High-Throughput Short Sequence Typing Schemes for Pseudomonas aeruginosa and Stenotrophomonas maltophilia Pure Culture and Environmental DNA
Abstract
:1. Introduction
2. Materials and Methods
2.1. Development of the HiSST Scheme
2.2. Primer Design and PCR Amplification
2.3. Validation of the HiSST Scheme with Reference Strains
2.4. Validation of Molecular Typing by WGS
2.5. ANI Analyses
2.6. cgSNP Analyses
2.7. SNP and HiSST Profile Analyses
2.8. Validation of the HiSST Scheme with Environmental Samples
2.9. Selective Culture Conditions for P. aeruginosa
2.10. Adaptation of a Selective Agar for S. maltophilia
2.11. Creating HiSST Databases
2.12. Bioinformatical Pipeline for HiSST Analysis
2.13. HiSST Nomenclature and Assignation
2.14. Accession Number(s)
3. Results
3.1. Design of the HiSST Scheme for P. aeruginosa
3.2. Design of the HiSST Scheme for S. maltophilia
3.3. mSM2I Agar Selective for S. maltophilia
3.4. Validation and Application of the HiSST Schemes
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Maiden, M.C.J.; Bygraves, J.A.; Feil, E.; Morelli, G.; Russell, J.E.; Urwin, R.; Zhang, Q.; Zhou, J.; Zurth, K.; Caugant, D.A.; et al. Multilocus Sequence Typing: A Portable Approach to the Identification of Clones within Populations of Pathogenic Microorganisms. Proc. Natl. Acad. Sci. USA 1998, 95, 3140–3145. [Google Scholar] [CrossRef] [PubMed]
- Davis, R.J.; Jensen, S.O.; Van Hal, S.; Espedido, B.; Gordon, A.; Farhat, R.; Chan, R. Whole Genome Sequencing in Real-Time Investigation and Management of a Pseudomonas aeruginosa Outbreak on a Neonatal Intensive Care Unit. Infect. Control Hosp. Epidemiol. 2015, 36, 1058–1064. [Google Scholar] [CrossRef] [PubMed]
- Zingg, W.; Soulake, I.; Baud, D.; Huttner, B.; Pfister, R.; Renzi, G.; Pittet, D.; Schrenzel, J.; Francois, P. Management and Investigation of a Serratia marcescens Outbreak in a Neonatal Unit in Switzerland–the Role of Hand Hygiene and Whole Genome Sequencing. Antimicrob. Resist. Infect. Control 2017, 6, 125. [Google Scholar] [CrossRef] [PubMed]
- Maiden, M.C.J.; van Rensburg, M.J.J.; Bray, J.E.; Earle, S.G.; Ford, S.A.; Jolley, K.A.; McCarthy, N.D. MLST Revisited: The Gene-by-Gene Approach to Bacterial Genomics. Nat. Rev. Microbiol. 2013, 11, 728–736. [Google Scholar] [CrossRef] [PubMed]
- Mellmann, A.; Harmsen, D.; Cummings, C.A.; Zentz, E.B.; Leopold, S.R.; Rico, A.; Prior, K.; Szczepanowski, R.; Ji, Y.; Zhang, W.; et al. Prospective Genomic Characterization of the German Enterohemorrhagic Escherichia coli O104:H4 Outbreak by Rapid next Generation Sequencing Technology. PLoS ONE 2011, 6, e22751. [Google Scholar] [CrossRef] [PubMed]
- Muyzer, G.; De Waal, E.C.; Uitterlinden, A.G. Profiling of Complex Microbial Populations by Denaturing Gradient Gel Electrophoresis Analysis of Polymerase Chain Reaction-Amplified Genes Coding for 16S rRNA. Appl. Environ. Microbiol. 1993, 59, 695–700. [Google Scholar] [CrossRef] [PubMed]
- Chiou, C.-S. Multilocus Variable-Number Tandem Repeat Analysis as a Molecular Tool for Subtyping and Phylogenetic Analysis of Bacterial Pathogens. Expert Rev. Mol. Diagn. 2010, 10, 5–7. [Google Scholar] [CrossRef]
- Lalancette, C.; Charron, D.; Laferrière, C.; Dolcé, P.; Déziel, E.; Prévost, M.; Bédard, E. Hospital Drains as Reservoirs of Pseudomonas aeruginosa: Multiple-Locus Variable-Number of Tandem Repeats Analysis Genotypes Recovered from Faucets, Sink Surfaces and Patients. Pathogens 2017, 6, 36. [Google Scholar] [CrossRef]
