. and E. coli isolates were susceptible to the tested antimicrobials.
Two ESBL isolates were detected and characterized. The first isolate (sample 13) was classified as Serratia fonticola, and it tested positive for blaCTX-M. The PCR product showed a 87.37% identity with the blaFONA-3/6 gene. The second isolate (sample 16) was classified as E. coli and tested positive for blaCTX-M. Sequence analyses showed a 100% identity with blaCTX-M-1 gene. The ESBL S. fonticola isolate was resistant to ampicillin and amoxicillin-clavulonate (penicillins class), cefoxitin, cefotaxime, and ceftiofur (cephalosporins class), and aztreonam (monobactams class), whereas the ESBL E. coli strain was resistant to ampicillin (penicillins class), cefoxitin, cefotaxime, and ceftiofur (cephalosporins class), aztreonam (monobactams class), and tetracycline (tetracyclines class). Both isolates can be classified as multi-drug-resistant (MDR) [54].
The DNA of C. burnetii, Mycobacterium spp., Brucella spp., and F. tularensis was not detected in any of the analyzed samples.

4. Discussion

In recent years, there has been a growth in the number of wolves on Italian territory; wolves are increasingly present in forest areas, but not rarely they are sighted even near inhabited centers. Considering the difficulty in collecting biological samples from these animals, the role of wolves in the epidemiology of some pathogens has not been fully elucidated. In particular, studies have been carried out on parasitic and viral agents, but little information on bacterial pathogens has been obtained. Bacteria belonging to different species may be excreted in feces becoming responsible for environmental contamination. Wolf feces on forest areas’ soil may be a direct source of infection for other animals, such as small mammals, birds, reptiles, amphibians, insects, but also hunting dogs, wild boars, and wild ruminants. In addition, mainly after abundant rainfall, fecal material can run off, amplifying the concern of microbial dissemination.
The present investigation did not detect relevant pathogens, such as Campylobacter spp., Salmonella spp., F. tularensis, C. burnetii, Brucella spp., and Mycobacterium spp. These findings may be attributed to the low circulation of the agents in the sampling area, despite the absence of related studies in the existing literature. Moreover, the fecal shedding of these bacteria usually is discontinuous, mainly in clinically healthy animals, and as other routes of excretion are possible; other biological samples should be investigated. Wild animals can be carriers, usually asymptomatic, of these pathogens [55,56,57,58,59,60], and infections in wolves have been reported for Salmonella spp. [61], F. tularensis [62], Brucella spp. [63], Mycobacterium bovis [64], and Mycobacterium caprae [65].
On the other hand, our investigation found zoonotic bacteria, such as Y. enterocolitica and L. monocytogenes, less investigated in wildlife, but able to infect other animals.
Listeria monocytogenes causes severe human infection characterized by a relevant proportion of hospitalized patients and mortality [66]. Pigs and cattle are the main reservoirs among domestic animals [66,67], but wild animals can harbor the pathogen as well. The role of wildlife in the epidemiological cycle of L. monocytogenes remains a topic of ongoing investigation [67], and there are no data in the available literature regarding the occurrence of L. monocytogenes in wolves. The strain cultured in our survey belongs to the serogroup IIa, which includes serotypes 1/2a and 3a, frequently found in human and animal infections [68].
Yersinia enterocolitica, isolated from 18.75% of the analyzed samples, is confirmed to be present in wildlife, even though non-virulent strains are the most frequently detected [69,70,71,72,73]. There are no available data on wolves as carriers of Yersinia spp. in the literature; therefore, our results cannot be compared to other epidemiological situations. Three isolates of our study were classified as Y. enterocolitica Biotype 1A; this is a non-virulent biotype previously found in wild animals and environment [74]. However, the virulence potential of Y. enterocolitica Biotype 1A was recently re-evaluated, because it has been associated with cases of human infections [41,75]. The isolation of Y. aldovae, species not related to human or animal infections, is not surprising because it is commonly isolated from aquatic ecosystems and soil [76].
The detection of one STEC strain is interesting because, to the best of our knowledge, this is the first report of this pathotype in wolves. STEC are bacteria responsible for severe human diseases, such as hemorrhagic colitis in adults and hemolytic uremic syndrome in children [77]. Bovine are identified as the main reservoirs [78], although wildlife, mammals and birds, have been proven to harbor this E. coli pathotype [77,79,80].
Two strains, one E. coli and one S. fonticola, resulted as ESBL-producing bacteria with blaCTX-M-1 and blaFONA genes, respectively. Gonçalves and colleagues (2012) registered a prevalence of 5.5% ESBL-producing E. coli in fecal samples of Iberian wolves (Canis lupus signatus) in Portugal and detected some relative resistance genes, including the gene blaCTX-M-1, which is known as one of the most commonly detected ESBL genes in Europe [9]. Serratia fonticola is an environmental bacterium rarely associated with human infections [81] and intrinsically resistant to penicillins and cephalosporins due to the presence in the chromosome of the ESBL resistance gene blaFONA [82,83]. The detection of two (12.5%) ESBL-producing Enterobacteriaceae strains in a small number of analyzed samples shows that these bacteria are circulating, as also highlighted by previous studies that found these microorganisms in humans and domestic and wild animals [84,85]. Currently, the spreading of ESBL- and carbapenemase-producing bacteria represent a relevant concern because Extended Spectrum beta-lactams and carbapenems are antimicrobials commonly used in human medicine, mainly for the treatment of highly drug-resistant bacteria [86,87]. No carbapenemase-producing Enterobacteriaceae were detected in the present investigation. This finding is quite in agreement with previous surveys that found low percentage of carbapenem-resistant bacteria in wildlife [88]. Conversely, some studies have reported high rate of detection in wildlife, especially in seagulls (15.9% in Australia and 19.4% in France), and wild boars (0.6–13.4% in Algeria) [89].
Antimicrobial resistance was found only in the two ESBL strains. These isolates were resistant to antimicrobials belonging to different classes, and therefore, they were classified as MDR. This finding showed that a single bacterial strain can harbor resistance to several antimicrobials [90] and suggested that animals, such as wild species, never treated with antibiotics, may acquire resistant bacteria from the environment.

