Protective Role of Indole-3-Acetic Acid Against Salmonella Typhimurium: Inflammation Moderation and Intestinal Microbiota Restoration
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Bacteria Preparation
2.3. Materials and Preparation
2.4. Mouse Model and Treatments
2.5. Sample Collection and Serum Chemical Analysis
2.6. Intestinal Histopathological Evaluation
2.7. Quantitative Real-Time Polymerase Chain Reaction (PCR) Analysis
2.8. Fecal Microbial Quantity and16S rRNA Bioinformatics Analysis
2.9. Statistical Analysis
3. Results
3.1. Growth Performance and Survival Rate
3.2. Intestinal Histopathology
3.3. mRNA Expression Levels of Pro-Inflammatory Cytokines
3.4. mRNA Expression Levels of Tight Junction Protein
3.5. Th17 and ILC3 Transcription Levels of Intestinal Immune Cells
3.6. Serum IL-1β, TNF-α and IL-6 Concentration
3.7. Colonic Microbiota Structure Changes
4. Discussion
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
References
- Kim, S.; Lee, K.S.; Pak, G.D.; Excler, J.L.; Sahastrabuddhe, S.; Marks, F.; Kim, J.H.; Mogasale, V. Spatial and Temporal Patterns of Typhoid and Paratyphoid Fever Outbreaks: A Worldwide Review, 1990–2018. Clin. Infect. Dis. 2019, 69, S499–S509. [Google Scholar] [CrossRef] [Scilit]
- Galán, J.E. Salmonella Typhimurium and inflammation: A pathogen-centric affair. Nat. Rev. Microbiol. 2021, 19, 716–725. [Google Scholar] [CrossRef] [Scilit]
- Buckle, G.C.; Walker, C.L.F.; Black, R.E. Typhoid fever and paratyphoid fever: Systematic review to estimate global morbidity and mortality for 2010. J. Glob. Health 2012, 2, 10401. [Google Scholar] [CrossRef] [Scilit]
- Bo, Y.; Jing, Z.; Fengfeng, L.; Biao, K.; Meiying, Y. Epidemiological analysis of typhoid fever and paratyphoid fever in China and provinces with high incidence in 2015–2016. Dis. Surveill. 2018, 33, 407–412. [Google Scholar]
- Dougan, G.; Baker, S. Salmonella enterica Serovar Typhi and the Pathogenesis of Typhoid Fever. Annu. Rev. Microbiol. 2014, 68, 317–336. [Google Scholar] [CrossRef] [Scilit]
- House, D.; Bishop, A.; Parry, C.; Dougan, G.; Wain, J. Typhoid fever: Pathogenesis and disease. Curr. Opin. Infect. Dis. 2001, 14, 573–578. [Google Scholar] [CrossRef] [Scilit]
- Stecher, B.R.; Robbiani, R.; Walker, A.W.; Westendorf, A.M.; Barthel, M.; Kremer, M.; Chaffron, S.; Macpherson, A.J.; Buer, J.; Parkhill, J. Salmonella enterica Serovar Typhimurium Exploits Inflammation to Compete with the Intestinal Microbiota. PLoS Biol. 2007, 5, 2177–2189. [Google Scholar] [CrossRef] [Scilit]
- Ferreira, R.B.R.; Gill, N.; Willing, B.P.; Antunes, L.C.M.; Russell, S.L.; Croxen, M.A.; Finlay, B.B. The Intestinal Microbiota Plays a Role in Salmonella-Induced Colitis Independent of Pathogen Colonization. PLoS ONE 2011, 6, e20338. [Google Scholar] [CrossRef] [Scilit]
- Stecher, B.; Macpherson, A.J.; Hapfelmeier, S.; Kremer, M.; Stallmach, T.; Hardt, W.D. Comparison of Salmonella enterica Serovar Typhimurium Colitis in Germfree Mice and Mice Pretreated with Streptomycin. Infect. Immun. 2005, 73, 3228–3241. [Google Scholar] [CrossRef] [Scilit]
- Roager, H.M.; Licht, T.R. Microbial tryptophan catabolites in health and disease. Nat. Commun. 2018, 9, 3294. [Google Scholar] [CrossRef] [Scilit]