- Jolley, K.A.; Bliss, C.M.; Bennett, J.S.; Bratcher, H.B.; Brehony, C.; Colles, F.M.; Wimalarathna, H.; Harrison, O.B.; Sheppard, S.K.; Cody, A.J.; et al. Ribosomal Multilocus Sequence Typing: Universal Characterization of Bacteria from Domain to Strain. Microbiology 2012, 158, 1005–1015. [Google Scholar] [CrossRef]
- Berg, G.; Roskot, N.; Smalla, K. Genotypic and Phenotypic Relationships between Clinical and Environmental Isolates of Stenotrophomonas maltophilia. J. Clin. Microbiol. 1999, 37, 7. [Google Scholar] [CrossRef]
- Wilks, S.A.; Koerfer, V.V.; Prieto, J.A.; Fader, M.; Keevil, C.W. Biofilm Development on Urinary Catheters Promotes the Appearance of Viable but Nonculturable Bacteria. mBio 2021, 12, e03584-20. [Google Scholar] [CrossRef]
- Wingender, J. Hygienically Relevant Microorganisms in Biofilms of Man-Made Water Systems. In Biofilm Highlights; Flemming, H.-C., Wingender, J., Szewzyk, U., Eds.; Springer Series on Biofilms; Springer: Berlin/Heidelberg, Germany, 2011; pp. 189–238. ISBN 978-3-642-19940-0. [Google Scholar]
- Bourdin, T.; Monnier, A.; Benoit, M.-È.; Bédard, E.; Prévost, M.; Quach, C.; Déziel, E.; Constant, P. A High-Throughput Short Sequence Typing Scheme for Serratia marcescens Pure Culture and Environmental DNA. Appl. Environ. Microbiol. 2021, 87, e01399-21. [Google Scholar] [CrossRef] [PubMed]
- Crone, S.; Vives-Flórez, M.; Kvich, L.; Saunders, A.M.; Malone, M.; Nicolaisen, M.H.; Martínez-García, E.; Rojas-Acosta, C.; Gomez-Puerto, M.C.; Calum, H.; et al. The Environmental Occurrence of Pseudomonas aeruginosa. APMIS 2020, 128, 220–231. [Google Scholar] [CrossRef] [PubMed]
- Spiers, A.J.; Buckling, A.; Rainey, P.B. The Causes of Pseudomonas Diversity. Microbiology 2000, 146, 2345–2350. [Google Scholar] [CrossRef] [PubMed]
- Bédard, E.; Laferrière, C.; Charron, D.; Lalancette, C.; Renaud, C.; Desmarais, N.; Déziel, E.; Prévost, M. Post-Outbreak Investigation of Pseudomonas aeruginosa Faucet Contamination by Quantitative Polymerase Chain Reaction and Environmental Factors Affecting Positivity. Infect. Control Hosp. Epidemiol. 2015, 36, 1337–1343. [Google Scholar] [CrossRef] [PubMed]
- Bédard, E.; Prévost, M.; Déziel, E. Pseudomonas aeruginosa in Premise Plumbing of Large Buildings. MicrobiologyOpen 2016, 5, 937–956. [Google Scholar] [CrossRef] [PubMed]
- Garvey, M.I.; Wilkinson, M.A.C.; Holden, K.L.; Martin, T.; Parkes, J.; Holden, E. Tap out: Reducing Waterborne Pseudomonas aeruginosa Transmission in an Intensive Care Unit. J. Hosp. Infect. 2018, 102, 75–81. [Google Scholar] [CrossRef]
- Falkinham, J.O.; Hilborn, E.D.; Arduino, M.J.; Pruden, A.; Edwards, M.A. Epidemiology and Ecology of Opportunistic Premise Plumbing Pathogens: Legionella pneumophila, Mycobacterium avium, and Pseudomonas aeruginosa. Environ. Health Perspect. 2015, 123, 749–758. [Google Scholar] [CrossRef]
- Diorio-Toth, L.; Wallace, M.A.; Farnsworth, C.W.; Wang, B.; Gul, D.; Kwon, J.H.; Andleeb, S.; Burnham, C.-A.D.; Dantas, G. Intensive Care Unit Sinks Are Persistently Colonized with Multidrug Resistant Bacteria and Mobilizable, Resistance-Conferring Plasmids. mSystems 2023, 8, e00206-23. [Google Scholar] [CrossRef]
- Weiner, L.M.; Webb, A.K.; Limbago, B.; Dudeck, M.A.; Patel, J.; Kallen, A.J.; Edwards, J.R.; Sievert, D.M. Antimicrobial-Resistant Pathogens Associated With Healthcare-Associated Infections: Summary of Data Reported to the National Healthcare Safety Network at the Centers for Disease Control and Prevention, 2011–2014. Infect. Control Hosp. Epidemiol. 2016, 37, 1288–1301. [Google Scholar] [CrossRef]
- European Centre for Disease Prevention and Control Healthcare-Associated Infections in Intensive Care Units. In ECDC. Annual Epidemiological Report for 2017; ECDC: Stockholm, Sweden, 2019.