5. Conclusions

The small number of samples that it was possible to collect does not allow for clarification of the role of wolves in the epidemiological cycles of the investigated pathogens. The negative results could be related to the absence of the searched pathogens in the sampling area and do not exclude wolves as susceptible animals. On the other hand, the detection of bacteria, such as L. monocytogenes, Y. enterocolitica, STEC, and ESBL-producing E. coli, suggests that wolves can be infected by them and consequently contribute to their spreading in the environment. Moreover, the detection of MDR bacteria and of bacteria harboring resistance genes showed that these animals may contribute to the antimicrobial resistance issue. The examined fecal samples were collected directly from the ground where wolves had placed them; therefore, the detection of antimicrobial-resistant bacteria highlights the importance of the environmental contamination. In fact, the finding of these zoonotic bacteria does not suggest wolves as a direct source of infection for humans, but shows that the fecal contamination contributes to the dissemination of agents which could indirectly infect people.
The present study, although carried out on a small number of samples, is the first focused on a large number of zoonotic bacterial pathogens; the results are preliminary but suggest, also from a One Health perspective, monitoring wolf populations in order to increase the knowledge about the bacterial circulation in wildlife and their role in the environmental contamination. In addition, metagenomic analyses could be useful to provide unbiased detection of all the pathogenic and nonpathogenic microflora present in the analyzed samples.

Author Contributions

Conceptualization, V.V.E.; formal analysis, F.B.; investigation, F.B. and G.C.; resources, V.V.E.; data curation, F.B. and G.C.; writing—original draft preparation, F.B.; writing—review and editing, F.B. and V.V.E.; supervision, V.V.E. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the University of Pisa, Fondi di Ateneo and grant number PRA_2020_88.

