Prevalence of Multidrug-Resistant Pseudomonas aeruginosa Isolated from Dairy Cattle, Milk, Environment, and Workers’ Hands
Abstract
:1. Introduction
2. Materials and Methods
2.1. Study Design
2.2. Origins and Processing of Samples
2.2.1. Animal Samples
2.2.2. Environmental Samples
2.2.3. Human Samples
2.3. Animal-House Description
2.4. Bacteriological and Chemical Identification of P. aeruginosa Strains
2.5. Molecular Identification of P. aeruginosa via 16S rRNA Gene Detection
2.6. Phenotypic AMR of Farms and Households’ Strains of P. aeruginosa
2.7. Molecular Identification of P. aeruginosa AMR-Resistance Genes (ARGs)
2.8. Statistical Analysis
3. Results
3.1. Prevalence of P. aeruginosa Isolated from Three Examined Dairy Farms and Households
3.2. AMR of P. aeruginosa Recovered from Different Sources
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Heir, E.; Moen, B.; Åsli, A.W.; Sunde, M.; Langsrud, S. Antibiotic Resistance and Phylogeny of Pseudomonas spp. Isolated over Three Decades from Chicken Meat in the Norwegian Food Chain. Microorganisms 2021, 9, 207. [Google Scholar] [CrossRef]
- Ammar, A.M.A.; El-Shafii, S.S.A.; AMO, A.; Zeinab, A.E.A. Detection of multidrug resistance genes in Pseudomonas aeruginosa isolated from bovine mastitic milk. J. Dairy Vet. Anim. Res. 2016, 3, 43–49. [Google Scholar]
- Osman, K.M.; Alabady, M.S.; Ata, N.S.; Ezzeldin, N.A.; Aly, M.A. Genotypic characterization of Pseudomonas aeruginosa isolated from human and animal sources in Egypt. Zoonoses Public Health 2010, 57, 329–338. [Google Scholar] [PubMed]
- Abd El-Ghany, W.A. Pseudomonas aeruginosa Infection of Avian Origin: Zoonosis and One Health Implications. Vet. World 2021, 14, 2155–2159. [Google Scholar] [CrossRef] [PubMed]
- Schauer, B.; Wald, R.; Urbantke, V.; Loncaric, I.; Baumgartner, M. Tracing Mastitis Pathogens-Epidemiological Investigations of a Pseudomonas aeruginosa Mastitis Outbreak in an Austrian Dairy Herd. Animals 2021, 11, 279. [Google Scholar] [CrossRef] [PubMed]
- Ruiz-Roldán, L.; Rojo-Bezares, B.; de Toro, M.; López, M.; Toledano, P.; Lozano, C.; Chichón, G.; Alvarez-Erviti, L.; Torres, C.; Sáenz, Y. Antimicrobial resistance and virulence of Pseudomonas spp. among healthy animals: Concern about exolysin ExlA detection. Sci. Rep. 2020, 10, 11667. [Google Scholar] [CrossRef] [PubMed]
- Aziz, S.; Mahmoud, R.; Mohamed, M. Control of biofilm-producing Pseudomonas aeruginosa isolated from dairy farm using Virokill silver nano-based disinfectant as an alternative approach. Sci. Rep. 2022, 12, 9452. [Google Scholar] [CrossRef]
- Ahmed, O.B. Detection of Antibiotic Resistance Genes in Pseudomonas aeruginosa by Whole Genome Sequencing. Infect. Drug Resist. 2022, 15, 6703–6709. [Google Scholar] [CrossRef]