- Wang, G.; Huang, S.; Wang, Y.; Cai, S.; Yu, H.; Liu, H.; Zeng, X.; Zhang, G.; Qiao, S. Bridging intestinal immunity and gut microbiota by metabolites. Cell Mol. Life Sci. 2019, 76, 3917–3937. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Platten, M.; Nollen, E.; Rohrig, U.F.; Fallarino, F.; Opitz, C.A. Tryptophan metabolism as a common therapeutic target in cancer, neurodegeneration and beyond. Nat. Rev. Drug Discov. 2019, 18, 379–401. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lamas, B.; Richard, M.L.; Leducq, V.; Pham, H.P.; Michel, M.L.; Da, C.G.; Bridonneau, C.; Jegou, S.; Hoffmann, T.W.; Natividad, J.M.; et al. CARD9 impacts colitis by altering gut microbiota metabolism of tryptophan into aryl hydrocarbon receptor ligands. Nat. Med. 2016, 22, 598–605. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zelante, T.; Iannitti, R.G.; Cunha, C.; De Luca, A.; Giovannini, G.; Pieraccini, G.; Zecchi, R.; D’Angelo, C.; Massi-Benedetti, C.; Fallarino, F.; et al. Tryptophan catabolites from microbiota engage aryl hydrocarbon receptor and balance mucosal reactivity via interleukin-22. Immunity 2013, 39, 372–385. [Google Scholar] [CrossRef] [Scilit]
- Langan, D.; Perkins, D.J.; Vogel, S.N.; Moudgil, K.D. Microbiota-Derived Metabolites, Indole-3-aldehyde and Indole-3-acetic Acid, Differentially Modulate Innate Cytokines and Stromal Remodeling Processes Associated with Autoimmune Arthritis. Int. J. Mol. Sci. 2021, 22, 2017. [Google Scholar] [CrossRef] [Scilit]
- Ji, Y.; Yin, W.; Liang, Y.; Sun, L.; Yin, Y.; Zhang, W. Anti-Inflammatory and Anti-Oxidative Activity of Indole-3-Acetic Acid Involves Induction of HO-1 and Neutralization of Free Radicals in RAW264.7 Cells. Int. J. Mol. Sci. 2020, 21, 1579. [Google Scholar] [CrossRef] [Scilit]
- Kim, D.; Kim, H.; Kim, K.; Roh, S. The Protective Effect of Indole-3-Acetic Acid (IAA) on H(2)O(2)-Damaged Human Dental Pulp Stem Cells Is Mediated by the AKT Pathway and Involves Increased Expression of the Transcription Factor Nuclear Factor-Erythroid 2-Related Factor 2 (Nrf2) and Its Downstream Target Heme Oxygenase 1 (HO-1). Oxid. Med. Cell Longev. 2017, 2017, 8639485. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tintelnot, J.; Xu, Y.; Lesker, T.R.; Schonlein, M.; Konczalla, L.; Giannou, A.D.; Pelczar, P.; Kylies, D.; Puelles, V.G.; Bielecka, A.A.; et al. Microbiota-derived 3-IAA influences chemotherapy efficacy in pancreatic cancer. Nature 2023, 615, 168–174. [Google Scholar] [CrossRef] [Scilit]
- Li, S.; Cai, Y.; Guan, T.; Zhang, Y.; Huang, K.; Zhang, Z.; Cao, W.; Guan, X. Quinic acid alleviates high-fat diet-induced neuroinflammation by inhibiting DR3/IKK/NF-κB signaling via gut microbial tryptophan metabolites. Gut Microbes 2024, 16, 2374608. [Google Scholar] [CrossRef] [Scilit]
- Liu, H.; Hou, C.; Wang, G.; Jia, H.; Yu, H.; Zeng, X.; Thacker, P.A.; Zhang, G.; Qiao, S. Lactobacillus reuteri I5007 Modulates Intestinal Host Defense Peptide Expression in the Model of IPEC-J2 Cells and Neonatal Piglets. Nutrients 2017, 9, 559. [Google Scholar] [CrossRef] [Scilit]
- He, T.; Yuan, Z.; Chen, Q.; Luo, J.; Mao, J.; Tang, Z.; Zhao, X.; Yang, Z. Circular RNAs Mediate the Effects of Dietary Tryptophan on the Transformation of Muscle Fiber Types in Weaned Piglets. J. Agric. Food Chem. 2024, 72, 8595–8605. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, G.; Huang, S.; Cai, S.; Yu, H.; Wang, Y.; Zeng, X.; Qiao, S. Lactobacillus reuteri Ameliorates Intestinal Inflammation and Modulates Gut Microbiota and Metabolic Disorders in Dextran Sulfate Sodium-Induced Colitis in Mice. Nutrients 2020, 12, 2298. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, G.; Wang, X.; Ma, Y.; Cai, S.; Yang, L.; Fan, Y.; Zeng, X.; Qiao, S. Lactobacillus reuteri improves the development and maturation of fecal microbiota in piglets through mother-to-infant microbe and metabolite vertical transmission. Microbiome 2022, 10, 211. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mothur, S.P. Available online: http://www.mothur.org (accessed on 11 September 2022).