Data Availability Statement

The data presented in this study are available within the article.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Bergström, A.; Stanton, D.W.G.; Taron, U.H.; Frantz, L.; Sinding, M.H.S.; Ersmark, E.; Pfrengle, S.; Cassatt-Johnstone, M.; Lebrasseur, O.; Girdland-Flink, L.; et al. Grey wolf genomic history reveals a dual ancestry of dogs. Nature 2022, 607, 313. [Google Scholar] [CrossRef] [Scilit]
  2. Martin, J.L.; Chamaillé-Jammes, S.; Waller, D.M. Deer, wolves, and people: Costs, benefits and challenges of living together. Biol. Rev. 2020, 95, 782–801. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Fabbri, E.; Miquel, C.; Lucchini, V.; Santini, A.; Caniglia, R.; Duchamp, C.; Weber, J.M.; Lequette, B.; Marucco, F.; Boitani, L.; et al. From the Apennines to the Alps: Colonization genetics of the naturally expanding Italian wolf (Canis lupus) population. Mol. Ecol. 2007, 16, 1661–1671. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Galaverni, M.; Caniglia, R.; Fabbri, E.; Milanesi, P.; Randi, E. One, no one, or one hundred thousand: How many wolves are there currently in Italy? Mammal Res. 2016, 61, 13–24. [Google Scholar] [CrossRef] [Scilit]
  5. Boitani, L. Canis lupus (Europe Assessment) (Errata Version Published in 2019). The IUCN Red List of Threatened Species 2018; p. e.T3746A144226239. Available online: https://www.iucnredlist.org/fr/species/3746/144226239#errata (accessed on 5 November 2024).
  6. La Morgia, V.; Marucco, F.; Aragno, P.; Salvatori, V.; Gervasi, V.; De Angelis, D.; Fabbri, E.; Caniglia, R.; Velli, E.; Avanzinelli, E.; et al. Stima della Distribuzione e Consistenza del lupo a Scala Nazionale 2020/2021. Relazione Tecnica Realizzata Nell’ambito della Convenzione ISPRA-Ministero della Transizione Ecologica “Attività di Monitoraggio Nazionale Nell’ambito del Piano di Azione del lupo”. Available online: https://www.isprambiente.gov.it/it/attivita/biodiversita/monitoraggio-nazionale-del-lupo/link (accessed on 5 November 2024).
  7. Torretta, E.; Caviglia, L.; Serafini, M.; Meriggi, A. Wolf predation on wild ungulates: How slope and habitat cover influence the localization of kill sites. Curr. Zool. 2018, 64, 271. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  8. Perrucci, S.; Maestrini, M.; Coppola, F.; Di Marco, M.; Di Rosso, A.; Pacini, M.I.; Zintu, P.; Felicioli, A. Gray wolf (Canis lupus italicus) and red fox (Vulpes vulpes) parasite survey in anthropized and natural areas of Central Italy. Vet. Sci. 2023, 10, 108. [Google Scholar] [CrossRef] [Scilit]
  9. Gonçalves, A.; Igrejas, G.; Radhouani, H.; Estepa, V.; Pacheco, R.; Monteiro, R.; Brito, F.; Guerra, A.; Petrucci-Fonseca, F.; Torres, C.; et al. Iberian wolf as a reservoir of extended-spectrum β-lactamase-producing Escherichia coli of the TEM, SHV, and CTX-M groups. Microb. Drug Resist. 2012, 18, 215–219. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  10. Vittecoq, M.; Godreuil, S.; Prugnolle, F.; Durand, P.; Brazier, L.; Renaud, N.; Arnal, A.; Aberkane, S.; Jean-Pierre, H.; Gauthier-Clerc, M.; et al. Antimicrobial resistance in wildlife. J. Appl. Ecol. 2016, 53, 519–529. [Google Scholar] [CrossRef] [Scilit]
  11. Paoletti, B.; Iorio, R.; Traversa, D.; Di Francesco, C.E.; Gentile, L.; Angelucci, S.; Amicucci, C.; Bartolini, R.; Marangi, M.; Di Cesare, A. Helminth infections in faecal samples of Apennine wolf (Canis lupus italicus) and Marsican brown bear (Ursus arctos marsicanus) in two protected national parks of central Italy. Ann. Parasitol. 2017, 63, 205–212. [Google Scholar]
  12. Di Francesco, C.E.; Smoglica, C.; Paoletti, B.; Angelucci, S.; Innocenti, M.; Antonucci, A.; Di Domenico, G.; Marsilio, F. Detection of selected pathogens in Apennine wolf (Canis lupus italicus) by a non-invasive GPS-based telemetry sampling of two packs from Majella National Park, Italy. Eur. J. Wildl. Res. 2019, 65, 84. [Google Scholar] [CrossRef] [Scilit]
  13. Badagliacca, P.; Di Sabatino, D.; Salucci, S.; Romeo, G.; Cipriani, M.; Sulli, N.; Dall’Acqua, F.; Ruggieri, M.; Calistri, P.; Morelli, D. The role of the wolf in endemic sylvatic Trichinella britovi infection in the Abruzzi region of Central Italy. Vet. Parasitol. 2016, 231, 124–127. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Ricchiuti, L.; Petrini, A.; Interisano, M.; Ruberto, A.; Salucci, S.; Marino, L.; Del Riccio, A.; Cocco, A.; Badagliacca, P.; Pozio, E. First report of Trichinella pseudospiralis in a wolf (Canis lupus italicus). Int. J. Parasitol. Parasites Wildl. 2021, 15, 195. [Google Scholar] [CrossRef] [Scilit]
  15. Macchioni, F.; Coppola, F.; Furzi, F.; Gabrielli, S.; Baldanti, S.; Boni, C.B.; Felicioli, A. Taeniid cestodes in a wolf pack living in a highly anthropic hilly agro-ecosystem. Parasite 2021, 28, 10. [Google Scholar] [CrossRef] [Scilit]
  16. Tieri, E.E.; Saletti, M.A.; D’Angelo, A.R.; Parisciani, G.; Pelini, S.; Cocco, A.; Di Teodoro, G.; Di Censo, E.; D’Alterio, N.; Latrofa, M.S.; et al. Angiostrongylus vasorum in foxes (Vulpes vulpes) and wolves (Canis lupus italicus) from Abruzzo region, Italy. Int. J. Parasitol. Parasites Wildl. 2021, 15, 184–194. [Google Scholar] [CrossRef] [Scilit]