- Hassuna, N.A.; Mandour, S.A.; Mohamed, E.S. Virulence Constitution of Multi-Drug-Resistant Pseudomonas aeruginosa in Upper Egypt. Infect. Drug Resist. 2020, 13, 587–595. [Google Scholar] [CrossRef]
- Badawy, B.; Gwida, M.; Sadat, A.; El-Toukhy, M.; Sayed-Ahmed, M.; Alam, N.; Ahmad, S.; Ali, M.; Elafify, M. Prevalence and Antimicrobial Resistance of Virulent Listeria monocytogenes and Cronobacter sakazakii in Dairy Cattle, the Environment, and Dried Milk with the In Vitro Application of Natural Alternative Control. Antibiotics 2022, 11, 1087. [Google Scholar] [CrossRef]
- Ibrahim, N.A.; Farag, V.M.; Abd-El-Moaty, A.M.; Atwa, S.M. Resistant Gene of Pseudomonas aeruginosa in Mastitic Cattle with Reference to Some Biochemical and Immunological Parameters. World’s Vet. J. 2017, 7, 5–13. [Google Scholar] [CrossRef]
- Spilker, T.; Coenye, T.; Vandamme, P.; LiPuma, J.J. PCR-based assay for differentiation of Pseudomonas aeruginosa from other Pseudomonas species recovered from cystic fibrosis patients. J. Clin. Microbiol. 2004, 42, 2074–2079. [Google Scholar] [CrossRef] [PubMed]
- Ibekwe, A.M.; Murinda, S.E.; Graves, A.K. Genetic diversity and antimicrobial resistance of Escherichia coli from human and animal sources uncovers multiple resistances from human sources. PLoS ONE 2011, 6, e20819. [Google Scholar] [CrossRef]
- Grape, M.; Motakefi, A.; Pavuluri, S.; Kahlmeter, G. Standard and real-time multiplex PCR methods for detection of trimethoprim resistance dfr genes in large collections of bacteria. Clin. Microbiol. Infect. 2007, 13, 1112–1118. [Google Scholar] [CrossRef]
- Schlegelova, J.; Vlkova, H.; Babak, V.; Holasova, M.; Jaglic, Z.; Stosova, T.; Sauer, P. Resistance to erythromycin of Staphylococcus spp. isolates from the food chain. Vet. Med.-Praha 2008, 53, 307. [Google Scholar] [CrossRef]
- National Committee for Clinical Laboratory Standards (NCCLS). Performance Standards for Antimicrobial Disk Susceptibility Tests. Twenty Second informational Supplement NCCLS Document M100-S22; No. 3; Clinical Laboratory Standards Institute (CLSI): Wayne, PA, USA, 2012; Volume 32. [Google Scholar]
- Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing (CLSI, 2020); Thirty Informational Supplement; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2020. [Google Scholar]
- Badawy, B.; Elafify, M.; Farag, A.M.; Moustafa, S.M.; Sayed-Ahmed, M.Z.; Moawad, A.A.; Algammal, A.M.; Ramadan, H.; Eltholth, M. Ecological Distribution of Virulent Multidrug-Resistant Staphylococcus aureus in Livestock, Environment, and Dairy Products. Antibiotics 2022, 11, 1651. [Google Scholar] [CrossRef] [PubMed]
- Magiorakos, A.P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, C.G.; Harbarth, S.; Hindler, J.F.; Kahlmeter, G.; Olsson-Liljequist, B.; et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef] [PubMed]
