Molecular Surveillance for Bocaparvoviruses and Bufaviruses in the European Hedgehog (Erinaceus europaeus)
Abstract
1. Introduction
2. Materials and Methods
2.1. Sampling
2.2. DNA Extraction from Tissue Samples
2.3. Detection of Parvoviruses
2.4. Genome Sequencing and Phylogenetic Analysis
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Pénzes, J.J.; de Souza, W.M.; Agbandje-McKenna, M.; Gifford, R.J. An Ancient Lineage of Highly Divergent Parvoviruses Infects Both Vertebrate and Invertebrate Hosts. Viruses 2019, 11, 525. [Google Scholar] [CrossRef]
- Pénzes, J.J.; Söderlund-Venermo, M.; Canuti, M.; Eis-Hübinger, A.M.; Hughes, J.; Cotmore, S.F.; Harrach, B. Reorganizing the Family Parvoviridae: A Revised Taxonomy Independent of the Canonical Approach Based on Host Association. Arch. Virol. 2020, 165, 2133–2146. [Google Scholar] [CrossRef]
- Cotmore, S.F.; Agbandje-McKenna, M.; Canuti, M.; Chiorini, J.A.; Eis-Hubinger, A.-M.; Hughes, J.; Mietzsch, M.; Modha, S.; Ogliastro, M.; Pénzes, J.J.; et al. ICTV virus taxonomy profile: Parvoviridae. J. Gen. Virol. 2019, 100, 367–368. [Google Scholar] [CrossRef]
- Jager, M.C.; Tomlinson, J.E.; Lopez-Astacio, R.A.; Parrish, C.R.; Van de Walle, G.R. Small but Mighty: Old and New Parvoviruses of Veterinary Significance. Virol. J. 2021, 18, 210. [Google Scholar] [CrossRef]
- Kapoor, A.; Mehta, N.; Dubovi, E.J.; Simmonds, P.; Govindasamy, L.; Medina, J.L.; Street, C.; Shields, S.; Lipkin, W.I. Characterization of Novel Canine Bocaviruses and Their Association with Respiratory Disease. J. Gen. Virol. 2012, 93, 341–346. [Google Scholar] [CrossRef] [PubMed]
- Li, L.; Pesavento, P.A.; Leutenegger, C.M.; Estrada, M.; Coffey, L.L.; Naccache, S.N.; Samayoa, E.; Chiu, C.; Qiu, J.; Wang, C.; et al. A Novel Bocavirus in Canine Liver. Virol. J. 2013, 10, 54. [Google Scholar] [CrossRef] [PubMed]
- Martella, V.; Lanave, G.; Mihalov-Kovács, E.; Marton, S.; Varga-Kugler, R.; Kaszab, E.; Di Martino, B.; Camero, M.; Decaro, N.; Buonavoglia, C.; et al. Novel Parvovirus Related to Primate Bufaviruses in Dogs. Emerg. Infect. Dis. 2018, 24, 1061–1068. [Google Scholar] [CrossRef]
- Lau, S.K.P.; Woo, P.C.Y.; Yeung, H.C.; Teng, J.L.L.; Wu, Y.; Bai, R.; Fan, R.Y.Y.; Chan, K.-H.; Yuen, K.-Y. Identification and Characterization of Bocaviruses in Cats and Dogs Reveals a Novel Feline Bocavirus and a Novel Genetic Group of Canine Bocavirus. J. Gen. Virol. 2012, 93, 1573–1582. [Google Scholar] [CrossRef]
- Ng, T.F.F.; Mesquita, J.R.; Nascimento, M.S.J.; Kondov, N.O.; Wong, W.; Reuter, G.; Knowles, N.J.; Vega, E.; Esona, M.D.; Deng, X.; et al. Feline Fecal Virome Reveals Novel and Prevalent Enteric Viruses. Vet. Microbiol. 2014, 171, 102–111. [Google Scholar] [CrossRef]