  17. De Macedo, M.R.P.; Zanet, S.; Bruno, S.; Tolosano, A.; Marucco, F.; Rossi, L.; Muller, G.; Ferroglio, E. Gastrointestinal helminths of wolves (Canis lupus Linnaeus, 1758) in Piedmont, north-western Italy. J. Helminthol. 2020, 94, e88. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  18. Poglayen, G.; Gori, F.; Morandi, B.; Galuppi, R.; Fabbri, E.; Caniglia, R.; Milanesi, P.; Galaverni, M.; Randi, E.; Marchesi, B.; et al. Italian wolves (Canis lupus italicus Altobello, 1921) and molecular detection of taeniids in the Foreste Casentinesi National Park, Northern Italian Apennines. Int. J. Parasitol. Parasites Wildl. 2017, 6, 1. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  19. Massolo, A.; Valli, D.; Wassermann, M.; Cavallero, S.; D’Amelio, S.; Meriggi, A.; Torretta, E.; Serafini, M.; Casulli, A.; Zambon, L.; et al. Unexpected Echinococcus multilocularis infections in shepherd dogs and wolves in south-western Italian Alps: A new endemic area? Int. J. Parasitol. Parasites Wildl. 2018, 7, 309. [Google Scholar] [CrossRef] [Scilit]
  20. Crotti, S.; Spina, S.; Cruciani, D.; Bonelli, P.; Felici, A.; Gavaudan, S.; Gobbi, M.; Morandi, F.; Piseddu, T.; Torricelli, M.; et al. Tapeworms detected in wolf populations in Central Italy (Umbria and Marche regions): A long-term study. Int. J. Parasitol. Parasites Wildl. 2023, 21, 11–16. [Google Scholar] [CrossRef] [Scilit]
  21. Ndiana, L.A.; Lanave, G.; Desario, C.; Berjaoui, S.; Alfano, F.; Puglia, I.; Fusco, G.; Colaianni, M.L.; Vincifori, G.; Camarda, A.; et al. Circulation of diverse protoparvoviruses in wild carnivores, Italy. Transbound. Emerg. Dis. 2021, 68, 2489–2502. [Google Scholar] [CrossRef] [Scilit]
  22. Ndiana, L.A.; Lanave, G.; Vasinioti, V.; Desario, C.; Martino, C.; Colaianni, M.L.; Pellegrini, F.; Camarda, A.; Berjaoui, S.; Sgroi, G.; et al. Detection and genetic characterization of Canine Adenoviruses, Circoviruses, and novel Cycloviruses from wild carnivores in Italy. Front. Vet. Sci. 2022, 9, 331. [Google Scholar] [CrossRef] [Scilit]
  23. Zaccaria, G.; Malatesta, D.; Scipioni, G.; Di Felice, E.; Campolo, M.; Casaccia, C.; Savini, G.; Di Sabatino, D.; Lorusso, A. Circovirus in domestic and wild carnivores: An important opportunistic agent? Virology 2016, 490, 69–74. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Amoroso, M.G.; Di Concilio, D.; D’Alessio, N.; Veneziano, V.; Galiero, G.; Fusco, G. Canine parvovirus and pseudorabies virus coinfection as a cause of death in a wolf (Canis lupus) from southern Italy. Vet. Med. Sci. 2020, 6, 600. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Di Sabatino, D.; Lorusso, A.; Di Francesco, C.E.; Gentile, L.; Di Pirro, V.; Bellacicco, A.L.; Giovannini, A.; Di Francesco, G.; Marruchella, G.; Marsilio, F.; et al. Arctic Lineage-Canine Distemper Virus as a cause of death in apennine wolves (Canis lupus) in Italy. PLoS ONE 2014, 9, 82356. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Alfano, F.; Dowgier, G.; Valentino, M.P.; Galiero, G.; Tinelli, A.; Decaro, N.; Fusco, G. Identification of pantropic Canine Coronavirus in a wolf (Canis lupus italicus) in Italy. J. Wildl. Dis. 2019, 55, 504–508. [Google Scholar]
  27. Balboni, A.; Musto, C.; Kaehler, E.; Verin, R.; Caniglia, R.; Fabbri, E.; Carra, E.; Cotti, C.; Battilani, M.; Delogu, M. Genetic Characterization of Canine Adenovirus Type 1 Detected by Real-Time Polymerase Chain Reaction in an Oral Sample of an Italian Wolf (Canis Lupus). J. Wildl. Dis. 2019, 55, 737–741. [Google Scholar] [CrossRef] [Scilit]
  28. Moreno, A.; Musto, C.; Gobbi, M.; Maioli, G.; Menchetti, M.; Trogu, T.; Paniccià, M.; Lavazza, A.; Delogu, M. Detection and molecular analysis of Pseudorabies virus from free-ranging Italian wolves (Canis lupus italicus) in Italy—A case report. BMC Vet. Res. 2024, 20, 9. [Google Scholar] [CrossRef] [Scilit]
  29. Smoglica, C.; Di Francesco, C.E.; Angelucci, S.; Antonucci, A.; Innocenti, M.; Marsilio, F. Occurrence of the tetracycline resistance gene tetA(P) in Apennine wolves (Canis lupus italicus) from different human–wildlife interfaces. J. Glob. Antimicrob. Resist. 2020, 23, 184–185. [Google Scholar] [CrossRef] [Scilit]
  30. Smoglica, C.; Angelucci, S.; Di Tana, F.; Antonucci, A.; Marsilio, F.; Esmeralda Di Francesco, C. Antibiotic Resistance in the Apennine Wolf (Canis lupus italicus): Implications for Wildlife and Human Health. Antibiotics 2023, 12, 950. [Google Scholar] [CrossRef] [Scilit]
  31. Di Francesco, A.; Salvatore, D.; Ranucci, A.; Gobbi, M.; Morandi, B. Antimicrobial resistance in wildlife: Detection of antimicrobial resistance genes in Apennine wolves (Canis lupus italicus Altobello, 1921) from Central Italy. Vet. Res. Commun. 2024, 48, 1941–1947. [Google Scholar] [CrossRef] [Scilit]
  32. Parco Foreste Casentinesi Monitoraggio Della Popolazione DI Lupo Nel Parco Nazionale Delle Foreste Casentinesi. Available online: https://www.parcoforestecasentinesi.it/it/node/550 (accessed on 5 November 2024).