- Banda, R.; Nduko, J.; Matofari, J. Bacterial Biofilm Formation in Milking Equipment in Lilongwe, Malawi. J. Food Qual. Hazards Control 2020, 7, 142–148. [Google Scholar] [CrossRef]
- El-Gohary, F.A.; Abdel-Hafez, L.J.M.; Zakaria, A.I.; Shata, R.R.; Tahoun, A.; El-Mleeh, A.; Elmahallawy, E.K. Enhanced antibacterial activity of silver nanoparticles combined with hydrogen peroxide against multidrug-resistant pathogens isolated from dairy farms and beef slaughterhouses in Egypt. Infect. Drug Resist. 2020, 13, 3485. [Google Scholar] [CrossRef]
- Banerjee, S.; Batabyal, K.; Joardar, S.N.; Isore, D.P.; Dey, S.; Samanta, I.; Murmu, S. Detection and characterization of pathogenic Pseudomonas aeruginosa from bovine subclinical mastitis in West Bengal, India. Vet. World 2017, 10, 738. [Google Scholar] [CrossRef]
- Banda, R.F.D.; Matofari, J.W.; Nduko, J.M.; Kenya, E. Hygienic practices and microbiological quality of milk from peri-urban dairy farmers and bulking centers in Lilongwe, Malawi. Bull. Anim. Health Prod. Afr. 2019, 67, 79–90. [Google Scholar]
- Elshafiee, E.A.; Nader, S.M.; Dorgham, S.M.; Hamza, D.A. Carbapenem-resistant Pseudomonas aeruginosa originating from farm animals and people in Egypt. J. Vet. Res. 2019, 63, 333–337. [Google Scholar] [CrossRef]
- Mahmoud, S.F.; Fayez, M.; Swelum, A.A.; Alswat, A.S.; Alkafafy, M.; Alzahrani, O.M.; Yusuf, S. Genetic Diversity, Biofilm Formation, and Antibiotic Resistance of Pseudomonas aeruginosa Isolated from Cow, Camel, and Mare with Clinical Endometritis. Vet. Sci. 2022, 9, 239. [Google Scholar] [CrossRef] [PubMed]
- Kirk, J.H.; Bartlett, P.C. Nonclinical Pseudomonas aeruginosa mastitis in a dairy herd. J. Am. Vet. Med. Assoc. 1984, 184, 671–673. [Google Scholar] [PubMed]
- Tartor, Y.H.; El-Naenaeey, E.Y. RT-PCR detection of exotoxin genes expression in multidrug resistant Pseudomonas aeruginosa. Mol. Cell. Biol. 2016, 62, 56–62. [Google Scholar]
- Salem, M.; Awad, A.; Younis, G. Antibiotic Susceptibility and Molecular Detection of Virulent Pseudomonas aeruginosa Isolated from Bovine Mastitis Milk in Egypt. J. Adv. Vet. Res. 2023, 13, 664–671. [Google Scholar]
- Wang, N.; Yang, X.; Jiao, S.; Zhang, J.; Ye, B.; Gao, S. Sulfonamide-resistant bacteria and their resistance genes in soils fertilized with manures from Jiangsu Province, Southeastern China. PLoS ONE 2014, 9, e112626. [Google Scholar] [CrossRef]
- Maclean, K.; Njamo, F.O.J.P.; Serepa-Dlamini, M.H.; Kondiah, K.; Green, E. Antimicrobial Susceptibility Profiles among Pseudomonas aeruginosa Isolated from Professional SCUBA Divers with Otitis Externa, Swimming Pools and the Ocean at a Diving Operation in South Africa. Pathogens 2022, 11, 91. [Google Scholar] [CrossRef]
Target Gene | Primer Sequence (5′–3′) | Amplified Segment (bp) | Primary Denaturation | Amplification (35 Cycles) | Final Extension | Reference | ||
