Baicalin Weakens the Porcine ExPEC-Induced Inflammatory Response in 3D4/21 Cells by Inhibiting the Expression of NF-κB/MAPK Signaling Pathways and Reducing NLRP3 Inflammasome Activation
Abstract
1. Introduction
2. Materials and Methods
2.1. Reagents
2.2. Strains and Growth Conditions
2.3. Culture of Porcine Alveolar Macrophage 3D4/21
2.4. Determination of the Minimum Inhibitory Concentration (MIC) of BA
2.5. Growth Characteristic Analysis
2.6. Cell Viability Assay with CCK8
2.7. Lactate Dehydrogenase (LDH) Activity
2.8. Expression of Inflammatory Genes by q-PCR
2.9. Measurement of the Cytokines
2.10. Western Blot Assay
2.11. Statistical Analysis
3. Results
3.1. The Antibacterial Effect of BA on PCN033
3.2. Effects of BA on the Damage to 3D4/21 Cells Infected with PCN033
3.3. Effects of BA on the Viability of 3D4/21 Cells
3.4. Effects of BA on the Transcription Levels of Inflammatory Factors in 3D4/21 Cells Infected with PCN033
3.5. Effects of BA on the Expression Levels of Inflammatory Factors in 3D4/21 Cells Infected with PCN033
3.6. Effect of BA on the NF-B Signaling Pathway in 3D4/21 Cells Infected with PCN033
3.7. Effect of BA on the MAPK Signaling Pathway in 3D4/21 Cells Infected with PCN033
3.8. Effect of BA on the NLRP3 Inflammasome in 3D4/21 Cells Infected with PCN033
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Smith, J.L.; Fratamico, P.M.; Gunther, N.W. Extraintestinal pathogenic Escherichia coli. Foodborne Pathog. Dis. 2007, 4, 134–163. [Google Scholar] [CrossRef] [PubMed]
- Russo, T.A.; Johnson, J.R. Proposal for a New Inclusive Designation for Extraintestinal Pathogenic Isolates of Escherichia coli: ExPEC. J. Infect. Dis. 2000, 181, 1753–1754. [Google Scholar] [CrossRef] [PubMed]
- Troeger, H.; Richter, J.F.; Beutin, L.; Günzel, D.; Dobrindt, U.; Epple, H.J.; Gitter, A.H.; Zeitz, M.; Fromm, M.; Schulzke, J.D. Escherichia coli alpha-haemolysin induces focal leaks in colonic epithelium: A novel mechanism of bacterial translocation. Cell. Microbiol. 2007, 9, 2530–2540. [Google Scholar] [CrossRef]
- Kaper, J.B.; Nataro, J.P.; Mobley, H.L. Pathogenic Escherichia coli. Nat. Rev. Microbiol. 2004, 2, 123–140. [Google Scholar] [CrossRef] [PubMed]
- Johnson, J.R.; Russo, T.A. Molecular epidemiology of extraintestinal pathogenic (uropathogenic) Escherichia coli. Int. J. Med Microbiol. IJMM 2005, 295, 383–404. [Google Scholar] [CrossRef]
- Tan, C.; Tang, X.; Zhang, X.; Ding, Y.; Zhao, Z.; Wu, B.; Cai, X.; Liu, Z.; He, Q.; Chen, H. Serotypes and virulence genes of extraintestinal pathogenic Escherichia coli isolates from diseased pigs in China. Vet. J. 2012, 192, 483–488. [Google Scholar] [CrossRef]
- Ma, J.; Cheng, Z.; Bai, Q.; Zhao, K.; Pan, Z.; Yao, H. Screening virulence factors of porcine extraintestinal pathogenic Escherichia coli (an emerging pathotype) required for optimal growth in swine blood. Transbound. Emerg. Dis. 2021, 68, 2005–2016. [Google Scholar] [CrossRef]