- Zhang, W.; Li, L.; Deng, X.; Kapusinszky, B.; Pesavento, P.A.; Delwart, E. Faecal Virome of Cats in an Animal Shelter. J. Gen. Virol. 2014, 95, 2553–2564. [Google Scholar] [CrossRef]
- Diakoudi, G.; Lanave, G.; Capozza, P.; Di Profio, F.; Melegari, I.; Di Martino, B.; Pennisi, M.G.; Elia, G.; Cavalli, A.; Tempesta, M.; et al. Identification of a Novel Parvovirus in Domestic Cats. Vet. Microbiol. 2019, 228, 246–251. [Google Scholar] [CrossRef] [PubMed]
- van den Brand, J.M.A.; van Leeuwen, M.; Schapendonk, C.M.; Simon, J.H.; Haagmans, B.L.; Osterhaus, A.D.M.E.; Smits, S.L. Metagenomic Analysis of the Viral Flora of Pine Marten and European Badger Feces. J. Virol. 2012, 86, 2360–2365. [Google Scholar] [CrossRef]
- Yang, S.; Wang, Y.; Li, W.; Fan, Z.; Jiang, L.; Lin, Y.; Fu, X.; Shen, Q.; Sun, Z.; Wang, X.; et al. A Novel Bocavirus from Domestic Mink, China. Virus Genes 2016, 52, 887–890. [Google Scholar] [CrossRef] [PubMed]
- Siqueira, J.D.; Ng, T.F.; Miller, M.; Li, L.; Deng, X.; Dodd, E.; Batac, F.; Delwart, E. Endemic Infection of Stranded Southern Sea Otters (Enhydra lutris nereis) with Novel Parvovirus, Polyomavirus, and Adenovirus. J. Wildl. Dis. 2017, 53, 532–542. [Google Scholar] [CrossRef] [PubMed]
- Melegari, I.; Di Profio, F.; Palombieri, A.; Sarchese, V.; Diakoudi, G.; Robetto, S.; Orusa, R.; Marsilio, F.; Bányai, K.; Martella, V.; et al. Molecular Detection of Canine Bufaviruses in Wild Canids. Arch. Virol. 2019, 164, 2315–2320. [Google Scholar] [CrossRef] [PubMed]
- Bodewes, R.; Lapp, S.; Hahn, K.; Habierski, A.; Förster, C.; König, M.; Wohlsein, P.; Osterhaus, A.D.M.E.; Baumgärtner, W. Novel Canine Bocavirus Strain Associated with Severe Enteritis in a Dog Litter. Vet. Microbiol. 2014, 174, 1–8. [Google Scholar] [CrossRef]
- Canuti, M.; Bouchard, É.; Rodrigues, B.; Whitney, H.G.; Hopson, M.; Gilroy, C.; Stenson, G.; Dufour, S.C.; Lang, A.S.; Verhoeven, J.T.P. Newlavirus, a Novel, Highly Prevalent, and Highly Diverse Protoparvovirus of Foxes (Vulpes Spp.). Viruses 2021, 13, 1969. [Google Scholar] [CrossRef]
- He, W.T.; Hou, X.; Zhao, J.; Sun, J.; He, H.; Si, W.; Wang, J.; Jiang, Z.; Yan, Z.; Xing, G.; et al. Virome Characterization of Game Animals in China Reveals a Spectrum of Emerging Pathogens. Cell 2022, 185, 1117–1129.e8. [Google Scholar] [CrossRef]
- Lanave, G.; Diakoudi, G.; Pellegrini, F.; Lombardi, R.; Prioletti, M.; Circella, E.; Camarda, A.; Di Martino, B.; Camero, M.; Decaro, N.; et al. Novel parvovirus in an outbreak of fatal enteritis in European hedgehogs (Erinaceus europaeus), Italy, 2022. Microbiol. Spectr. 2023, 11, e0249423. [Google Scholar] [CrossRef]