  33. Guida per il Riconoscimento delle Specie. 2020. Progetto NAT2CARE Attivazione della Cittadinanza per il Ripristino e la Conservazione delle aree Natura 2000 Transfrontaliere. Dipartimento di Scienze Agroalimentari Ambientali e Animali, Università di Udine (Ed.). Programma di Cooperazione Interreg V-A Italia-Slovenia 2014–2020, 56p. Available online: https://www.parcoprealpigiulie.it/documents/369/7.Nat2Care_Guida_riconoscimento_specie_2020.pdf (accessed on 12 April 2022).
  34. Doumith, M.; Buchrieser, C.; Glaser, P.; Jacquet, C.; Martin, P. Differentiation of the major listeria monocytogenes serovars by multiplex PCR. J. Clin. Microbiol. 2004, 42, 3819–3822. [Google Scholar] [CrossRef] [Scilit]
  35. D’Agostino, M.; Wagner, M.; Vazquez-Boland, J.A.; Kuchta, T.; Karpiskova, R.; Hoorfar, J.; Novella, S.; Scortti, M.; Ellison, J.; Murray, A.; et al. A validated PCR-based method to detect Listeria monocytogenes using raw milk as a food model—Towards an international standard. J. Food Prot. 2004, 67, 1646–1655. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Borucki, M.K.; Call, D.R. Listeria monocytogenes Serotype Identification by PCR. J. Clin. Microbiol. 2003, 41, 5537–5540. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  37. Wang, G.; Clark, C.G.; Taylor, T.M.; Pucknell, C.; Barton, C.; Price, L.; Woodward, D.L.; Rodgers, F.G. Colony multiplex PCR assay for identification and differentiation of Campylobacter jejuni, C. coli, C. lari, C. upsaliensis, and C. fetus subsp. fetus. J. Clin. Microbiol. 2002, 40, 4744–4747. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Bottone, E.J. Yersinia enterocolitica: The charisma continues. Clin. Microbiol. Rev. 1997, 10, 257–276. [Google Scholar] [CrossRef]
  39. Thoerner, P.; Kingombe, C.I.B.; Bögli-Stuber, K.; Bissig-Choisat, B.; Wassenaar, T.M.; Frey, J.; Jemmi, T. PCR detection of virulence genes in Yersinia enterocolitica and Yersinia pseudotuberculosis and investigation of virulence gene distribution. Appl. Environ. Microbiol. 2003, 69, 1810. [Google Scholar] [CrossRef] [Scilit]
  40. Thisted Lambertz, S.; Danielsson-Tham, M.L. Identification and characterization of pathogenic Yersinia enterocolitica isolates by PCR and Pulsed-Field Gel Electrophoresis. Appl. Environ. Microbiol. 2005, 71, 3674. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  41. Bhagat, N.; Virdi, J.S. Distribution of virulence-associated genes in Yersinia enterocolitica biovar 1A correlates with clonal groups and not the source of isolation. FEMS Microbiol. Lett. 2007, 266, 177–183. [Google Scholar] [CrossRef] [Scilit]
  42. Bhowmick, P.P.; Devegowda, D.; Karunasagar, I. Virulotyping of seafood associated Salmonella enterica subsp. enterica isolated from Southwest coast of India. Res. Artic. Biotechnol. Bioinf. Bioeng 2011, 1, 63–69. [Google Scholar]
  43. Paton, A.W.; Paton, J.C. Direct detection and characterization of shiga toxigenic Escherichia coli by multiplex PCR for stx1, stx2, eae, ehxA, and saa. J. Clin. Microbiol. 2002, 40, 271–274. [Google Scholar] [CrossRef] [Scilit]
  44. Hasman, H.; Mevius, D.; Veldman, K.; Olesen, I.; Aarestrup, F.M. β-Lactamases among extended-spectrum β-lactamase (ESBL)-resistant Salmonella from poultry, poultry products and human patients in The Netherlands. J. Antimicrob. Chemother. 2005, 56, 115–121. [Google Scholar] [CrossRef] [Scilit]
  45. Dahshan, H.; Shahada, F.; Chuma, T.; Moriki, H.; Okamoto, K. Genetic analysis of multidrug-resistant Salmonella enterica serovars Stanley and Typhimurium from cattle. Vet. Microbiol. 2010, 145, 76–83. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  46. Poirel, L.; Walsh, T.R.; Cuvillier, V.; Nordmann, P. Multiplex PCR for detection of acquired carbapenemase genes. Diagn. Microbiol. Infect. Dis. 2011, 70, 119–123. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  47. CLSI (Clinical and Laboratory Standards Institute). M02-A12—Performance Standards for Antimicrobial Disk Susceptibility Tests, 12th ed.; Approved Standard; CLSI: Wayne, PA, USA, 2015. [Google Scholar]
  48. EUCAST (The European Committee on Antimicrobial Susceptibility Testing). Breakpoint Tables for Interpretation of MICs and Zone Diameters; Version 14.0; EUCAST: Basel, Switzerland, 2024. [Google Scholar]
  49. CLSI (Clinical and Laboratory Standards Institute). M100 Performance Standards for Antimicrobial Susceptibility Testing A CLSI Supplement for Global Application, 30th ed.; CLSI supplement M100; CLSI: Wayne, PA, USA, 2020. [Google Scholar]
  50. Berri, M.; Rekiki, A.; Boumedine, K.S.; Rodolakis, A. Simultaneous differential detection of Chlamydophila abortus, Chlamydophila pecorum and Coxiella burnetii from aborted ruminant’s clinical samples using multiplex PCR. BMC Microbiol. 2009, 9, 130. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  51. Moravkova, M.; Hlozek, P.; Beran, V.; Pavlik, I.; Preziuso, S.; Cuteri, V.; Bartos, M. Strategy for the detection and differentiation of Mycobacterium avium species in isolates and heavily infected tissues. Res. Vet. Sci. 2008, 85, 257–264. [Google Scholar] [CrossRef] [Scilit]