- Moulin-Schouleur, M.; Schouler, C.; Tailliez, P.; Kao, M.R.; Brée, A.; Germon, P.; Oswald, E.; Mainil, J.; Blanco, M.; Blanco, J. Common virulence factors and genetic relationships between O18:K1:H7 Escherichia coli isolates of human and avian origin. J. Clin. Microbiol. 2006, 44, 3484–3492. [Google Scholar] [CrossRef]
- Jakobsen, L.; Spangholm, D.J.; Pedersen, K.; Jensen, L.B.; Emborg, H.D.; Agersø, Y.; Aarestrup, F.M.; Hammerum, A.M.; Frimodt-Møller, N. Broiler chickens, broiler chicken meat, pigs and pork as sources of ExPEC related virulence genes and resistance in Escherichia coli isolates from community-dwelling humans and UTI patients. Int. J. Food Microbiol. 2010, 142, 264–272. [Google Scholar] [CrossRef]
- Zhu, Y.; Dong, W.; Ma, J.; Yuan, L.; Hejair, H.M.A.; Pan, Z.; Liu, G.; Yao, H. Characterization and virulence clustering analysis of extraintestinal pathogenic Escherichia coli isolated from swine in China. Bmc Vet. Res. 2017, 13, 94. [Google Scholar] [CrossRef]
- Totsika, M.; Kostakioti, M.; Hannan, T.J.; Upton, M.; Beatson, S.A.; Janetka, J.W.; Hultgren, S.J.; Schembri, M.A. A FimH inhibitor prevents acute bladder infection and treats chronic cystitis caused by multidrug-resistant uropathogenic Escherichia coli ST131. J. Infect. Dis. 2013, 208, 921–928. [Google Scholar] [CrossRef] [PubMed]
- Mellata, M. Human and avian extraintestinal pathogenic Escherichia coli: Infections, zoonotic risks, and antibiotic resistance trends. Foodborne Pathog. Dis. 2013, 10, 916–932. [Google Scholar] [CrossRef] [PubMed]
- Lima-Filho, J.V.; Martins, L.V.; Nascimento, D.C.d.O.; Ventura, R.F.; Batista, J.E.C.; Silva, A.F.B.; Ralph, M.T.; Vaz, R.V.; Rabello, C.B.V.; Da Silva, I.d.M.M.; et al. Zoonotic potential of multidrug-resistant extraintestinal pathogenic Escherichia coli obtained from healthy poultry carcasses in Salvador, Brazil. Braz. J. Infect. Dis. Off. Publ. Braz. Soc. Infect. Dis. 2013, 17, 54–61. [Google Scholar] [CrossRef] [PubMed]
- Johnson, J.R.; O’Bryan, T.T.; Kuskowski, M.; Maslow, J.N. Ongoing horizontal and vertical transmission of virulence genes and papA alleles among Escherichia coli blood isolates from patients with diverse-source bacteremia. Infect. Immun. 2001, 69, 5363–5374. [Google Scholar] [CrossRef]
- Barber, A.E.; Fleming, B.A.; Mulvey, M.A. Similarly lethal strains of extraintestinal pathogenic Escherichia coli trigger markedly diverse host responses in a zebrafish model of sepsis. MSphere 2016, 1, e00062-16. [Google Scholar] [CrossRef] [PubMed]
- Russo, T.A.; Johnson, J.R. Medical and economic impact of extraintestinal infections due to Escherichia coli: Focus on an increasingly important endemic problem. Microbes Infect. 2003, 5, 449–456. [Google Scholar] [CrossRef] [PubMed]
- Tang, X.; Tan, C.; Zhang, X.; Zhao, Z.; Xia, X.; Wu, B.; Guo, A.; Zhou, R.; Chen, H. Antimicrobial resistances of extraintestinal pathogenic Escherichia coli isolates from swine in China. Microb. Pathog. 2011, 50, 207–212. [Google Scholar] [CrossRef]