- Kränzlin, B.; Wohlsein, P.; Dubberke, M.; Kuczka, A. Parvovirusinfektion bei Igeln (Erinaceus europaeus). Kleintierpraxis 1993, 38, 675–678. [Google Scholar]
- Di Martino, B.; Sarchese, V.; Di Profio, F.; Palombieri, A.; Melegari, I.; Fruci, P.; Aste, G.; Bányai, K.; Fulvio, M.; Martella, V. Genetic Heterogeneity of Canine Bufaviruses. Transbound. Emerg. Dis. 2021, 68, 802–812. [Google Scholar] [CrossRef] [PubMed]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef]
- Shan, T.; Lan, D.; Li, L.; Wang, C.; Cui, L.; Zhang, W.; Hua, X.; Zhu, C.; Zhao, W.; Delwart, E. Genomic Characterization and High Prevalence of Bocaviruses in Swine. PLoS ONE 2011, 6, e17292. [Google Scholar] [CrossRef] [PubMed]
- Meng, Q.; Qiao, M.; Gong, S.; Tian, L.; Li, C.; Qiao, J.; Meng, D.; Wu, Y.; Cai, K.; Zhang, Z.; et al. Molecular Detection and Genetic Diversity of Porcine Bocavirus in Piglets in China. Acta Virol. 2018, 62, 343–349. [Google Scholar] [CrossRef]
- He, Y.; Chen, W.; Fan, J.; Fan, S.; Ding, H.; Chen, J.; Yi, L. Recombinase-Aided Amplification Coupled with Lateral Flow Dipstick for Efficient and Accurate Detection of Porcine Parvovirus. Life 2021, 11, 762. [Google Scholar] [CrossRef] [PubMed]
- Yoo, S.J.; Sunwoo, S.Y.; Ko, S.S.; Je, S.H.; Lee, D.U.; Lyoo, Y.S. A Novel Porcine Bocavirus Harbors a Variant NP Gene. Springerplus 2015, 4, 370. [Google Scholar] [CrossRef]
- Conceição-Neto, N.; Theuns, S.; Cui, T.; Zeller, M.; Yinda, C.K.; Christiaens, I.; Heylen, E.; Van Ranst, M.; Carpentier, S.; Nauwynck, H.J.; et al. Identification of an Enterovirus Recombinant with a Torovirus-like Gene Insertion during a Diarrhea Outbreak in Fattening Pigs. Virus Evol. 2017, 3, vex024. [Google Scholar] [CrossRef]
- Amimo, J.O.; Njuguna, J.; Machuka, E.; Okoth, E.; Djikeng, A. First Complete Genome Sequences of Porcine Bocavirus Strains from East Africa. Genome Announc. 2017, 5, e00093-17. [Google Scholar] [CrossRef]
- Paim, W.P.; Maggioli, M.F.; Weber, M.N.; Rezabek, G.; Narayanan, S.; Ramachandran, A.; Canal, C.W.; Bauermann, F.V. Virome Characterization in Serum of Healthy Show Pigs Raised in Oklahoma Demonstrated Great Diversity of SsDNA Viruses. Virology 2021, 556, 87–95. [Google Scholar] [CrossRef]
- Wang, Y.; Zhao, J.; Zheng, M.; Liu, Z.; Yuan, J.; Zhao, J.; Shen, Q.; Fan, Z.; Jiang, L.; Yang, S. Genome Sequence of a Porcine Bocavirus Detected in Feces of Domestic Minks in China. Genome Announc. 2017, 5, e01170-17. [Google Scholar] [CrossRef]
- Williams, S.H.; Che, X.; Garcia, J.A.; Klena, J.D.; Lee, B.; Muller, D.; Ulrich, W.; Corrigan, R.M.; Nichol, S.; Jain, K.; et al. Viral Diversity of House Mice in New York City. mBio 2018, 9, e01354-17. [Google Scholar] [CrossRef]