---|---|---|---|---|---|---|---|---|
16S rRNA | GGGGGATCTTCGGACCTCA TCCTTAGAGTGCCCACCCG | 956 | 94 °C/5 min | 94 °C/30 s | 58 °C/40 s | 72 °C/45 s | 72 °C/10 min | [12] |
sul1 | CGGCGTGGGCTACCTGAACG GCCGATCGCGTGAAGTTCCG | 433 | 94 °C/5 min | 94 °C/30 s | 60 °C/40 s | 72 °C/45 s | 72 °C/10 min | [13] |
drfA | TGGTAGCTATATCGAAGAATGGAGT TATGTTAGAGGCGAAGTCTTGGGTA | 425 | 94 °C/5 min | 94 °C30 s | 60 °C/40 s | 72 °C/45 s | 72 °C/10 min | [14] |
ermB | CATTTAACGACGAAACTGGC GGAACATCTGTGGTATGGCG | 425 | 94 °C/5 min | 94 °C/30 s | 51 °C/40 s | 72 °C/45 s | 72 °C/10 min | [15] |
Samples | Farm I | Farm II | Farm III | Total of Examined Farms (n = 3) | ||||
---|---|---|---|---|---|---|---|---|
Total No. | Positive No. (%) | Total No. | Positive No. (%) | Total No. | Positive No. (%) | Total No. | Positive No. (%) | |
Animal | 60 | 13 (21.7) | 33 | 6 (18.2) | 55 | 4 (7.3) | 148 | 23 (15.6) |
Rectal swabs | 20 | 5 (25) | 13 | 3 (23.1) | 20 | 3 (15) | 53 | 11 (20.8) |
Milk | 20 | 3 (15) | 10 | 1 (10) | 20 | 1 (5) | 50 | 5 (10) |
Udder skin swabs | 20 | 5 (25) | 10 | 2 (20) | 15 | 0 (0) | 45 | 7 (15.6) |
Environment | 60 | 4 (6.7) | 22 | 3 (13.6) | 45 | 2 (4.4) | 127 | 9 (7.1) |
Drinking water | 15 | 2 (13.3) | 6 | 1 (16.7) | 10 | 1 (10) | 31 | 3 (9.7) |
Water source | 15 | 1 (6.7) | 6 | 1 (16.7) | 15 | 0 (0) | 36 | 3 (8.3) |
Feedstuff | 15 | 0 (0) | 5 | 0 (0) | 10 | 0 (0) | 30 | 0 (0) |
Bedding | 15 | 1 (6.7) | 5 | 1 (20) | 10 | 1 (10) | 30 | 3 (10) |
Human (hand swabs) | 15 | 1 (6.7) | 10 | 0 (0) | 20 | 0 (0) | 45 | 1 (2.2) |
Total | 135 | 18 (13.3) | 65 | 9 (16.4) | 120 | 6 (5) | 320 | 33 (10.3) |
p value | p = 0.267 | p = 0.914 | p = 0.36 | p = 0.045 * |
Samples | Household I | Household II | Household III | Total of Examined Household (n = 3) | ||||
---|---|---|---|---|---|---|---|---|
Total n | Positive n (%) | Total n | Positive n (%) | Total n | Positive n (%) | Total n | Positive n (%) | |
Animal | 15 | 11 (73.3) | 15 | 8 (53.3) | 15 | 9 (60) | 45 | 28 (62.2) |
Rectal swabs | 5 | 3 (60) | 5 | 5 (100) | 5 | 2 (40) | 15 | 10 (66.7) |
Milk | 5 | 4 (80) | 5 | 1 (20) | 5 | 3 (60) | 15 | 8 (53.3) |
Udder skin swabs | 5 | 4 (80) | 5 | 2 (40) | 5 | 4 (80) | 15 | 10 (66.7) |
Environment | 20 | 14 (70) | 20 | 14 (70) | 20 | 9 (45) | 60 | 37 (61.7) |
Drinking water | 5 | 4 (80) | 5 | 5 (100) | 5 | 2 (40) | 15 | 11 (73.3) |
Water source | 5 | 3 (60) | 5 | 3 (60) | 5 | 1 (20) | 15 | 7 (46.7) |
Feedstuff | 5 | 5 (100) | 5 | 3 (60) | 5 | 3 (60) | 15 | 11 (73.3) |
Bedding | 5 | 2 (40) | 5 | 3 (60) | 5 | 3 (60) | 15 | 8 (53.3) |
Human (hand swabs) | 5 | 1 (20) | 5 | 2 (40) | 5 | 1 (20) | 15 | 4 (26.7) |
Total | 35 | 25 (71.7) | 40 | 24 (60) | 40 | 19 (47.5) | 120 | 69 (57.5) |
p value | p = 0.813 | p = 0.402 | p = 0.287 | p = 0.546 * |
Samples | Total No. of Isolates | Distribution of Antimicrobial Resistance Amongst Strains | |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