- Jahanbakhsh, S.; Smith, M.G.; Kohan-Ghadr, H.R.; Letellier, A.; Abraham, S.; Trott, D.J.; Fairbrother, J.M. Dynamics of extended-spectrum cephalosporin resistance in pathogenic Escherichia coli isolated from diseased pigs in Quebec, Canada. Int. J. Antimicrob. Agents 2016, 48, 194–202. [Google Scholar] [CrossRef]
- Zhao, H.X.; Zhao, J.L.; Shen, J.Z.; Fan, H.L.; Guan, H.; An, X.P.; Li, P.F. Prevalence and molecular characterization of fluoroquinolone resistance in Escherichia coli isolates from dairy cattle with endometritis in China. Microb. Drug Resist. 2014, 20, 162–169. [Google Scholar] [CrossRef]
- Peng, Z.; Zhang, X.; Li, X.; Hu, Z.; Li, Z.; Jia, C.; Dai, M.; Tan, C.; Chen, H.; Wang, X. Characteristics of colistin-resistant Escherichia coli from pig farms in Central China. Anim. Dis. 2021, 1, 9. [Google Scholar] [CrossRef]
- Zheng, X.; Yang, D.; Liu, X.; Wang, N.; Li, B.; Cao, H.; Lu, Y.; Wei, G.; Zhou, H.; Zheng, J. Identification of a new anti-LPS agent, geniposide, from Gardenia jasminoides Ellis, and its ability of direct binding and neutralization of lipopolysaccharide in vitro and in vivo. Int. Immunopharmacol. 2010, 10, 1209–1219. [Google Scholar] [CrossRef]
- Lv, X.; Fu, K.; Li, W.; Wang, Y.; Wang, J.; Li, H.; Tian, W.; Cao, R. TIIA attenuates LPS-induced mouse endometritis by suppressing the NF-κB signaling pathway. Can. J. Physiol. Pharmacol. 2015, 93, 967–971. [Google Scholar] [CrossRef]
- Shi, T.; Li, T.; Jiang, X.; Jiang, X.; Zhang, Q.; Wang, Y.; Zhang, Y.; Wang, L.; Qin, X.; Zhang, W.; et al. Baicalin protects mice from infection with methicillin-resistant Staphylococcus aureus via alleviating inflammatory response. J. Leukoc. Biol. 2020, 108, 1829–1839. [Google Scholar] [CrossRef] [PubMed]
- Xiang, H.; Zhang, Q.; Qi, B.; Tao, X.; Xia, S.; Song, H.; Qu, J.; Shang, D. Chinese Herbal Medicines Attenuate Acute Pancreatitis: Pharmacological Activities and Mechanisms. Front. Pharmacol. 2017, 8, 216. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Li, X.; Ciric, B.; Ma, C.G.; Gran, B.; Rostami, A.; Zhang, G.X. Therapeutic effect of baicalin on experimental autoimmune encephalomyelitis is mediated by SOCS3 regulatory pathway. Sci. Rep. 2015, 5, 17407. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Wang, S.; Zhao, G. Baicalin relieves lipopolysaccharide-evoked inflammatory injury through regulation of miR-21 in H9c2 cells. Phytother. Res. 2020, 34, 1134–1141. [Google Scholar] [CrossRef]
- Luo, J.; Dong, B.; Wang, K.; Cai, S.; Liu, T.; Cheng, X.; Lei, D.; Chen, Y.; Li, Y.; Kong, J.; et al. Baicalin inhibits biofilm formation, attenuates the quorum sensing-controlled virulence and enhances Pseudomonas aeruginosa clearance in a mouse peritoneal implant infection model. PLoS ONE 2017, 12, e0176883. [Google Scholar] [CrossRef]
- Omwenga, E.O.; Hensel, A.; Shitandi, A.; Goycoolea, F.M. Chitosan nanoencapsulation of flavonoids enhances their quorum sensing and biofilm formation inhibitory activities against an E.coli Top 10 biosensor. Colloids Surf. Biointerfaces 2018, 164, 125–133. [Google Scholar] [CrossRef]