- Zhang, C.; Song, F.; Xiu, L.; Liu, Y.; Yang, J.; Yao, L.; Peng, J. Identification and Characterization of a Novel Rodent Bocavirus from Different Rodent Species in China. Emerg. Microbes Infect. 2018, 7, 48. [Google Scholar] [CrossRef] [PubMed]
- Xiong, Y.-Q.; You, F.-F.; Chen, X.-J.; Chen, Y.-X.; Wen, Y.-Q.; Chen, Q. Detection and Phylogenetic Analysis of Porcine Bocaviruses Carried by Murine Rodents and House Shrews in China. Transbound. Emerg. Dis. 2019, 66, 259–267. [Google Scholar] [CrossRef]
- He, W.; Gao, Y.; Wen, Y.; Ke, X.; Ou, Z.; Fu, J.; Cheng, M.; Mo, Y.; Chen, Q. Ungulate Bocaparvovirus 4 and Rodent Bocavirus Are Different Genotypes of the Same Species of Virus. Virol. Sin. 2022, 37, 215–222. [Google Scholar] [CrossRef]
- Hargitai, R.; Pankovics, P.; Kertész, A.M.; Bíró, H.; Boros, Á.; Phan, T.G.; Delwart, E.; Reuter, G. Detection and Genetic Characterization of a Novel Parvovirus Distantly Related to Human Bufavirus in Domestic Pigs. Arch. Virol. 2016, 161, 1033–1037. [Google Scholar] [CrossRef] [PubMed]
- Kozak, M. Pushing the Limits of the Scanning Mechanism for Initiation of Translation. Gene 2002, 299, 1–34. [Google Scholar] [CrossRef]
- Ilyina, T.V.; Koonin, E.V. Conserved Sequence Motifs in the Initiator Proteins for Rolling Circle DNA Replication Encoded by Diverse Replicons from Eubacteria, Eucaryotes and Archaebacteria. Nucleic Acids Res. 1992, 20, 3279–3285. [Google Scholar] [CrossRef] [PubMed]
- Walker, J.E.; Saraste, M.; Runswick, M.J.; Gay, N.J. Distantly Related Sequences in the Alpha- and Beta-Subunits of ATP Synthase, Myosin, Kinases and Other ATP-Requiring Enzymes and a Common Nucleotide Binding Fold. EMBO J. 1982, 1, 945–951. [Google Scholar] [CrossRef]
- James, J.A.; Escalante, C.R.; Yoon-Robarts, M.; Edwards, T.A.; Linden, R.M.; Aggarwal, A.K. Crystal Structure of the SF3 Helicase from Adeno-Associated Virus Type 2. Structure 2003, 11, 1025–1035. [Google Scholar] [CrossRef]
- Yang, S.; Liu, D.; Wang, Y.; Qu, F.; He, Y.; Sun, Z.; Shen, Q.; Li, W.; Fu, X.; Deng, X.; et al. Bufavirus Protoparvovirus in feces of wild rats in China. Virus Genes 2016, 52, 130–133. [Google Scholar] [CrossRef]
- Sun, W.; Zhang, S.; Huang, H.; Wang, W.; Cao, L.; Zheng, M.; Yin, Y.; Zhang, H.; Lu, H.; Jin, N. First Identification of a Novel Parvovirus Distantly Related to Human Bufavirus from Diarrheal Dogs in China. Virus Res. 2019, 265, 127–131. [Google Scholar] [CrossRef] [PubMed]
- Sasaki, M.; Orba, Y.; Anindita, P.D.; Ishii, A.; Ueno, K.; Hang’ombe, B.M.; Mweene, A.S.; Ito, K.; Sawa, H. Distinct Lineages of Bufavirus in Wild Shrews and Nonhuman Primates. Emerg. Infect. Dis. 2015, 21, 1230–1233. [Google Scholar] [CrossRef]