- Morin, C.D.; Déziel, E.; Gauthier, J.; Levesque, R.C.; Lau, G.W. An Organ System-Based Synopsis of Pseudomonas aeruginosa Virulence. Virulence 2021, 12, 1469–1507. [Google Scholar] [CrossRef] [PubMed]
- Qin, S.; Xiao, W.; Zhou, C.; Pu, Q.; Deng, X.; Lan, L.; Liang, H.; Song, X.; Wu, M. Pseudomonas aeruginosa: Pathogenesis, Virulence Factors, Antibiotic Resistance, Interaction with Host, Technology Advances and Emerging Therapeutics. Signal Transduct. Target. Ther. 2022, 7, 1–27. [Google Scholar] [CrossRef]
- Diggle, S.P.; Whiteley, M. Microbe Profile: Pseudomonas aeruginosa: Opportunistic Pathogen and Lab Rat. Microbiology 2020, 166, 30–33. [Google Scholar] [CrossRef] [PubMed]
- Pinot, C.; Deredjian, A.; Nazaret, S.; Brothier, E.; Cournoyer, B.; Segonds, C.; Favre-Bonté, S. Identification of Stenotrophomonas maltophilia Strains Isolated from Environmental and Clinical Samples: A Rapid and Efficient Procedure. J. Appl. Microbiol. 2011, 111, 1185–1193. [Google Scholar] [CrossRef] [PubMed]
- Ryan, R.P.; Monchy, S.; Cardinale, M.; Taghavi, S.; Crossman, L.; Avison, M.B.; Berg, G.; van der Lelie, D.; Dow, J.M. The Versatility and Adaptation of Bacteria from the Genus Stenotrophomonas. Nat. Rev. Microbiol. 2009, 7, 514–525. [Google Scholar] [CrossRef] [PubMed]
- Brooke, J.S. Stenotrophomonas maltophilia: An Emerging Global Opportunistic Pathogen. Clin. Microbiol. Rev. 2012, 25, 2–41. [Google Scholar] [CrossRef]
- Apisarnthanarak, A.; Fraser, V.J.; Dunne, W.M.; Little, J.R.; Hoppe-Bauer, J.; Mayfield, J.L.; Polish, L.B. Stenotrophomonas maltophilia Intestinal Colonization in Hospitalized Oncology Patients with Diarrhea. Clin. Infect. Dis. 2003, 37, 1131–1135. [Google Scholar] [CrossRef]
- Falkinham, J.O.; Pruden, A.; Edwards, M. Opportunistic Premise Plumbing Pathogens: Increasingly Important Pathogens in Drinking Water. Pathogens 2015, 4, 373–386. [Google Scholar] [CrossRef]
- Juhnke, M.E.; des Jardin, E. Selective Medium for Isolation of Xanthomonas maltophilia from Soil and Rhizosphere Environments. Appl. Environ. Microbiol. 1989, 55, 747–750. [Google Scholar] [CrossRef]
- Kerr, K.G.; Denton, M.; Todd, N.; Corps, C.M.; Kumari, P.; Hawkey, P.M. A New Selective Differential Medium for Isolation of Stenotrophomonas maltophilia. Eur. J. Clin. Microbiol. Infect. Dis. 1996, 15, 607–610. [Google Scholar] [CrossRef]
- Foster, N.F.; Chang, B.J.; Riley, T.V. Evaluation of a Modified Selective Differential Medium for the Isolation of Stenotrophomonas maltophilia. J. Microbiol. Methods 2008, 75, 153–155. [Google Scholar] [CrossRef] [PubMed]
- Adjidé, C.C.; De Meyer, A.; Weyer, M.; Obin, O.; Lamory, F.; Lesueur, C.; Trouillet, L.; Biendo, M.; Ganry, O.; Eb, F. La Mise Au Point d’un Milieu Sensible, Spécifique et Prédictif de Recherche de Stenotrophomonas maltophilia Dans l’environnement Des Soins. Pathol. Biol. 2010, 58, 11–17. [Google Scholar] [CrossRef] [PubMed]