- Scott, S.A.; Fu, J.; Chang, P.V. Microbial tryptophan metabolites regulate gut barrier function via the aryl hydrocarbon receptor. Proc. Natl. Acad. Sci. USA 2020, 117, 19376–19387. [Google Scholar] [CrossRef] [Scilit]
- Ding, Y.; Yanagi, K.; Yang, F.; Callaway, E.; Cheng, C.; Hensel, M.E.; Menon, R.; Alaniz, R.C.; Lee, K.; Jayaraman, A. Oral supplementation of gut microbial metabolite indole-3-acetate alleviates diet-induced steatosis and inflammation in mice. eLife 2024, 12, RP87458. [Google Scholar] [CrossRef]
- Wang, G.; Fan, Y.; Zhang, G.; Cai, S.; Ma, Y.; Yang, L.; Wang, Y.; Yu, H.; Qiao, S.; Zeng, X. Microbiota-derived indoles alleviate intestinal inflammation and modulate microbiome by microbial cross-feeding. Microbiome 2024, 12, 59. [Google Scholar] [CrossRef] [Scilit]
- Zhang, L.; Gui, S.; Liang, Z.; Liu, A.; Chen, Z.; Tang, Y.; Xiao, M.; Chu, F.; Liu, W.; Jin, X. Musca domestica Cecropin (Mdc) Alleviates Salmonella typhimurium-Induced Colonic Mucosal Barrier Impairment: Associating With Inflammatory and Oxidative Stress Response, Tight Junction as Well as Intestinal Flora. Front. Microbiol. 2019, 10, 522. [Google Scholar] [CrossRef] [Scilit]
- Tuxpan-Pérez, A.; Ibarra-Valencia, M.A.; Estrada, B.E.; Clement, H.; Corrales-García, L.L.; Espino-Solis, G.P.; Corzo, G. Antimicrobial and Immunomodulatory Effects of Selected Chemokine and Antimicrobial Peptide on Cytokine Profile During. Antibiotics 2022, 11, 607. [Google Scholar] [CrossRef] [Scilit]
- Shi, Z.; Nan, Y.; Zhou, X.; Zhang, W.; Zhang, Z.; Zhang, C.; Duan, H.; Ge, J.; Zhao, L. Molecular Mechanisms of Intestinal Protection by Levilactobacillus brevis 23017 against Salmonella typhimurium C7731-Induced Damage: Role of Nrf2. Microorganisms 2024, 12, 1135. [Google Scholar] [CrossRef] [Scilit]
- Camilleri, M.; Madsen, K.; Spiller, R.; Meerveld, B.G.V.; Verne, G.N. Intestinal barrier function in health and gastrointestinal disease. Neurogastroenterol. Motil. Off. J. Eur. Gastrointest. Motil. Soc. 2012, 24, 503–512. [Google Scholar] [CrossRef] [Scilit]
- Martens, E.C.; Neumann, M.; Desai, M.S. Interactions of commensal and pathogenic microorganisms with the intestinal mucosal barrier. Nat. Rev. Microbiol. 2018, 16, 457–470. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Junaid, M.; Lu, H.; Din, A.U.; Yu, B.; Liu, Y.; Li, Y.; Liu, K.; Yan, J.; Qi, Z. Deciphering Microbiome, Transcriptome, and Metabolic Interactions in the Presence of Probiotic Lactobacillus acidophilus against Salmonella Typhimurium in a Murine Model. Antibiotics 2024, 13, 352. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wei, S.; Huang, J.; Liu, Z.; Wang, M.; Zhang, B.; Lian, Z.; Guo, Y.; Han, H. Differential immune responses of C57BL/6 mice to infection by Salmonella enterica serovar Typhimurium strain SL1344, CVCC541 and CMCC50115. Virulence 2019, 10, 248–259. [Google Scholar] [CrossRef] [Scilit]