- Liu, L.; Schwarz, L.; Ullman, K.; Ahola, H.; Qiu, Y.; Ma, Z.; Hennig-Pauka, I. Identification of a Novel Bufavirus in Domestic Pigs by a Viral Metagenomic Approach. J. Gen. Virol. 2016, 97, 1592–1596. [Google Scholar] [CrossRef]
- Handley, S.A.; Thackray, L.B.; Zhao, G.; Presti, R.; Miller, A.D.; Droit, L.; Abbink, P.; Maxfield, L.F.; Kambal, A.; Duan, E.; et al. Pathogenic Simian Immunodeficiency Virus Infection Is Associated with Expansion of the Enteric Virome. Cell 2012, 151, 253–266. [Google Scholar] [CrossRef] [PubMed]
- Phan, T.G.; Vo, N.P.; Bonkoungou, I.J.O.; Kapoor, A.; Barro, N.; O’Ryan, M.; Kapusinszky, B.; Wang, C.; Delwart, E. Acute Diarrhea in West African Children: Diverse Enteric Viruses and a Novel Parvovirus Genus. J. Virol. 2012, 86, 11024–11030. [Google Scholar] [CrossRef]
- Yahiro, T.; Wangchuk, S.; Tshering, K.; Bandhari, P.; Zangmo, S.; Dorji, T.; Tshering, K.; Matsumoto, T.; Nishizono, A.; Söderlund-Venermo, M.; et al. Novel Human Bufavirus Genotype 3 in Children with Severe Diarrhea, Bhutan. Emerg. Infect. Dis. 2014, 20, 1037–1039. [Google Scholar] [CrossRef] [PubMed]
- Phan, T.G.; Dreno, B.; da Costa, A.C.; Li, L.; Orlandi, P.; Deng, X.; Kapusinszky, B.; Siqueira, J.; Knol, A.-C.; Halary, F.; et al. A New Protoparvovirus in Human Fecal Samples and Cutaneous T Cell Lymphomas (Mycosis Fungoides). Virology 2016, 496, 299–305. [Google Scholar] [CrossRef]
- Sasaki, M.; Gonzalez, G.; Wada, Y.; Setiyono, A.; Handharyani, E.; Rahmadani, I.; Taha, S.; Adiani, S.; Latief, M.; Kholilullah, Z.A.; et al. Divergent Bufavirus Harboured in Megabats Represents a New Lineage of Parvoviruses. Sci. Rep. 2016, 6, 24257. [Google Scholar] [CrossRef]
- Wu, Z.; Yang, L.; Ren, X.; He, G.; Zhang, J.; Yang, J.; Qian, Z.; Dong, J.; Sun, L.; Zhu, Y.; et al. Deciphering the Bat Virome Catalog to Better Understand the Ecological Diversity of Bat Viruses and the Bat Origin of Emerging Infectious Diseases. ISME J. 2016, 10, 609–620. [Google Scholar] [CrossRef]
- Li, J.; Cui, L.; Deng, X.; Yu, X.; Zhang, Z.; Yang, Z.; Delwart, E.; Zhang, W.; Hua, X. Canine Bufavirus in Faeces and Plasma of Dogs with Diarrhoea, China. Emerg. Microbes Infect. 2019, 8, 245–247. [Google Scholar] [CrossRef]
- Allander, T.; Tammi, M.T.; Eriksson, M.; Bjerkner, A.; Tiveljung-Lindell, A.; Andersson, B. Cloning of a human parvovirus by molecular screening of respiratory tract samples. Proc. Natl. Acad. Sci. USA 2005, 102, 12891–12896. [Google Scholar] [CrossRef]
- Binn, L.N.; Lazar, E.C.; Eddy, G.A.; Kajima, M. Recovery and Characterization of a Minute Virus of Canines. Infect. Immun. 1970, 1, 503–508. [Google Scholar] [CrossRef] [PubMed]