  52. dos Santos, L.S.; Sá, J.C.; dos Santos Ribeiro, D.L.; Chaves, N.P.; da Silva Mol, J.P.; Santos, R.L.; da Paixão, T.A.; de Carvalho Neta, A.V. Detection of Brucella sp. infection through serological, microbiological, and molecular methods applied to buffaloes in Maranhão State, Brazil. Trop. Anim. Health Prod. 2017, 49, 675–679. [Google Scholar] [CrossRef] [Scilit]
  53. Milutinović, M.; Masuzawa, T.; Tomanović, S.; Radulović, Ž.; Fukui, T.; Okamoto, Y. Borrelia burgdorferi sensu lato, Anaplasma phagocytophilum, Francisella tularensis and their co-infections in host-seeking Ixodes ricinus ticks collected in Serbia. Exp. Appl. Acarol. 2008, 45, 171–183. [Google Scholar] [CrossRef] [Scilit]
  54. Magiorakos, A.P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, C.G.; Harbarth, S.; Hindler, J.F.; Kahlmeter, G.; Olsson-Liljequist, B.; et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  55. Yon, L.; Duff, J.P.; Ågren, E.O.; Erdélyi, K.; Ferroglio, E.; Godfroid, J.; Hars, J.; Hestvik, G.; Horton, D.; Kuiken, T.; et al. Recent changes in infectious diseases in European wildlife. J. Wildl. Dis. 2019, 55, 3–43. [Google Scholar] [CrossRef] [Scilit]
  56. Pereira, A.C.; Reis, A.C.; Ramos, B.; Cunha, M.V. Animal tuberculosis: Impact of disease heterogeneity in transmission, diagnosis and control. Transbound. Emerg. Dis. 2020, 67, 1828–1846. [Google Scholar] [CrossRef] [Scilit]
  57. Ebani, V.V.; Guardone, L.; Bertelloni, F.; Perrucci, S.; Poli, A.; Mancianti, F. Survey on the presence of bacterial and parasitic zoonotic agents in the feces of wild birds. Vet. Sci. 2021, 8, 171. [Google Scholar] [CrossRef] [Scilit]
  58. Yeni, D.K.; Büyük, F.; Ashraf, A.; Shah, M.S.u.D. Tularemia: A re-emerging tick-borne infectious disease. Folia Microbiol. 2021, 66, 1. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  59. Kerkhof, P.J.; Peruzy, M.F.; Murru, N.; Houf, K. Wild boars as reservoir for Campylobacter and Arcobacter. Vet. Microbiol. 2022, 270, 109462. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  60. Celina, S.S.; Cerný, J. Coxiella burnetii in ticks, livestock, pets and wildlife: A mini-review. Front. Vet. Sci. 2022, 9, 1068129. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  61. Gambi, L.; Ravaioli, V.; Rossini, R.; Tranquillo, V.; Boscarino, A.; Mattei, S.; D’incau, M.; Tosi, G.; Fiorentini, L.; Donato, A. Di Prevalence of Different Salmonella enterica Subspecies and Serotypes in Wild Carnivores in Emilia-Romagna Region, Italy. Animals 2022, 12, 3368. [Google Scholar] [CrossRef] [Scilit]
  62. Mínguez-González, O.; Gutiérrez-Martín, C.B.; del Carmen Martínez-Nistal, M.; del Rosario Esquivel-García, M.; Gómez-Campillo, J.I.; Collazos-Martínez, J.Á.; Fernández-Calle, L.M.; Ruiz-Sopeña, C.; Tamames-Gómez, S.; Martínez-Martínez, S.; et al. Tularemia outbreaks in Spain from 2007 to 2020 in humans and domestic and wild animals. Pathogens 2021, 10, 892. [Google Scholar] [CrossRef] [Scilit]
  63. Kosoy, M.; Goodrich, I. Comparative ecology of Bartonella and Brucella infections in wild carnivores. Front. Vet. Sci. 2018, 5, 322. [Google Scholar] [CrossRef] [Scilit]
  64. Lutze-Wallace, C.; Berlie-Surujballi, G.; Barbeau, Y.; Bergeson, D. Strain typing of Mycobacterium bovis from a 1978 case of tuberculosis in a wolf (Canis lupis) from Manitoba. Can. Vet. J. 2005, 46, 502. [Google Scholar]
  65. Orłowska, B.; Augustynowicz-Kopeć, E.; Krajewska, M.; Zabost, A.; Welz, M.; Kaczor, S.; Anusz, K. Mycobacterium caprae transmission to free-living grey wolves (Canis lupus) in the Bieszczady Mountains in Southern Poland. Eur. J. Wildl. Res. 2017, 63, 1–5. [Google Scholar] [CrossRef] [Scilit]
  66. EFSA (European Food Safety Authority); ECDC (European Centre for Disease Prevention and Control). The European Union One Health 2021 Zoonoses Report. EFSA J. 2022, 20, 273. [Google Scholar]
  67. Schoder, D.; Guldimann, C.; Märtlbauer, E. Asymptomatic carriage of Listeria monocytogenes by animals and humans and its impact on the food chain. Foods 2022, 11, 3472. [Google Scholar] [CrossRef] [Scilit]
  68. Bagatella, S.; Tavares-Gomes, L.; Oevermann, A. Listeria monocytogenes at the interface between ruminants and humans: A comparative pathology and pathogenesis review. Vet. Pathol. 2022, 59, 186–210. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  69. Joutsen, S.; Laukkanen-Ninios, R.; Henttonen, H.; Niemimaa, J.; Voutilainen, L.; Kallio, E.R.; Helle, H.; Korkeala, H.; Fredriksson-Ahomaa, M. Yersinia spp. in wild rodents and shrews in Finland. Vector-Borne Zoonotic Dis. 2017, 17, 303–311. [Google Scholar] [CrossRef] [Scilit]
  70. Syczyło, K.; Platt-Samoraj, A.; Bancerz-Kisiel, A.; Szczerba-Turek, A.; Pajdak-Czaus, J.; Łabuć, S.; Procajło, Z.; Socha, P.; Chuzhebayeva, G.; Szweda, W. The prevalence of Yersinia enterocolitica in game animals in Poland. PLoS ONE 2018, 13, e0195136. [Google Scholar] [CrossRef] [Scilit]