E | G | AK | CP | NOR | SXT | IMP | AX | CPM | LEV | TZP | |||
Farm I | Animal | 13 | 6 | 11 | 6 | 2 | 0 | 13 | 9 | 4 | 10 | 3 | 7 |
Environment | 4 | 1 | 3 | 0 | 0 | 0 | 4 | 3 | 2 | 3 | 0 | 4 | |
Human | 1 | 1 | 1 | 1 | 0 | 0 | 1 | 1 | 1 | 1 | 1 | 1 | |
Total | 18 | 8 | 15 | 7 | 2 | 0 | 18 | 13 | 7 | 14 | 4 | 12 | |
Farm II | Animal | 6 | 5 | 4 | 4 | 1 | 0 | 6 | 5 | 5 | 4 | 1 | 5 |
Environment | 3 | 0 | 0 | 0 | 1 | 0 | 3 | 3 | 3 | 2 | 0 | 2 | |
Human | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | |
Total | 9 | 5 | 4 | 4 | 2 | 0 | 9 | 8 | 8 | 6 | 1 | 7 | |
Farm III | Animal | 4 | 1 | 2 | 0 | 1 | 3 | 4 | 1 | 1 | 3 | 2 | 2 |
Environment | 2 | 0 | 0 | 0 | 0 | 0 | 2 | 2 | 2 | 1 | 2 | 1 | |
Human | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | |
Total | 6 | 1 | 2 | 0 | 1 | 3 | 6 | 3 | 3 | 4 | 4 | 3 | |
Total | 33 | 13 | 21 | 11 | 5 | 3 | 33 | 24 | 18 | 24 | 9 | 22 | |
Resistance % | 100% | 39.4 | 63.3 | 33.3 | 15 | 9.1 | 100 | 72.7 | 54.5 | 72.7 | 27.3 | 68.8 |
Samples | Total No. of Positive | Distribution of Antimicrobial Resistance Amongst Strains | |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
E | G | AK | CP | NOR | SXT | IMP | AX | CPM | LEV | TZP | |||
Household I | Animal | 11 | 2 | 9 | 4 | 0 | 2 | 11 | 9 | 9 | 7 | 2 | 8 |
Environment | 14 | 3 | 5 | 4 | 0 | 1 | 14 | 12 | 12 | 10 | 4 | 7 | |
Human | 1 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 0 | |
Total | 26 | 5 | 14 | 8 | 0 | 3 | 26 | 21 | 21 | 18 | 6 | 15 | |
household II | Animal | 8 | 7 | 6 | 1 | 0 | 4 | 8 | 7 | 7 | 4 | 5 | 3 |
Environment | 14 | 14 | 14 | 0 | 0 | 9 | 14 | 10 | 10 | 9 | 11 | 7 | |
Human | 2 | 2 | 2 | 0 | 0 | 0 | 2 | 2 | 2 | 2 | 0 | 0 | |
Total | 24 | 23 | 22 | 1 | 0 | 13 | 24 | 19 | 19 | 15 | 16 | 10 | |
Household III | Animal | 9 | 9 | 9 | 0 | 0 | 3 | 6 | 8 | 8 | 9 | 5 | 2 |
Environment | 9 | 7 | 7 | 2 | 0 | 0 | 6 | 8 | 4 | 5 | 3 | 0 | |
Human | 1 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 0 | 0 | |
Total | 19 | 16 | 16 | 2 | 0 | 3 | 13 | 17 | 12 | 14 | 8 | 2 | |
Total | 69 | 44 | 52 | 11 | 0 | 19 | 63 | 57 | 52 | 47 | 30 | 27 | |
Resistance % | 100 | 63.8 | 75.4 | 15.9 | 0 | 27.5 | 91.3 | 82.6 | 75.4 | 68.1 | 43.5 | 39.1 |
Source | Sample | Antimicrobial Profile | MAR Index | Distribution of Antibiotic Resistance Genes | ||||
---|---|---|---|---|---|---|---|---|
Farm No. | Type | ID | Type | drfA | sul1 | ermB | ||
Farm I | Animal | 2 | Rectal swab | SXT, E, G, AK, IMP, CPM, TZP | 0.636 MDR | + | + | + |
6 | Rectal swab | SXT, E, G, IMP, AX, CPM | 0.545 MDR | + | + | + | ||
7 | Rectal swab | SXT, E, G, AK, CP, CPM | 0.545 MDR | + | + | + | ||
13 | Rectal swab | SXT, G, IMP, AX, CPM | 0.454 MDR | + | ||||
19 | Rectal swab | SXT, G, AK, IMP, AX, CPM, LEV | 0.636 MDR | + | ||||