- Storz, J.; Leary, J.J.; Carlson, J.H.; Bates, R.C. Parvoviruses Associated with Diarrhea in Calves. J. Am. Vet. Med. Assoc. 1978, 173, 624–627. [Google Scholar] [PubMed]
- Mochizuki, M.; Hashimoto, M.; Hajima, T.; Takiguchi, M.; Hashimoto, A.; Une, Y.; Roerink, F.; Ohshima, T.; Parrish, C.R.; Carmichael, L.E. Virologic and Serologic Identification of Minute Virus of Canines (Canine Parvovirus Type 1) from Dogs in Japan. J. Clin. Microbiol. 2002, 40, 3993–3998. [Google Scholar] [CrossRef] [PubMed]
- Lau, S.K.P.; Yip, C.C.Y.; Que, T.-L.; Lee, R.A.; Au-Yeung, R.K.H.; Zhou, B.; So, L.-Y.; Lau, Y.-L.; Chan, K.-H.; Woo, P.C.Y.; et al. Clinical and Molecular Epidemiology of Human Bocavirus in Respiratory and Fecal Samples from Children in Hong Kong. J. Infect. Dis. 2007, 196, 986–993. [Google Scholar] [CrossRef] [PubMed]
- Sloots, T.P.; McErlean, P.; Speicher, D.J.; Arden, K.E.; Nissen, M.D.; Mackay, I.M. Evidence of Human Coronavirus HKU1 and Human Bocavirus in Australian Children. J. Clin. Virol. 2006, 35, 99–102. [Google Scholar] [CrossRef] [PubMed]
- Söderlund-Venermo, M.; Lahtinen, A.; Jartti, T.; Hedman, L.; Kemppainen, K.; Lehtinen, P.; Allander, T.; Ruuskanen, O.; Hedman, K. Clinical Assessment and Improved Diagnosis of Bocavirus-Induced Wheezing in Children, Finland. Emerg. Infect. Dis. 2009, 15, 1423–1430. [Google Scholar] [CrossRef]
- Priestnall, S.L.; Mitchell, J.A.; Walker, C.A.; Erles, K.; Brownlie, J. New and Emerging Pathogens in Canine Infectious Respiratory Disease. Vet. Pathol. 2014, 51, 492–504. [Google Scholar] [CrossRef]
- Verbeke, V.; Reynders, M.; Floré, K.; Vandewal, W.; Debulpaep, S.; Sauer, K.; Cardoen, F.; Padalko, E. Human Bocavirus Infection in Belgian Children with Respiratory Tract Disease. Arch. Virol. 2019, 164, 2919–2930. [Google Scholar] [CrossRef]
- Lin, M.Y.-C.; Chan, H.-C.; Chi, H.; Chiu, S.-C.; Nora-Krukle, Z.; Rasa-Dzelzkaleja, S.; Vilmane, A.; Murovska, M.; Lin, J.-H.; Liu, H.-F. Genetic Diversity and Phylogenetic Analysis of Human Bocavirus 2 in Pediatric Patients with Acute Gastroenteritis in Taiwan. Int. J. Environ. Res. Public Health 2020, 17, 1086. [Google Scholar] [CrossRef]
- Yu, J.; Chen, Q.; Hao, Y.; Yu, T.; Zeng, S.; Wu, X.; Zhang, B.; Duan, Z. Identification of Human Bocaviruses in the Cerebrospinal Fluid of Children Hospitalized with Encephalitis in China. J. Clin. Virol. 2013, 57, 374–377. [Google Scholar] [CrossRef]
- Mori, D.; Ranawaka, U.; Yamada, K.; Rajindrajith, S.; Miya, K.; Perera, H.K.K.; Matsumoto, T.; Dassanayake, M.; Mitui, M.T.; Mori, H.; et al. Human Bocavirus in Patients with Encephalitis, Sri Lanka, 2009-2010. Emerg Infect Dis 2013, 19, 1859–1862. [Google Scholar] [CrossRef]