- Curran, B.; Jonas, D.; Grundmann, H.; Pitt, T.; Dowson, C.G. Development of a Multilocus Sequence Typing Scheme for the Opportunistic Pathogen Pseudomonas aeruginosa. J. Clin. Microbiol. 2004, 42, 5644–5649. [Google Scholar] [CrossRef] [PubMed]
- Kaiser, S.; Biehler, K.; Jonas, D. A Stenotrophomonas maltophilia Multilocus Sequence Typing Scheme for Inferring Population Structure. J. Bacteriol. 2009, 191, 2934–2943. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.-Y.; Chiou, C.-S.; Chen, C.-C. PGAdb-Builder: A Web Service Tool for Creating Pan-Genome Allele Database for Molecular Fine Typing. Sci. Rep. 2016, 6, 36213. [Google Scholar] [CrossRef]
- Hall, T.A. BioEdit: A User-Friendly Biological Sequence Alignment Editor and Analysis Program for Windows 95/98/NT. Nucl. Acids. Symp. Ser. 1999, 41, 95–98. [Google Scholar]
- Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic Local Alignment Search Tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
- Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S.; Madden, T.L. Primer-BLAST: A Tool to Design Target-Specific Primers for Polymerase Chain Reaction. BMC Bioinform. 2012, 13, 134. [Google Scholar] [CrossRef]
- Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A Flexible Trimmer for Illumina Sequence Data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef]
- Bankevich, A.; Nurk, S.; Antipov, D.; Gurevich, A.A.; Dvorkin, M.; Kulikov, A.S.; Lesin, V.M.; Nikolenko, S.I.; Pham, S.; Prjibelski, A.D.; et al. SPAdes: A New Genome Assembly Algorithm and Its Applications to Single-Cell Sequencing. J. Comput. Biol. 2012, 19, 455–477. [Google Scholar] [CrossRef]
- Wick, R.R.; Schultz, M.B.; Zobel, J.; Holt, K.E. Bandage: Interactive Visualization of de Novo Genome Assemblies. Bioinformatics 2015, 31, 3350–3352. [Google Scholar] [CrossRef] [PubMed]
- Assefa, S.; Keane, T.M.; Otto, T.D.; Newbold, C.; Berriman, M. ABACAS: Algorithm-Based Automatic Contiguation of Assembled Sequences. Bioinformatics 2009, 25, 1968–1969. [Google Scholar] [CrossRef] [PubMed]
- RStudio v2023.09: Integrated Development for R. Available online: https://github.com/rstudio/rstudio (accessed on 7 August 2023).
- Gu, Z.; Gu, L.; Eils, R.; Schlesner, M.; Brors, B. Circlize Implements and Enhances Circular Visualization in R. Bioinformatics 2014, 30, 2811–2812. [Google Scholar] [CrossRef] [PubMed]
- Gu, Z.; Eils, R.; Schlesner, M. Complex Heatmaps Reveal Patterns and Correlations in Multidimensional Genomic Data. Bioinformatics 2016, 32, 2847–2849. [Google Scholar] [CrossRef] [PubMed]
- Seemann, T. Snippy: Fast Bacterial Variant Calling from NGS Reads. Available online: https://github.com/tseemann/snippy (accessed on 28 August 2023).