33 | Milk | SXT, G, AK, CPM, LEV | 0.454 MDR | + | ||||
35 | Milk | SXT, E, G, AK, IMP, AX, CPM, TZP | 0.727 MDR | + | ||||
39 | Milk | SXT, G, IMP, TZP | 0.363 MDR | + | ||||
44 | Rectal swab | SXT, G, AK, CPM, TZP | 0.454 MDR | + | ||||
50 | Rectal swab | SXT, G, IMP | 0.272 | + | ||||
51 | Rectal swab | SXT, IMP, CPM, TZP | 0.363 MDR | + | ||||
53 | Rectal swab | SXT, E, IMP, TZP | 0.363 | + | + | |||
56 | Rectal swab | SXT, E, G, CP, CPM, LEV, TZP | 0.636 MDR | + | + | |||
Environment | 66 | Drinking water | SXT, G, IMP, CPM, TZP | 0.454 MDR | + | + | ||
67 | Drinking water | SXT, G, TZP | 0.272 | + | + | |||
73 | Drinking water | SXT, E, G, IMP, AX, CPM, TZP | 0.636 MDR | + | + | |||
89 | Bedding | SXT, G, IMP, AX, CPM, TZP | 0.545 MDR | + | ||||
101 | Hand swab | SXT, E, G, AK, IMP, AX, CPM, LEV, TZP | 0.818 MDR | + | + | + | ||
Farm II | Animal | 115 | Rectal swab | SXT, G, AK, IMP, AX, CPM, TZP | 0.636 MDR | + | ||
119 | Rectal swab | SXT, G, AK, IMP, AX, TZP | 0.545 MDR | + | ||||
120 | Rectal swab | SXT, E, AK, IMP, AX, CPM, TZP | 0.636 MDR | + | + | + | ||
139 | Milk | SXT, E, G, AK, IMP, CPM, LEV, TZP | 0.727 MDR | + | + | + | ||
161 | Udder skin swab | SXT, E, IMP, AX, TZP | 0.454 | + | + | |||
163 | Udder skin swab | SXT, E, G, CP, AX, CPM | 0.545 MDR | + | + | + | ||
Environment | 177 | Drinking water | SXT, CP, IMP, AX, CPM, TZP | 0.545 MDR | + | |||
183 | Water source | SXT, IMP, AX | 0.272 | + | ||||
185 | Bedding | SXT, IMP, AX, CPM, TZP | 0.454 MDR | + | ||||
Farm III | Animal | 201 | Rectal swab | SXT, IMP, AX, LEV, TZP | 0.454 MDR | + | ||
213 | Rectal swab | SXT, E, G, CP, NOR, CPM | 0.545 MDR | + | + | |||
224 | Rectal swab | SXT, CP, NOR, CPM | 0.363 | + | ||||
246 | Milk | SXT, G, NOR, CPM, LEV, TZP | 0.545 MDR | + | ||||
Environment | 287 | Drinking water | SXT, IMP, AX, LEV | 0.363 | + | |||
292 | Bedding | SXT, IMP, AX, CPM, LEV, TZP | 0.545 MDR | + |
Source | Sample | Antimicrobial Resistance Profile | MAR Index | Distribution of Antibiotic Resistance Genes | ||||
---|---|---|---|---|---|---|---|---|
Household No. | Type | ID | Type | drfA | sul1 | ermB | ||
Household I | Animal | 311 | Rectal swab | G, SXT, IMP, AX, CPM | 0.454 MDR | + | ||
312 | Rectal swab | G, SXT, IMP, AX, TZP | 0.454 MDR | + | ||||
314 | Rectal swab | AK, SXT, IMP, AX, CPM, LEV | 0.545 MDR | + | ||||
316 | Milk | G, SXT, IMP, AX, TZP | 0.454 MDR | + | ||||
317 | Milk | SXT, IMP, AX, CPM, TZP | 0.454 MDR | + | ||||
318 | Milk | G, SXT, IMP, AX, CPM, TZP | 0.545 MDR | + | ||||
319 | Milk | G, AK, SXT, IMP, AX, CPM, LEV | 0.636 MDR | + | ||||
322 | Udder skin swab | E, G, AK, NOR, SXT, CPM, TZP | 0.636 MDR | + | + | + | ||
323 | Udder skin swab | G, SXT, IMP, AX, TZP | 0.454 MDR | + | ||||
324 | Udder skin swab | G, SXT, IMP, AX, TZP | 0.454 MDR | + | ||||