- Peng, L.Y.; Yuan, M.; Wu, Z.M.; Song, K.; Zhang, C.L.; An, Q.; Xia, F.; Yu, J.L.; Yi, P.F.; Fu, B.D.; et al. Anti-bacterial activity of baicalin against APEC through inhibition of quorum sensing and inflammatory responses. Sci. Rep. 2019, 9, 4063. [Google Scholar] [CrossRef]
- Tu, X.K.; Yang, W.Z.; Shi, S.S.; Chen, Y.; Wang, C.H.; Chen, C.M.; Chen, Z. Baicalin inhibits TLR2/4 signaling pathway in rat brain following permanent cerebral ischemia. Inflammation 2011, 34, 463–470. [Google Scholar] [CrossRef]
- Chang, C.P.; Huang, W.T.; Cheng, B.C.; Hsu, C.C.; Lin, M.T. The flavonoid baicalin protects against cerebrovascular dysfunction and brain inflammation in experimental heatstroke. Neuropharmacology 2007, 52, 1024–1033. [Google Scholar] [CrossRef] [PubMed]
- Guo, M.; Zhang, N.; Li, D.; Liang, D.; Liu, Z.; Li, F.; Fu, Y.; Cao, Y.; Deng, X.; Yang, Z. Baicalin plays an anti-inflammatory role through reducing nuclear factor-κB and p38 phosphorylation in S. aureus-induced mastitis. Int. Immunopharmacol. 2013, 16, 125–130. [Google Scholar] [CrossRef] [PubMed]
- Qiu, J.; Niu, X.; Dong, J.; Wang, D.; Wang, J.; Li, H.; Luo, M.; Li, S.; Feng, H.; Deng, X. Baicalin protects mice from Staphylococcus aureus pneumonia via inhibition of the cytolytic activity of α-hemolysin. J. Infect. Dis. 2012, 206, 292–301. [Google Scholar] [CrossRef]
- Liu, S.; Liu, B.; Luo, Z.Q.; Qiu, J.; Zhou, X.; Li, G.; Zhang, B.; Deng, X.; Yang, Z.; Wang, J. The combination of osthole with baicalin protects mice from Staphylococcus aureus pneumonia. World J. Microbiol. Biotechnol. 2017, 33, 11. [Google Scholar] [CrossRef]
- Zhu, J.; Wang, J.; Sheng, Y.; Zou, Y.; Bo, L.; Wang, F.; Lou, J.; Fan, X.; Bao, R.; Wu, Y.; et al. Baicalin improves survival in a murine model of polymicrobial sepsis via suppressing inflammatory response and lymphocyte apoptosis. PLoS ONE 2012, 7, e35523. [Google Scholar] [CrossRef] [PubMed]
- Cheng, Y.; Ping, J.; Xu, H.D.; Fu, H.J.; Zhou, Z.H. Synergistic effect of a novel oxymatrine-baicalin combination against hepatitis B virus replication, α smooth muscle actin expression and type I collagen synthesis in vitro. World J. Gastroenterol. WJG 2006, 12, 5153. [Google Scholar] [CrossRef]
- Cai, X.; Li, C.; Du, G.; Cao, Z. Protective effects of baicalin on ligature-induced periodontitis in rats. J. Periodontal Res. 2008, 43, 14–21. [Google Scholar] [CrossRef] [PubMed]
- Yu, F.Y.; Huang, S.G.; Zhang, H.Y.; Ye, H.; Chi, H.G.; Zou, Y.; Lv, R.X.; Zheng, X.B. Effects of baicalin in CD4 + CD29 + T cell subsets of ulcerative colitis patients. World J. Gastroenterol. 2014, 20, 15299–15309. [Google Scholar] [CrossRef]
- Zong, B.; Liu, W.; Zhang, Y.; Wang, X.; Chen, H.; Tan, C. Effect of kpsM on the virulence of porcine extraintestinal pathogenic Escherichia coli. Fems Microbiol. Lett. 2016, 363, fnw232. [Google Scholar] [CrossRef]
- Zhang, Y.; Zong, B.; Wang, X.; Zhu, Y.; Hu, L.; Li, P.; Zhang, A.; Chen, H.; Liu, M.; Tan, C. Fisetin Lowers Streptococcus suis serotype 2 Pathogenicity in Mice by Inhibiting the Hemolytic Activity of Suilysin. Front. Microbiol. 2018, 9, 1723. [Google Scholar] [CrossRef]