- Ao, Y.; Li, X.; Li, L.; Xie, X.; Jin, D.; Yu, J.; Lu, S.; Duan, Z. Two Novel Bocaparvovirus Species Identified in Wild Himalayan Marmots. Sci. China Life Sci. 2017, 60, 1348–1356. [Google Scholar] [CrossRef]
- Kainulainen, L.; Waris, M.; Söderlund-Venermo, M.; Allander, T.; Hedman, K.; Ruuskanen, O. Hepatitis and Human Bocavirus Primary Infection in a Child with T-Cell Deficiency. J. Clin. Microbiol. 2008, 46, 4104–4105. [Google Scholar] [CrossRef] [PubMed]
- Väisänen, E.; Paloniemi, M.; Kuisma, I.; Lithovius, V.; Kumar, A.; Franssila, R.; Ahmed, K.; Delwart, E.; Vesikari, T.; Hedman, K.; et al. Epidemiology of Two Human Protoparvoviruses, Bufavirus and Tusavirus. Sci. Rep. 2016, 6, 39267. [Google Scholar] [CrossRef] [PubMed]
- Väisänen, E.; Fu, Y.; Hedman, K.; Söderlund-Venermo, M. Human Protoparvoviruses. Viruses 2017, 9, 354. [Google Scholar] [CrossRef] [PubMed]
- Abayli, H.; Aslan, O.; Tumer, K.C.; Can-Sahna, K.; Tonbak, S. Investigation of Canine Chaphamaparvovirus, Canine Bufavirus, and Canine Adenovirus in Dogs with Diarrhea: First Report of Novel Canine Bufavirus in Turkey. Virus Genes 2023, 59, 427–436. [Google Scholar] [CrossRef]
- Piewbang, C.; Poonsin, P.; Lohavicharn, P.; Van Nguyen, T.; Lacharoje, S.; Kasantikul, T.; Techangamsuwan, S. Canine bufavirus (Carnivore protoparvovirus-3) infection in dogs with respiratory disease. Vet. Pathol. 2023, 3009858231198000. [Google Scholar] [CrossRef]
- Kemenesi, G.; Dallos, B.; Görföl, T.; Estók, P.; Boldogh, S.; Kurucz, K.; Oldal, M.; Marton, S.; Bányai, K.; Jakab, F. Genetic diversity and recombination within bufaviruses: Detection of a novel strain in Hungarian bats. Infect. Genet. Evol. 2015, 33, 288–292. [Google Scholar] [CrossRef]
- Aryal, M.; Liu, G. Porcine Bocavirus: A 10-Year History since Its Discovery. Virol. Sin. 2021, 36, 1261–1272. [Google Scholar] [CrossRef]
Oligonucleotide | Position | Sequence (5′-3′) | Sense | Use | References |
---|---|---|---|---|---|
CPPV 165F | 3068–3087 | CTGGTTTAATCCAGCAGACT | + | Screening PCR | [7] |
CPPV 371R | 3257–3274 | TGAAGACCAAGGTAGTAGG | − | Screening PCR | [7] |
HhBuV 5′F | 1–23 | GGAGGGGGCCTCTTACGTCATCA | + | Sequencing | This study |
HhBuV 141F | 141–163 | ATGAAGAAACCTACAAATATAGC | + | Sequencing | This study |
CPPV 453R | 653–673 | CCCCATTTTTCTGCAAAGWAT | − | Sequencing | [21] |
CPPV 1142F | 1352–1374 | TACCATGCAATCATSTGCTGCCT | + | Sequencing | [21] |
CPPV 1397R | 1607–1632 | TTGCCTTTTTGATCAAGTCTGATTGC | − | Sequencing | [21] |
CPPV 1409F | 2622–2643 | TCATATTCCTGGAGAAACATCA | + | Sequencing | [11] |
HhBuV 2670R | 2649–2670 | AGGGCTTACCTCTTTTGGTGCC | − | Sequencing | This study |
CPPV-L3-F | 3134–3160 | TGAACAAGAAATAGACAACATTGTCAT | + | Sequencing | [7] |
CPPV-L3-R | 3208–3231 | AAAGAGCAGTTAGGTCATTGTTGT | − | Sequencing | [7] |