325 | Udder skin swab | E, G, AK, NOR, SXT, CPM, TZP | 0.636 MDR | + | + | + | ||
Environment | 326 | Drinking water | G, AK, SXT, CPM, LEV, TZP | 0.545 MDR | + | + | ||
328 | Drinking water | G, SXT, IMP, AX, CPM, LEV, TZP | 0.636 MDR | + | ||||
329 | Drinking water | AK, SXT, IMP, AX, CPM, TZP | 0.545 MDR | + | + | |||
330 | Drinking water | SXT, IMP, AX, CPM, LEV | 0.454 MDR | + | ||||
331 | Water source | E, G, SXT, IMP, AX, CPM, LEV, TZP | 0.727 MDR | + | + | |||
333 | Water source | E, G, AK, SXT, IMP, AX, CPM | 0.636 MDR | + | + | |||
334 | Water source | NOR, SXT, IMP, AX, CPM | 0.454 MDR | + | + | |||
336 | Feedstuff | SXT, IMP, AX, CPM, TZP | 0.454 MDR | + | ||||
337 | Feedstuff | SXT, IMP, AX, CPM, TZP | 0.454 MDR | + | ||||
338 | Feedstuff | SXT, IMP, AX, TZP | 0.363 | + | ||||
339 | Feedstuff | SXT, IMP, AX | 0.272 | + | ||||
340 | Feedstuff | SXT, IMP, AX | 0.272 | + | ||||
343 | Bedding | SXT, IMP, AX | 0.272 | + | ||||
345 | Bedding | E, G, AK, SXT, CPM | 0.454 | + | + | + | ||
Human | 349 | Hand swab | SXT, CPM | 0.181 | + | + | ||
Household II | Animal | 351 | Rectal swab | SXT, IMP, AX, LEV, TZP | 0.454 MDR | + | + | |
352 | Rectal swab | E, AK, SXT, IMP, AX, LEV, TZP | 0.636 MDR | + | + | |||
353 | Rectal swab | E, G, SXT, IMP, AX, CPM | 0.545 MDR | + | + | |||
354 | Rectal swab | E, G, NOR, SXT, IMP, AX, CPM, LEV | 0.727 MDR | + | ||||
355 | Rectal swab | E, G, NOR, SXT, IMP, AX | 0.545 | + | ||||
360 | Milk | E, G, NOR, SXT, IMP, AX, LEV, TZP | 0.727 MDR | + | + | + | ||
362 | Udder skin swab | E, G, SXT, CPM, LEV | 0.454 MDR | |||||
364 | Udder skin swab | E, G, NOR, SXT, IMP, AX, CPM | 0.636 MDR | + | + | |||
Environment | 366 | Drinking water | E, G, NOR, SXT, IMP, AX, CPM, LEV | 0.727 MDR | + | + | + | |
367 | Drinking water | E, G, SXT, IMP, AX, CPM, LEV, TZP | 0.727 MDR | + | + | + | ||
368 | Drinking water | E, G, SXT, IMP, AX, LEV, TZP | 0.636 MDR | + | ||||
369 | Drinking water | E, G, NOR, SXT, IMP, AX, CPM, LEV | 0.727 MDR | + | ||||
370 | Drinking water | E, G, SXT, CPM, LEV, TZP | 0.545 MDR | + | + | + | ||
371 | Water source | E, G, NOR, SXT, IMP, AX, CPM, LEV | 0.727 MDR | + | + | |||
372 | Water source | E, G, NOR, SXT, CPM, LEV, TZP | 0.636 MDR | |||||
374 | Water source | E, G, NOR, SXT | 0.363 | + | + | + | ||
378 | Feedstuff | E, G, SXT, CPM, LEV | 0.454 MDR | + | + | |||
379 | Feedstuff | E, G, NOR, SXT, IMP, AX | 0.545 | + | + | |||
380 | Feedstuff | E, G, SXT, IMP, AX, CPM, LEV, TZP | 0.727 MDR | + | ||||
381 | Bedding | E, G, NOR, SXT, IMP, AX, CPM, TZP | 0.727 MDR | + | ||||
384 | Bedding | E, G, NOR, SXT, IMP, AX, LEV, TZP | 0.727 MDR | + | + | |||
385 | Bedding | E, G, NOR, SXT, IMP, AX, LEV | 0.636 MDR | + | + | |||
Human | 386 | Hand swab | E, G, SXT, IMP, AX, CPM | 0.545 MDR | + | + | + | |
388 | Hand swab | E, G, SXT, IMP, AX, CPM | 0.545 MDR | + | + | + | ||