- Liu, C.; Zheng, H.; Yang, M.; Xu, Z.; Wang, X.; Wei, L.; Tang, B.; Liu, F.; Zhang, Y.; Ding, Y.; et al. Genome analysis and in vivo virulence of porcine extraintestinal pathogenic Escherichia coli strain PCN033. BMC Genom. 2015, 16, 717. [Google Scholar] [CrossRef][Green Version]
- Peng, Y.; Wang, X.; Shou, J.; Zong, B.; Zhang, Y.; Tan, J.; Chen, J.; Hu, L.; Zhu, Y.; Chen, H.; et al. Roles of Hcp family proteins in the pathogenesis of the porcine extraintestinal pathogenic Escherichia coli type VI secretion system. Sci. Rep. 2016, 6, 26816. [Google Scholar] [CrossRef]
- Li, T.; Qian, Y.; Miao, Z.; Zheng, P.; Shi, T.; Jiang, X.; Pan, L.; Qian, F.; Yang, G.; An, H.; et al. Xuebijing Injection Alleviates Pam3CSK4-Induced Inflammatory Response and Protects Mice From Sepsis Caused by Methicillin-Resistant Staphylococcus aureus. Front. Pharmacol. 2020, 11, 104. [Google Scholar] [CrossRef] [PubMed]
- HL, T.I. Macrophages in Innate and Acquired Immunity. Semin. Respir. Crit. Care Med. 2004, 25, 21–23. [Google Scholar] [CrossRef]
- Rocha-Ramírez, L.M.; Pérez-Solano, R.A.; Castañón-Alonso, S.L.; Moreno Guerrero, S.S.; Ramírez Pacheco, A.; García Garibay, M.; Eslava, C. Probiotic Lactobacillus Strains Stimulate the Inflammatory Response and Activate Human Macrophages. J. Immunol. Res. 2017, 2017, 4607491. [Google Scholar] [CrossRef]
- Lai, J.L.; Liu, Y.H.; Liu, C.; Qi, M.P.; Liu, R.N.; Zhu, X.F.; Zhou, Q.G.; Chen, Y.Y.; Guo, A.Z.; Hu, C.M. Indirubin Inhibits LPS-Induced Inflammation via TLR4 Abrogation Mediated by the NF-kB and MAPK Signaling Pathways. Inflammation 2017, 40, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Kannian, P.; Ashwini, V.; Suchithra, S.B.; Sindu, K.B. Elevated urinary IL-1β levels in multidrug resistant Escherichia coli and Klebsiella infections. Inflamm. Res. Off. J. Eur. Histamine Res. Soc. 2020, 69, 11–13. [Google Scholar] [CrossRef] [PubMed]
- Cui, L.; Feng, L.; Zhang, Z.H.; Jia, X.B. The anti-inflammation effect of baicalin on experimental colitis through inhibiting TLR4/NF-κB pathway activation. Int. Immunopharmacol. 2014, 23, 294–303. [Google Scholar] [CrossRef] [PubMed]
- Han, M.S.; Barrett, T.; Brehm, M.A.; Davis, R.J. Inflammation Mediated by JNK in Myeloid Cells Promotes the Development of Hepatitis and Hepatocellular Carcinoma. Cell Rep. 2016, 15, 19–26. [Google Scholar] [CrossRef]
- Wu, Y.; Wang, F.; Fan, L.; Zhang, W.; Wang, T.; Du, Y.; Bai, X. Baicalin alleviates atherosclerosis by relieving oxidative stress and inflammatory responses via inactivating the NF-κB and p38 MAPK signaling pathways. Biomed. Pharmacother. Biomed. Pharmacother. 2018, 97, 1673–1679. [Google Scholar] [CrossRef]
- Nguyen, P.L.; Bui, B.P.; Duong, M.T.H.; Lee, K.; Ahn, H.C.; Cho, J. Suppression of LPS-Induced Inflammation and Cell Migration by Azelastine through Inhibition of JNK/NF-κB Pathway in BV2 Microglial Cells. Int. J. Mol. Sci. 2021, 22, 9061. [Google Scholar] [CrossRef]