CPPV 1414R | 3550–3571 | ACTGGCAATCTAACAGACATAT | − | Sequencing | [11] |
HhBuV 3854F | 3854–3873 | TGACTACAACCACGGAGACC | + | Sequencing | This study |
HhBuV 4000R | 3981–4000 | TTCCAGCTGGTTGTGTGTGC | − | Sequencing | This study |
CPPV 1571R | 4421–4439 | TTATAGAGTAATATTAGGC | − | Sequencing | [11] |
HhBuV 4631R | 4612–4631 | GGTGTCAAAGTGACTTTGAA | − | Sequencing | This study |
Virus | Strain | Tissue | GenBank Accession Number |
---|---|---|---|
Hedgehog bocavirus | 637DU-2022 | duodenum | OR682572 |
742DU-2022 | duodenum | OR682573 | |
1141DU-2022 | duodenum | OR682574 | |
617DU-2019 | duodenum | OR682575 | |
1079DU-2021 | duodenum | OR682576 | |
1279DU-2019 | duodenum | OR682577 | |
1083DU-2021 | duodenum | OR682578 | |
358DU-2022 | duodenum | OR682579 | |
592DU-2019 | duodenum | OR682580 | |
618DU-2019 | duodenum | OR682581 | |
637L-2022 | liver | OR682582 | |
1079L-2021 | liver | OR682583 | |
1082L-2021 | liver | OR682584 | |
458L-2022 | liver | OR682585 | |
Porcine bocavirus | 656DU-2022 | duodenum | OR682586 |
655DU-2022 | duodenum | OR682587 | |
655L-2022 | liver | OR682588 | |
657DU-2022 | duodenum | OR682589 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sarchese, V.; Palombieri, A.; Prandi, I.; Robetto, S.; Bertolotti, L.; Capucchio, M.T.; Orusa, R.; Mauthe von Degerfeld, M.; Quaranta, G.; Vacchetta, M.; et al. Molecular Surveillance for Bocaparvoviruses and Bufaviruses in the European Hedgehog (Erinaceus europaeus). Microorganisms 2024, 12, 189. https://doi.org/10.3390/microorganisms12010189
Sarchese V, Palombieri A, Prandi I, Robetto S, Bertolotti L, Capucchio MT, Orusa R, Mauthe von Degerfeld M, Quaranta G, Vacchetta M, et al. Molecular Surveillance for Bocaparvoviruses and Bufaviruses in the European Hedgehog (Erinaceus europaeus). Microorganisms. 2024; 12(1):189. https://doi.org/10.3390/microorganisms12010189
Chicago/Turabian StyleSarchese, Vittorio, Andrea Palombieri, Ilaria Prandi, Serena Robetto, Luigi Bertolotti, Maria Teresa Capucchio, Riccardo Orusa, Mitzy Mauthe von Degerfeld, Giuseppe Quaranta, Massimo Vacchetta, and et al. 2024. "Molecular Surveillance for Bocaparvoviruses and Bufaviruses in the European Hedgehog (Erinaceus europaeus)" Microorganisms 12, no. 1: 189. https://doi.org/10.3390/microorganisms12010189
APA StyleSarchese, V., Palombieri, A., Prandi, I., Robetto, S., Bertolotti, L., Capucchio, M. T., Orusa, R., Mauthe von Degerfeld, M., Quaranta, G., Vacchetta, M., Martella, V., Di Martino, B., & Di Profio, F. (2024). Molecular Surveillance for Bocaparvoviruses and Bufaviruses in the European Hedgehog (Erinaceus europaeus). Microorganisms, 12(1), 189. https://doi.org/10.3390/microorganisms12010189