household III | Animal | 393 | Rectal swab | E, G, IMP, AX, SXT, CPM | 0.545 MDR | + | + | + |
395 | Rectal swab | E, G, IMP, AX, SXT, CPM | 0.545 MDR | + | + | |||
398 | Milk | E, G, IMP, AX, SXT, CPM, LEV, TZP | 0.727 MDR | + | + | |||
399 | Milk | E, G, IMP, AX, SXT, CPM, LEV | 0.636 MDR | + | + | + | ||
400 | Milk | E, G, IMP, AX, SXT, CPM | 0.545 MDR | + | + | |||
402 | Udder skin swab | E, G, NOR, IMP, AX, SXT, CPM, LEV, TZP | 0.818 MDR | + | + | |||
403 | Udder skin swab | E, G, NOR, IMP, AX, CPM, LEV | 0.636 MDR | + | ||||
404 | Udder skin swab | E, G, NOR, IMP, AX, CPM | 0.545 MDR | + | ||||
405 | Udder skin swab | E, G, CPM, LEV | 0.363 MDR | + | ||||
Environment | 406 | Drinking water | E, G, IMP, AX, CPM | 0.454 MDR | + | |||
410 | Drinking water | E, G, IMP, AX, CPM, LEV | 0.545 MDR | + | ||||
415 | Water source | E, G, IMP, AX, CPM | 0.454 MDR | + | ||||
418 | Feedstuff | E, AK, SXT, IMP, LEV | 0.454 MDR | + | + | + | ||
419 | Feedstuff | E, G, SXT, IMP, CPM | 0.454 MDR | + | + | |||
420 | Feedstuff | G, SXT, IMP | 0272 | + | ||||
421 | Bedding | SXT | 0.090 | + | + | |||
423 | Bedding | E, G, IMP, AX, LEV | 0.454 MDR | + | ||||
425 | Bedding | E, G, AK, SXT, CPM | 0.454 MDR | + | + | + | ||
Human | 427 | Hand swab | SXT, IMP | 0.181 | + | + |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Badawy, B.; Moustafa, S.; Shata, R.; Sayed-Ahmed, M.Z.; Alqahtani, S.S.; Ali, M.S.; Alam, N.; Ahmad, S.; Kasem, N.; Elbaz, E.; et al. Prevalence of Multidrug-Resistant Pseudomonas aeruginosa Isolated from Dairy Cattle, Milk, Environment, and Workers’ Hands. Microorganisms 2023, 11, 2775. https://doi.org/10.3390/microorganisms11112775
Badawy B, Moustafa S, Shata R, Sayed-Ahmed MZ, Alqahtani SS, Ali MS, Alam N, Ahmad S, Kasem N, Elbaz E, et al. Prevalence of Multidrug-Resistant Pseudomonas aeruginosa Isolated from Dairy Cattle, Milk, Environment, and Workers’ Hands. Microorganisms. 2023; 11(11):2775. https://doi.org/10.3390/microorganisms11112775
Chicago/Turabian StyleBadawy, Basma, Samar Moustafa, Radwa Shata, Mohamed Z. Sayed-Ahmed, Saad S. Alqahtani, Md Sajid Ali, Nawazish Alam, Sarfaraz Ahmad, Nahed Kasem, Elzahara Elbaz, and et al. 2023. "Prevalence of Multidrug-Resistant Pseudomonas aeruginosa Isolated from Dairy Cattle, Milk, Environment, and Workers’ Hands" Microorganisms 11, no. 11: 2775. https://doi.org/10.3390/microorganisms11112775
APA StyleBadawy, B., Moustafa, S., Shata, R., Sayed-Ahmed, M. Z., Alqahtani, S. S., Ali, M. S., Alam, N., Ahmad, S., Kasem, N., Elbaz, E., El-Bahkiry, H. S., Radwan, R. M., El-Gohary, A., & Elsayed, M. M. (2023). Prevalence of Multidrug-Resistant Pseudomonas aeruginosa Isolated from Dairy Cattle, Milk, Environment, and Workers’ Hands. Microorganisms, 11(11), 2775. https://doi.org/10.3390/microorganisms11112775