- Chen, H.; Jiang, Y.; Liu, R.; Deng, J.; Chen, Q.; Chen, L.; Liang, G.; Chen, X.; Xu, Z. Curcumin Derivative C66 Suppresses Pancreatic Cancer Progression through the Inhibition of JNK-Mediated Inflammation. Molecules 2022, 27, 3076. [Google Scholar] [CrossRef]
- Fang, F.; Xie, Z.; Quan, J.; Wei, X.; Wang, L.; Yang, L. Baicalin suppresses Propionibacterium acnes-induced skin inflammation by downregulating the NF-κB/MAPK signaling pathway and inhibiting activation of NLRP3 inflammasome. Braz. J. Med. Biol. Res. Rev. Bras. Pesqui. Medicas Biol. 2020, 53, e9949. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Hauenstein, A.V. The NLRP3 inflammasome: Mechanism of action, role in disease and therapies. Mol. Asp. Med. 2020, 76, 100889. [Google Scholar] [CrossRef] [PubMed]
- Jin, X.; Liu, M.Y.; Zhang, D.F.; Zhong, X.; Du, K.; Qian, P.; Yao, W.F.; Gao, H.; Wei, M.J. Baicalin mitigates cognitive impairment and protects neurons from microglia-mediated neuroinflammation via suppressing NLRP3 inflammasomes and TLR4/NF-κB signaling pathway. Cns Neurosci. Ther. 2019, 25, 575–590. [Google Scholar] [CrossRef] [PubMed]










| Primer | Sequence | Remark |
|---|---|---|
| -actin | TGCGGGACATCAAGGAGAAG | Forward |
| AGTTGAAGGTGGTCTCGTGG | Reverse | |
| IL-6 | TGTCGAGGCTGTGCAGATTAGT | Forward |
| CATCCATCGTTCTGTGACTGC | Reverse | |
| IL-8 | ACAGCAGTAACAACAACAAG | Forward |
| GACCAGCACAGGAATGAG | Reverse | |
| IL-1 | GCTGGAGGATATAGACCCC | Forward |
| GTTGGGGTACAGGGCAGAC | Reverse | |
| c-jun | AGAATCCGAAGGGAAAGGA | Forward |
| CTTCTCCTTCAGCAGGTTGG | Reverse | |
| c-fos | GCTGACAGATACACTCCAAGCGG | Forward |
| AGGAAGACGTGTAAGTAGTGCAG | Reverse |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zong, B.; Xiao, Y.; Ren, M.; Wang, P.; Fu, S.; Qiu, Y. Baicalin Weakens the Porcine ExPEC-Induced Inflammatory Response in 3D4/21 Cells by Inhibiting the Expression of NF-κB/MAPK Signaling Pathways and Reducing NLRP3 Inflammasome Activation. Microorganisms 2023, 11, 2126. https://doi.org/10.3390/microorganisms11082126
Zong B, Xiao Y, Ren M, Wang P, Fu S, Qiu Y. Baicalin Weakens the Porcine ExPEC-Induced Inflammatory Response in 3D4/21 Cells by Inhibiting the Expression of NF-κB/MAPK Signaling Pathways and Reducing NLRP3 Inflammasome Activation. Microorganisms. 2023; 11(8):2126. https://doi.org/10.3390/microorganisms11082126
Chicago/Turabian StyleZong, Bingbing, Yong Xiao, Mingxing Ren, Peiyi Wang, Shulin Fu, and Yinsheng Qiu. 2023. "Baicalin Weakens the Porcine ExPEC-Induced Inflammatory Response in 3D4/21 Cells by Inhibiting the Expression of NF-κB/MAPK Signaling Pathways and Reducing NLRP3 Inflammasome Activation" Microorganisms 11, no. 8: 2126. https://doi.org/10.3390/microorganisms11082126
APA StyleZong, B., Xiao, Y., Ren, M., Wang, P., Fu, S., & Qiu, Y. (2023). Baicalin Weakens the Porcine ExPEC-Induced Inflammatory Response in 3D4/21 Cells by Inhibiting the Expression of NF-κB/MAPK Signaling Pathways and Reducing NLRP3 Inflammasome Activation. Microorganisms, 11(8), 2126. https://doi.org/10.3390/microorganisms11082126