- Winter, S.E.; Thiennimitr, P.; Winter, M.G.; Butler, B.P.; Huseby, D.L.; Crawford, R.W.; Russell, J.M.; Bevins, C.L.; Adams, L.G.; Tsolis, R.M.; et al. Gut inflammation provides a respiratory electron acceptor for Salmonella. Nature 2010, 467, 426–429. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Neurath, M.F. Cytokines in inflammatory bowel disease. Nat. Rev. Immunol. 2014, 14, 329–342. [Google Scholar] [CrossRef] [Scilit]
- Atreya, R.; Zimmer, M.; Bartsch, B.; Waldner, M.J.; Atreya, I.; Neumann, H.; Hildner, K.; Hoffman, A.; Kiesslich, R.; Rink, A.D.; et al. Antibodies against tumor necrosis factor (TNF) induce T-cell apoptosis in patients with inflammatory bowel diseases via TNF receptor 2 and intestinal CD14(+) macrophages. Gastroenterology 2011, 141, 2026–2038. [Google Scholar] [CrossRef] [Scilit]
- Neurath, M.F.; Finotto, S. IL-6 signaling in autoimmunity, chronic inflammation and inflammation-associated cancer. Cytokine Growth Factor Rev. 2011, 22, 83–89. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lopez-Castejon, G.; Brough, D. Understanding the mechanism of IL-1beta secretion. Cytokine Growth Factor Rev. 2011, 22, 189–195. [Google Scholar] [CrossRef] [Scilit]
- Lawrence, T. The nuclear factor NF-kappaB pathway in inflammation. Csh Perspect. Biol. 2009, 1, a001651. [Google Scholar] [CrossRef] [Scilit]
- John, G.K.; Wang, L.; Nanavati, J.; Twose, C.; Singh, R.; Mullin, G. Dietary Alteration of the Gut Microbiome and Its Impact on Weight and Fat Mass: A Systematic Review and Meta-Analysis. Genes 2018, 9, 167. [Google Scholar] [CrossRef] [Scilit]
- Yoshida, N.; Yamashita, T.; Hirata, K.I. Gut Microbiome and Cardiovascular Diseases. Diseases 2018, 6, 56. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hansen, L.; Roager, H.M.; Sondertoft, N.B.; Gobel, R.J.; Kristensen, M.; Valles-Colomer, M.; Vieira-Silva, S.; Ibrugger, S.; Lind, M.V.; Maerkedahl, R.B.; et al. A low-gluten diet induces changes in the intestinal microbiome of healthy Danish adults. Nat. Commun. 2018, 9, 4630. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Behary, J.; Amorim, N.; Jiang, X.T.; Raposo, A.; Gong, L.; McGovern, E.; Ibrahim, R.; Chu, F.; Stephens, C.; Jebeili, H.; et al. Gut microbiota impact on the peripheral immune response in non-alcoholic fatty liver disease related hepatocellular carcinoma. Nat. Commun. 2021, 12, 187. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Valdez-Palomares, F.; Nambo-Venegas, R.; Uribe-Garcia, J.; Mendoza-Vargas, A.; Granados-Portillo, O.; Meraz-Cruz, N.; Palacios-Gonzalez, B. Intestinal microbiota fingerprint in subjects with irritable bowel syndrome responders to a low FODMAP diet. Food Funct. 2021, 12, 3206–3218. [Google Scholar] [CrossRef] [Scilit]
- Shim, J.; Kim, J.W.; Shea, P.J.; Oh, B.T. IAA production by Bacillus sp. JH 2-2 promotes Indian mustard growth in the presence of hexavalent chromium. J. Basic. Microb. 2015, 55, 652–658. [Google Scholar] [CrossRef] [Scilit]
- Krishnan, R.; Menon, R.R.; Likhitha; Busse, H.J.; Tanaka, N.; Krishnamurthi, S.; Rameshkumar, N. Novosphingobium pokkalii sp nov, a novel rhizosphere-associated bacterium with plant beneficial properties isolated from saline-tolerant pokkali rice. Res. Microbiol. 2017, 168, 113–121. [Google Scholar] [CrossRef] [Scilit]