  71. Platt-Samoraj, A.; Zmudzki, J.; Pajdak-Czaus, J.; Szczerba-Turek, A.; Bancerz-Kisiel, A.; Procajło, Z.; Łabuć, S.; Szweda, W. The prevalence of Yersinia enterocolitica and Yersinia pseudotuberculosis in small wild rodents in Poland. Vector-Borne Zoonotic Dis. 2020, 20, 586–592. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  72. Modesto, P.; De Ciucis, C.G.; Vencia, W.; Pugliano, M.C.; Mignone, W.; Berio, E.; Masotti, C.; Ercolini, C.; Serracca, L.; Andreoli, T.; et al. Evidence of antimicrobial resistance and presence of pathogenicity genes in Yersinia enterocolitica isolate from wild boars. Pathogens 2021, 10, 398. [Google Scholar] [CrossRef] [Scilit]
  73. Carella, E.; Romano, A.; Domenis, L.; Robetto, S.; Spedicato, R.; Guidetti, C.; Pitti, M.; Orusa, R. Characterisation of Yersinia enterocolitica strains isolated from wildlife in the Northwestern Italian Alps. J. Vet. Res. 2022, 66, 141. [Google Scholar] [CrossRef] [Scilit]
  74. Roulová, N.; Moťková, P.; Brožková, I.; Brzezinska, M.S.; Pejchalová, M. Detection, characterization, and antimicrobial susceptibility of Yersinia enterocolitica in different types of wastewater in the Czech Republic. J. Appl. Microbiol. 2022, 133, 2255–2266. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  75. Platt-Samoraj, A. Toxigenic properties of Yersinia enterocolitica Biotype 1A. Toxins 2022, 14, 118. [Google Scholar] [CrossRef] [Scilit]
  76. Sulakvelidze, A. Yersiniae other than Y.enterocolitica, Y. pseudotuberculosis, and Y. pestis: The ignored species. Microbes Infect. 2000, 2, 497–513. [Google Scholar] [CrossRef] [Scilit]
  77. Alonso, C.A.; Mora, A.; Díaz, D.; Blanco, M.; González-Barrio, D.; Ruiz-Fons, F.; Simón, C.; Blanco, J.; Torres, C. Occurrence and characterization of stx and/or eae-positive Escherichia coli isolated from wildlife, including a typical EPEC strain from a wild boar. Vet. Microbiol. 2017, 207, 69–73. [Google Scholar] [CrossRef] [Scilit]
  78. Persad, A.K.; Lejeune, J.T. Animal Reservoirs of Shiga Toxin-Producing Escherichia coli. In Enterohemorrhagic Escherichia coli and Other Shiga Toxin-Producing E. coli; American Society of Microbiology: Washington, DC, USA, 2014; pp. 231–244. [Google Scholar]
  79. Dias, D.; Caetano, T.; Torres, R.T.; Fonseca, C.; Mendo, S. Shiga toxin-producing Escherichia coli in wild ungulates. Sci. Total Environ. 2019, 651, 203–209. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  80. Bertelloni, F.; Lunardo, E.; Rocchigiani, G.; Ceccherelli, R.; Ebani, V. Occurrence of Escherichia coli virulence genes in feces of wild birds from Central Italy. Asian Pac. J. Trop. Med. 2019, 12, 142–146. [Google Scholar]
  81. Espinoza, V.; Valdez, M.; Burcovschii, S.; Fong, I.; Petersen, G.; Heidari, A. The First Case Report of Endocarditis Caused by Serratia fonticola. J. Investig. Med. High Impact Case Rep. 2021, 9, 23247096211044916. [Google Scholar] [CrossRef] [Scilit]
  82. Fuentes-Castillo, D.; Power, P.; Cerdeira, L.; Cardenas-Arias, A.; Moura, Q.; Oliveira, F.A.; Levy, C.E.; Gutkind, G.; Catão-Dias, J.L.; Lincopan, N. FONA-7, a novel Extended-Spectrum β-Lactamase variant of the FONA family identified in Serratia fonticola. Microb. Drug Resist. 2021, 27, 585–589. [Google Scholar] [CrossRef] [Scilit]
  83. Tanimoto, K.; Nomura, T.; Hashimoto, Y.; Hirakawa, H.; Watanabe, H.; Tomita, H. Isolation of Serratia fonticola Producing FONA, a Minor Extended-Spectrum β-Lactamase (ESBL), from Imported Chicken Meat in Japan. Jpn. J. Infect. Dis. 2021, 74, 79–81. [Google Scholar] [CrossRef] [Scilit]
  84. EFSA, (European Food Safety Authority); ECDC, (European Centre for Disease Prevention and Control) The European Union Summary Report on Antimicrobial Resistance in zoonotic and indicator bacteria from humans, animals and food in 2019–2020. EFSA J. 2022, 20, e07209.
  85. Rubin, J.E.; Pitout, J.D.D. Extended-spectrum β-lactamase, carbapenemase and AmpC producing Enterobacteriaceae in companion animals. Vet. Microbiol. 2014, 170, 10–18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  86. EFSA BIOHAZ Panel (EFSA Panel on Biological Hazards). Scientific Opinion on the public health risks of bacterial strains producing extended-spectrum β-lactamases and/or AmpC β-lactamases in food and food-producing animals. EFSA J. 2011, 9, 2322. [Google Scholar] [CrossRef] [Scilit]
  87. EFSA BIOHAZ Panel (EFSA Panel on Biological Hazards). Scientific Opinion on Carbapenem resistance in food animal ecosystems. EFSA J. 2013, 11, 3501. [Google Scholar]
  88. Darwich, L.; Vidal, A.; Seminati, C.; Albamonte, A.; Casado, A.; López, F.; Molina-López, R.A.; Migura-Garcia, L. High prevalence and diversity of extended-spectrum β-lactamase and emergence of OXA-48 producing Enterobacterales in wildlife in Catalonia. PLoS ONE 2019, 14, e0210686. [Google Scholar] [CrossRef] [Scilit]
  89. Köck, R.; Daniels-Haardt, I.; Becker, K.; Mellmann, A.; Friedrich, A.W.; Mevius, D.; Schwarz, S.; Jurke, A. Carbapenem-resistant Enterobacteriaceae in wildlife, food-producing, and companion animals: A systematic review. Clin. Microbiol. Infect. 2018, 24, 1241–1250. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  90. Matakone, M.; Founou, R.C.; Founou, L.L.; Dimani, B.D.; Koudoum, P.L.; Fonkoua, M.C.; Boum-II, Y.; Gonsu, H.; Noubom, M. Multi-drug resistant (MDR) and extended-spectrum β-lactamase (ESBL) producing Escherichia coli isolated from slaughtered pigs and slaughterhouse workers in Yaoundé, Cameroon. One Health 2024, 19, 100885. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Table 1. Primers and related information for the PCR assays employed to characterize the bacterial strains isolated from fecal samples.