- Danecek, P.; Auton, A.; Abecasis, G.; Albers, C.A.; Banks, E.; DePristo, M.A.; Handsaker, R.E.; Lunter, G.; Marth, G.T.; Sherry, S.T.; et al. The Variant Call Format and VCFtools. Bioinformatics 2011, 27, 2156–2158. [Google Scholar] [CrossRef] [PubMed]
- Dereeper, A.; Homa, F.; Andres, G.; Sempere, G.; Sarah, G.; Hueber, Y.; Dufayard, J.-F.; Ruiz, M. SNiPlay3: A Web-Based Application for Exploration and Large Scale Analyses of Genomic Variations. Nucleic Acids Res. 2015, 43, W295–W300. [Google Scholar] [CrossRef] [PubMed]
- Paradis, E.; Schliep, K. Ape 5.0: An Environment for Modern Phylogenetics and Evolutionary Analyses in R. Bioinformatics 2019, 35, 526–528. [Google Scholar] [CrossRef] [PubMed]
- Nascimento, M.; Sousa, A.; Ramirez, M.; Francisco, A.P.; Carriço, J.A.; Vaz, C. PHYLOViZ 2.0: Providing Scalable Data Integration and Visualization for Multiple Phylogenetic Inference Methods. Bioinformatics 2017, 33, 128–129. [Google Scholar] [CrossRef]
- Feil, E.J.; Li, B.C.; Aanensen, D.M.; Hanage, W.P.; Spratt, B.G. eBURST: Inferring Patterns of Evolutionary Descent among Clusters of Related Bacterial Genotypes from Multilocus Sequence Typing Data. J. Bacteriol. 2004, 186, 1518–1530. [Google Scholar] [CrossRef]
- Brown, V.I.; Lowbury, E.J.L. Use of an Improved Cetrimide Agar Medium and Other Culture Methods for Pseudomonas aeruginosa. J. Clin. Pathol. 1965, 18, 752–756. [Google Scholar] [CrossRef]
- Camacho, C.; Coulouris, G.; Avagyan, V.; Ma, N.; Papadopoulos, J.; Bealer, K.; Madden, T.L. BLAST+: Architecture and Applications. BMC Bioinform. 2009, 10, 421. [Google Scholar] [CrossRef] [PubMed]
- Callahan, B.J.; McMurdie, P.J.; Rosen, M.J.; Han, A.W.; Johnson, A.J.A.; Holmes, S.P. DADA2: High-Resolution Sample Inference from Illumina Amplicon Data. Nat. Methods 2016, 13, 581–583. [Google Scholar] [CrossRef] [PubMed]
- Martin, M. Cutadapt Removes Adapter Sequences from High-Throughput Sequencing Reads. EMBnet J. 2011, 17, 10–12. [Google Scholar] [CrossRef]
- Nikolaidis, M.; Mossialos, D.; Oliver, S.G.; Amoutzias, G.D. Comparative Analysis of the Core Proteomes among the Pseudomonas Major Evolutionary Groups Reveals Species-Specific Adaptations for Pseudomonas aeruginosa and Pseudomonas chlororaphis. Diversity 2020, 12, 289. [Google Scholar] [CrossRef]
- Rudra, B.; Duncan, L.; Shah, A.J.; Shah, H.N.; Gupta, R.S. Phylogenomic and Comparative Genomic Studies Robustly Demarcate Two Distinct Clades of Pseudomonas aeruginosa Strains: Proposal to Transfer the Strains from an Outlier Clade to a Novel Species Pseudomonas paraeruginosa sp. Nov. Int. J. Syst. Evol. Microbiol. 2022, 72. [Google Scholar] [CrossRef] [PubMed]
- Shen, K.; Sayeed, S.; Antalis, P.; Gladitz, J.; Ahmed, A.; Dice, B.; Janto, B.; Dopico, R.; Keefe, R.; Hayes, J.; et al. Extensive Genomic Plasticity in Pseudomonas aeruginosa Revealed by Identification and Distribution Studies of Novel Genes among Clinical Isolates. Infect. Immun. 2006, 74, 5272–5283. [Google Scholar] [CrossRef]
- Freschi, L.; Vincent, A.T.; Jeukens, J.; Emond-Rheault, J.-G.; Kukavica-Ibrulj, I.; Dupont, M.-J.; Charette, S.J.; Boyle, B.; Levesque, R.C. The Pseudomonas aeruginosa Pan-Genome Provides New Insights on Its Population Structure, Horizontal Gene Transfer, and Pathogenicity. Genome Biol. Evol. 2019, 11, 109–120. [Google Scholar] [CrossRef]
- Bourdin, T.; Benoit, M.-È.; Monnier, A.; Bédard, E.; Prévost, M.; Charron, D.; Audy, N.; Gravel, S.; Sicard, M.; Quach, C.; et al. Serratia marcescens Colonization in a Neonatal Intensive Care Unit Has Multiple Sources, with Sink Drains as a Major Reservoir. Appl. Environ. Microbiol. 2023, 89, e00105-23. [Google Scholar] [CrossRef]
- Magalhães, B.; Valot, B.; Abdelbary, M.M.H.; Prod’hom, G.; Greub, G.; Senn, L.; Blanc, D.S. Combining Standard Molecular Typing and Whole Genome Sequencing to Investigate Pseudomonas aeruginosa Epidemiology in Intensive Care Units. Front. Public Health 2020, 8, 3. [Google Scholar] [CrossRef]
Species | Locus | Primer Sequence (5′–3′) F: Forward; R: Reverse | PCR Amplicon Length | PCR Cycling Conditions | |
---|---|---|---|---|---|
Pseudomonas aeruginosa | bvgS | F | ACGGCGACGARCTGTTGC | 310 | Initial denaturation at 95 °C for 5 min, followed by 35 cycles at 95 °C for 20 s, 60 °C for 40 s, 72 °C for 30 s and a final extension period of 5 min at 72 °C. |
R | GGCATGGTCGGCGTAACC | ||||
pheT | F | GCGTGGACTTCTTCGACGC | 271 | Initial denaturation at 95 °C for 5 min, followed by 35 cycles at 95 °C for 20 s, 58 °C for 40 s, 72 °C for 30 s and a final extension period of 5 min at 72 °C. | |
R | GACAGCTCGCGGAACTTCG | ||||
btuB | F | GCCAAGCCGTTCTTCTCCG | 330 | Initial denaturation at 95 °C for 5 min, followed by 35 cycles at 95 °C for 20 s, 58 °C for 40 s, 72 °C for 30 s and a final extension period of 5 min at 72 °C. | |
R | CAGGTTCTGCTCGCCGTC | ||||
sdaA | F | ATCGTCGAGGACCGCACG | 327 | Initial denaturation at 95 °C for 5 min, followed by 35 cycles at 95 °C for 20 s, 60 °C for 40 s, 72 °C for 30 s and a final extension period of 5 min at 72 °C. | |
R | GTAGAGRTTGACCCAGTCGAGC | ||||
Stenotrophomonas maltophilia | yvoA | F | CCGAGAGCGGCATGATCGA | 233 | Initial denaturation at 95 °C for 5 min, followed by 35 cycles at 95 °C for 20 s, 60 °C for 40 s, 72 °C for 30 s and a final extension period of 5 min at 72 °C. |
R | CAGGCARCGCATCGCCA | ||||
glnG | F | GTGATGTCGGCCTAYACCG | 299 | Initial denaturation at 95 °C for 5 min, followed by 35 cycles at 95 °C for 20 s, 58 °C for 40 s, 72 °C for 30 s and a final extension period of 5 min at 72 °C. | |
R | GCCACCAGYTCCTTGCC | ||||
tycC | F | TGTACACCGARCAGGTCGAG | 249 | Initial denaturation at 95 °C for 5 min, followed by 35 cycles at 95 °C for 20 s, 58 °C for 40 s, 72 °C for 30 s and a final extension period of 5 min at 72 °C. | |
R | TCTTGGCGTTGTGACGGATATC | ||||
ribA | F | CTGCCCTCGYTGGGCTA | 327 | Initial denaturation at 95 °C for 5 min, followed by 35 cycles at 95 °C for 20 s, 60 °C for 40 s, 72 °C for 30 s and a final extension period of 5 min at 72 °C. |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bourdin, T.; Benoit, M.-È.; Bédard, E.; Prévost, M.; Quach, C.; Déziel, E.; Constant, P. High-Throughput Short Sequence Typing Schemes for Pseudomonas aeruginosa and Stenotrophomonas maltophilia Pure Culture and Environmental DNA. Microorganisms 2024, 12, 48. https://doi.org/10.3390/microorganisms12010048
Bourdin T, Benoit M-È, Bédard E, Prévost M, Quach C, Déziel E, Constant P. High-Throughput Short Sequence Typing Schemes for Pseudomonas aeruginosa and Stenotrophomonas maltophilia Pure Culture and Environmental DNA. Microorganisms. 2024; 12(1):48. https://doi.org/10.3390/microorganisms12010048
Chicago/Turabian StyleBourdin, Thibault, Marie-Ève Benoit, Emilie Bédard, Michèle Prévost, Caroline Quach, Eric Déziel, and Philippe Constant. 2024. "High-Throughput Short Sequence Typing Schemes for Pseudomonas aeruginosa and Stenotrophomonas maltophilia Pure Culture and Environmental DNA" Microorganisms 12, no. 1: 48. https://doi.org/10.3390/microorganisms12010048
APA StyleBourdin, T., Benoit, M.-È., Bédard, E., Prévost, M., Quach, C., Déziel, E., & Constant, P. (2024). High-Throughput Short Sequence Typing Schemes for Pseudomonas aeruginosa and Stenotrophomonas maltophilia Pure Culture and Environmental DNA. Microorganisms, 12(1), 48. https://doi.org/10.3390/microorganisms12010048