- Chhetri, G.; Kang, M.; Kim, J.; Kim, I.; So, Y.; Seo, T. Sphingosinicella flava sp. nov., indole acetic acid producing bacteria isolated from maize field soil. Int. J. Syst. Evol. Micr 2021, 71, 005038. [Google Scholar] [CrossRef] [Scilit]
- Su, X.; Gao, Y.; Yang, R. Gut Microbiota-Derived Tryptophan Metabolites Maintain Gut and Systemic Homeostasis. Cells 2022, 11, 2296. [Google Scholar] [CrossRef] [Scilit]







| Item | Inflammatory Cell Infiltration | Lamina Propria Edema | Acinar Dilation | Goblet Cells Decrease | Fibrosis |
|---|---|---|---|---|---|
| 0 | No lesions | No lesions | No lesions | No lesions | No lesions |
| 1 | Mild | Mild edema | Mild | Mild | Mild |
| 2 | Moderate, mucosa inflammatory cell infiltration | Marked edema | Marked expansion | Moderate, exfoliated cells | Moderate |
| 3 | Severe, inflammatory cells infiltration submucosa | Severe edema | / | Severe exfoliated cells | Severe |
| 4 | Severe, mucosal severe edema | / | / | / | / |
| Gene Name | Forward Primer Sequence (5′ to 3′) | Reverse Primer Sequence (5′ to 3′) | Size (bp) |
|---|---|---|---|
| GAPDH | AACTTTGGCATTGTGGAAGG | ACACATTGGGGGTAGGAACA | 223 |
| TNF-α | ACCCTCACACTCACAAACCA | GGCAGAGAGGAGGTTGACTT | 246 |
| IL-1β | TCAGGCAGGCAGTATCACTC | AGCTCATATGGGTCCGACAG | 250 |
| IL-6 | CTGCAAGAGACTTCCATCCAG | AGTGGTATAGACAGGTCTGTTGG | 131 |
| Occludin | AAGTCAACACCTCTGGTGCC | TCATAGTGGTCAGGGTCCGT | 173 |
| RORγt | TCCTGCCACCTTGAGTATAGTC | GTAAGTTGGCCGTCAGTGCTA | 80 |
| NKp46 | AATGGAAACTCGGTGAACATCTG | GGGGTTGCTCGACTTTGAC | 216 |
| IL-17A | ACTCTCCACCGCAATGAAGA | CTCTCAGGCTCCCTCTTCAG | 161 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Fan, Y.; Song, Q.; Li, S.; Tu, J.; Yang, F.; Zeng, X.; Yu, H.; Qiao, S.; Wang, G. Protective Role of Indole-3-Acetic Acid Against Salmonella Typhimurium: Inflammation Moderation and Intestinal Microbiota Restoration. Microorganisms 2024, 12, 2342. https://doi.org/10.3390/microorganisms12112342
Fan Y, Song Q, Li S, Tu J, Yang F, Zeng X, Yu H, Qiao S, Wang G. Protective Role of Indole-3-Acetic Acid Against Salmonella Typhimurium: Inflammation Moderation and Intestinal Microbiota Restoration. Microorganisms. 2024; 12(11):2342. https://doi.org/10.3390/microorganisms12112342
Chicago/Turabian StyleFan, Yuxin, Qinglong Song, Siyu Li, Jiayu Tu, Fengjuan Yang, Xiangfang Zeng, Haitao Yu, Shiyan Qiao, and Gang Wang. 2024. "Protective Role of Indole-3-Acetic Acid Against Salmonella Typhimurium: Inflammation Moderation and Intestinal Microbiota Restoration" Microorganisms 12, no. 11: 2342. https://doi.org/10.3390/microorganisms12112342
APA StyleFan, Y., Song, Q., Li, S., Tu, J., Yang, F., Zeng, X., Yu, H., Qiao, S., & Wang, G. (2024). Protective Role of Indole-3-Acetic Acid Against Salmonella Typhimurium: Inflammation Moderation and Intestinal Microbiota Restoration. Microorganisms, 12(11), 2342. https://doi.org/10.3390/microorganisms12112342