Table 1. Primers and related information for the PCR assays employed to characterize the bacterial strains isolated from fecal samples.
ApplicationGenePrimersSequencesAmplicons
(bp)
Annealing
Temperature °C
Ref.
Listeria monocytogenes confirmation and typingprsPRS_1GCTGAAGAGATTGCGAAAGAAG37053[34]
PRS_2CAAAGAAACCTTGGATTTGCGG
prfALIP1GATACAGAAACATCGGTTGGC27453[35]
LIP2aGTGTAATCTTGATGCCATCAGG
lmo0737LMO0737_1AGGGCTTCAAGGACTTACCC69153[34]
LMO0737_2ACGATTTCTGCTTGCCATTC
lmo1118LMO1118_1AGGGGTCTTAAATCCTGGA906
LMO1118_2CGGCTTGTTCGGCATACTTA
ORF2819ORF2819_1AGCAAAATGCCAAAACTCGT471
ORF2819_2CATCACTAAAGCCTCCCATTG
ORF2110ORF2110_1AGTGGACAATTGATTGGTGAA597
ORF2110_2CATCCATCCCTTACTTTGGAC
flaAFlaA-FTTACTAGATCAAACTGCTCC53861[36]
FlaA-RAAGAAAAGCCCCTCGTCC
Campylobacter spp. confirmation23S rRNA23SFTATACCGGTAAGGAGTGCTGGAG65059[37]
23SRATCAATTAACCTTCGAGCACCG
Yersinia enterocolitica virulence genes detectionail9AGTTTATCAATTGCGTCTGTTAATGTGTACG45460[40]
10ACTATCGAGTTTGGAGTATTCATATGAAGCG
virF11AAAGGTTGTTGAGCATTCACAAGATGG700
12ATTTGAGTGAAATAAGACTGACTCGAGAACC
invinvFTGCCTTGGTATGACTCTGCTTCA111463[41]
invRAGCGCACCATTACTGGTGGTTAT
ystAystAFATCGACACCAATAACCGCTGAG7961[39]
ystARCCAATCACTACTGACTTCGGCT
ystBystBFGTACATTAGGCCAAGAGACG146
ystBRGCAACATACCTCACAACACC
Salmonella spp. confirmationinvAinvAFGTTGTACCGTGGCATGTCTG93050[42]
invARGCCATGGTATGGATTTGTCC
Shiga Toxin-Producing Escherichia coli (STEC) detectionstx1stx1FATAAATCGCCATTCGTTGACTAC18060[43]
stx1RGAACGCCCACTGAGATCATC
stx2stx2FGGCACTGTCTGAAACTGCTCC255
stx2RTCGCCAGTTATCTGACATTCTG
Extended Spectrum β-Lactamase genes detectionblaTEMblaTEMFGCACGAGTGGGTTACATCGA31060[45]
blaTEMRGGTCCTCCGATCGTTGTCAG
blaSHVSHV-FTTCGCCTGTGTATTATCTCCCTG85450[44]
SHV-RTTAGCGTTGCCAGTGYTCG
blaCTX-MCTX-FATGTGCAGYACCAGTAARGTKATGGC59360
CTX-RTGGGTRAARTARGTSACCAGAAYCAGCGG
Carbapenemase genes detectionblaNDMNDM-FGGTTTGGCGATCTGGTTTTC62152[46]
NDM-RCGGAATGGCTCATCACGATC
blaKPCKPC-FCGTCTAGTTCTGCTGTCTTG798
KPC-RCTTGTCATCCTTGTTAGGCG
blaOXA-48OXA-FGCGTGGTTAAGGATGAACAC438
OXA-RCATCAAGTTCAACCCAACCG
blaIMPIMP-FGGAATAGAGTGGCTTAAYTCTC232
IMP-RGGTTTAAYAAAACAACCACC
blaVIMVIM-FGATGGTGTTTGGTCGCATA390
VIM-RCGAATGCGCAGCACCAG
Table 2. Primers and related information for the PCR assays employed for the detection of pathogenic bacteria in fecal samples.
Table 2. Primers and related information for the PCR assays employed for the detection of pathogenic bacteria in fecal samples.
PathogenGenePrimersSequencesAmplicons
(bp)
Annealing
Temperature °C
Ref.
Coxiella
burnetii
IS1111Trans-1TATGTATCCACCGTAGCCAGT68764[50]
Trans-2CCCAACAACACCTCCTTATTC
Mycobacterium spp.16SrDNAMycogenFAGAGTTTGATCCTGGCTCAG103062[51]
MycogenRTGCACACAGGCCACAAGGGA
Brucella spp.bcsp31B4TGGCTCGGTTGCCAATATCAA22360[52]
B5CGCGCTTGCCTTTCAAGGTCTG
Francisella
tularensis
TUL4TUL4–435TCGAAGACGATCAGATACCGTCG40055[53]
TUL4–863TGCCTTAAACTTCCTTGCGAT
Table 3. Results of bacteriological and molecular analyses conducted on wolf fecal samples.
Table 3. Results of bacteriological and molecular analyses conducted on wolf fecal samples.
Sample
Number
Listeria
monocytogenes
Campylobacter
spp.
Yersinia
spp.
Salmonella
spp.
STECESBLCRECoxiella
burnetii
Mycobacterium
spp.
Brucella
spp.
Francisella
tularensis
1++
2+
3
4
5
6+
7+
8
9
10
11
12+
13+
14
15
16+
Total10401200000
Legend: STEC: Shiga Toxin-Producing Escherichia coli; ESBL: Extended Spectrum β-Lactamase-producing Enterobacteriaceae; CRE: carbapenemase-producing Enterobacteriaceae; +: Positive; −: negative.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Bertelloni, F.; Cagnoli, G.; Ebani, V.V. Survey on the Occurrence of Zoonotic Bacterial Pathogens in the Feces of Wolves (Canis lupus italicus) Collected in a Protected Area in Central Italy. Microorganisms 2024, 12, 2367. https://doi.org/10.3390/microorganisms12112367

AMA Style

Bertelloni F, Cagnoli G, Ebani VV. Survey on the Occurrence of Zoonotic Bacterial Pathogens in the Feces of Wolves (Canis lupus italicus) Collected in a Protected Area in Central Italy. Microorganisms. 2024; 12(11):2367. https://doi.org/10.3390/microorganisms12112367

Chicago/Turabian Style

Bertelloni, Fabrizio, Giulia Cagnoli, and Valentina Virginia Ebani. 2024. "Survey on the Occurrence of Zoonotic Bacterial Pathogens in the Feces of Wolves (Canis lupus italicus) Collected in a Protected Area in Central Italy" Microorganisms 12, no. 11: 2367. https://doi.org/10.3390/microorganisms12112367

APA Style

Bertelloni, F., Cagnoli, G., & Ebani, V. V. (2024). Survey on the Occurrence of Zoonotic Bacterial Pathogens in the Feces of Wolves (Canis lupus italicus) Collected in a Protected Area in Central Italy. Microorganisms, 12(11), 2367. https://doi.org/10.3390/microorganisms12112367

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop