Prevalence and Characterisation of Clostridium perfringens Isolates in Food-Producing Animals in Romania
Abstract
1. Introduction
2. Materials and Methods
2.1. Sampling
2.2. C. perfringens Isolation
2.3. Toxinotyping of the C. perfrigens Isolates
2.4. Antimicrobial Susceptibility Testing
3. Results
3.1. Prevalence of C. perfringens
3.2. Toxinotyping of the C. perfringens Isolates
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Freedman, J.C.; Theoret, J.R.; Wisniewski, J.A.; Uzal, F.A.; Rood, J.I.; McClane, B.A. Clostridium perfringens type A–E toxinplasmids. Res. Microbiol. 2015, 166, 264. [Google Scholar] [CrossRef] [PubMed]
- Khan, M.A.; Bahadar, S.; Ullah, N.; Ullah, S.; Shakeeb, U.; Khan, A.Z.; Khan, I.U.; Kalhoro, N.H.; Shah, M.B.; Malik, M.I.U. Distribution and antimicrobial resistance patterns of Clostridium perfringens isolated from vaccinated and unvaccinated goats. Small Rumin. Res. 2019, 173, 70–73. [Google Scholar] [CrossRef]
- Jang, Y.-S.; Kim, D.-H.; Bae, D.; Kim, S.-H.; Kim, H.; Moon, J.-S.; Song, K.-Y.; Chon, J.-W.; Seo, K.-H. Prevalence, toxin-typing, and antimicrobial susceptibility of Clostridium perfringens from retail meats in Seoul, Korea. Anaerobe 2020, 64, 102235. [Google Scholar] [CrossRef] [PubMed]
- Aras, Z.; Hadimli, H.H. Detection and molecular typing of Clostridium perfringens isolates from beef, chicken and turkey meats. Anaerobe 2015, 32, 15–17. [Google Scholar] [CrossRef] [PubMed]
- Haider, Z.; Ali, T.; Ullah, A.; Basit, A.; Tahir, H.; Tariq, H.; Ilyas, S.Z.; Hayat, Z.; Rehman, S.-U. Isolation, toxinotyping and antimicrobial susceptibility testing of Clostridium perfringens isolated from Pakistan poultry. Anaerobe 2022, 73, 102499. [Google Scholar] [CrossRef]
- Rood, J.I.; Adams, V.; Lacey, J.; Lyras, D.; McClane, B.A.; Melville, S.B.; Moore, R.J.; Popoff, M.R.; Sarker, M.R.; Songer, J.G.; et al. Expansion of the Clostridium perfringens toxin-based typing scheme. Anaerobe 2018, 53, 5–10. [Google Scholar] [CrossRef]
- Azimirad, M.; Gholami, F.; Yadegar, A.; Knight, D.R.; Shamloei, S.; Aghdaei, H.A.; Zali, M.R. Prevalence and characterization of Clostridium perfringens toxinotypes among patients with antibiotic-associated diarrhea in Iran. Sci. Rep. 2019, 9, 7792. [Google Scholar] [CrossRef]
- Petit, L.; Gibert, M.; Popoff, M.R. Clostridium perfringens: Toxinotype and genotype. Trends Microbiol. 1999, 7, 104–110. [Google Scholar] [CrossRef]
- Yonogi, S.; Kanki, M.; Ohnishi, T.; Shiono, M.; Iida, T.; Kumeda, Y. Development and application of a multiplex PCR assay for detection of the Clostridium perfringens enterotoxin-encoding genes cpe and becAB. J. Microbiol. Methods 2016, 127, 172–175. [Google Scholar] [CrossRef]
- Li, J.; Zhou, Y.; Yang, D.; Zhang, S.; Sun, Z.; Wang, Y.; Wang, S.; Wu, C. Prevalence and antimicrobial susceptibility of Clostridium perfringens in chickens and pigs from Beijing and Shanxi, China. Vet. Microbiol. 2020, 252, 108932. [Google Scholar] [CrossRef]
- Johansson, A.; Greko, C.; Engström, B.; Karlsson, M. Antimicrobial susceptibility of Swedish, Norwegian and Danish isolates of Clostridium perfringens from poultry, and distribution of tetracycline resistance genes. Vet. Microbiol. 2004, 99, 251–257. [Google Scholar] [CrossRef] [PubMed]
- Hecht, D.W. Anaerobes: Antibiotic resistance, clinical significance, and the role of susceptibility testing. Anaerobe 2006, 12, 115–121. [Google Scholar] [CrossRef]
- Colobatiu, L.; Tabaran, A.; Flonta, M.; Oniga, O.; Mirel, S.; Mihaiu, M. First description of plasmid-mediated quinolone resistance determinants and β-lactamase encoding genes in non-typhoidal Salmonella isolated from humans, one companion animal and food in Romania. Gut. Pathog. 2015, 7, 16. [Google Scholar] [CrossRef]
- Kiu, R.; Hall, L.J. An update on the human and animal enteric pathogen Clostridium perfringens. Emerg. Microbes Infect. 2018, 7, 1–15. [Google Scholar] [CrossRef] [PubMed]
- Erol, I.; Goncuoglu, M.; Ayaz, N.; Ormanci, F.B.; Hildebrandt, G. Molecular typing of Clostridium perfringens isolated from turkey meat by multiplex PCR. Lett. Appl. Microbiol. 2008, 47, 31–34. [Google Scholar] [CrossRef] [PubMed]
- Meer, R.R.; Songer, J.G. Multiplex polymerase chain reaction assay for genotyping Clostridium perfringens. Am. J. Vet. Res. 1997, 58, 702–705. [Google Scholar] [PubMed]
- Yonogi, S.; Matsuda, S.; Kawai, T.; Yoda, T.; Harada, T.; Kumeda, Y.; Gotoh, K.; Hiyoshi, H.; Nakamura, S.; Kodama, T.; et al. BEC, a Novel Enterotoxin of Clostridium perfringens Found in Human Clinical Isolates from Acute Gastroenteritis Outbreaks. Infect. Immun. 2014, 82, 2390–2399. [Google Scholar] [CrossRef]
- Clinical and Laboratory Standards Institute (CLSI). Methods for Antimicrobial Susceptibility Testing of Anaerobic Bacteria, 9th ed.; CLSI document M07-A8; CLSI: Wayne, PA, USA, 2018. [Google Scholar]
- Anju, K.; Karthik, K.; Divya, V.; Mala Priyadharshini, M.L.; Sharma, R.K.; Manoharan, S. Toxinotyping and molecular characterization of antimicrobial resistance in Clostridium perfringens isolated from different sources of livestock and poultry. Anaerobe 2021, 67, 102298. [Google Scholar] [CrossRef]
- Willis, A.T. Anaerobic Bacteriology: Clinical and Laboratory Practice; Butterworths: Portsmouth, NH, USA, 1977; p. 360. [Google Scholar]
- Fayez, M.; Elsohaby, I.; Al-Marri, T.; Zidan, K.; Aldoweriej, A.; El-Sergany, E.; Elmoslemany, A. Genotyping and antimicrobial susceptibility of Clostridium perfringens isolated from dromedary camels, pastures and herders. Comp. Immunol. Microbiol. Infect. Dis. 2020, 70, 101460. [Google Scholar] [CrossRef]
- Lianou, A.; Panagou, E.Z.; Nychas, G.J.E. Meat Safety—I Foodborne Pathogens and Other Biological Issues. In Lawrie’s Meat Science; Toldra, F., Ed.; Woodhead Publishing: Boca Raton, FL, USA, 2017; pp. 521–552. [Google Scholar]
- Thitaram, S.N.; Frank, J.F.; Siragusa, J.R.; Bailey, J.S.; Dargatz, D.A.; Lombard, J.E.; Haley, C.A.; Lyon, S.A.; Fedorka-Cray, P.J. Antimicrobial susceptibility of Clostridium difficile isolated from food animals on farms. Int. J. Food Microbiol. 2016, 227, 1–5. [Google Scholar] [CrossRef]
- Álvarez-Pérez, S.; Blanco, J.L.; Astorga, R.J.; Gómez-Laguna, J.; Barrero-Domínguez, B.; Galán-Relaño, A.; Harmanus, C.; Kuijper, E.; Garcia, M. Distribution and tracking of Clostridium difficile and Clostridium perfringens in a free-range pig abattoir and processing plant. Food Res. Int. 2018, 113, 456–464. [Google Scholar] [CrossRef] [PubMed]
- Yadav, J.P.; Das, S.C.; Dhaka, P.; Vijay, D.; Kumar, M.; Mukhopadhyay, A.K.; Chowdhury, G.; Chauhan, P.; Singh, R.; Dhama, K.; et al. Molecular characterization and antimicrobial resistance profile of Clostridium perfringens type A isolates from humans, animals, fish and their environment. Anaerobe 2017, 47, 120–124. [Google Scholar] [CrossRef] [PubMed]
- Zhang, T.; Zhang, W.; Ai, D.; Zhang, R.; Lu, Q.; Luo, Q.; Shao, H. Prevalence and characterization of Clostridium perfringens in broiler chickens and retail chicken meat in central China. Anaerobe 2018, 54, 100–103. [Google Scholar] [CrossRef] [PubMed]
- Wen, Q.; McClane, B.A. Detection of Enterotoxigenic Clostridium perfringens Type A Isolates in American Retail Foods. Appl. Environ. Microbiol. 2004, 70, 2685–2691. [Google Scholar] [CrossRef] [PubMed]
- Hu, W.-S.; Kim, H.; Koo, O.K. Molecular genotyping, biofilm formation and antibiotic resistance of enterotoxigenic Clostridium perfringens isolated from meat supplied to school cafeterias in South Korea. Anaerobe 2018, 52, 115–121. [Google Scholar] [CrossRef] [PubMed]
- Wu, D.; Luo, R.; Gong, G.; Zhang, L.; Huang, J.; Cai, C.; Li, Y.; Irshad, I.; Song, R.; Suolang, S. Antimicrobial susceptibility and multilocus sequence typing of Clostridium perfringens isolated from yaks in Qinghai-Tibet plateau, China. Front. Vet. Sci. 2022, 9, 1562. [Google Scholar] [CrossRef]
- Ngamwongsatit, B.; Tanomsridachchai, W.; Suthienkul, O.; Urairong, S.; Navasakuljinda, W.; Janvilisri, T. Multidrug resistance in Clostridium perfringens isolated from diarrheal neonatal piglets in Thailand. Anaerobe 2016, 38, 88–93. [Google Scholar] [CrossRef]
- Osman, K.M.; Soliman, Y.A.; Amin, Z.M.S.; Aly, M.A.K. Prevalence of Clostridium perfringens type A isolates in commercial broiler chickens and parent broiler breeder hens in Egypt. Rev. Sci. Tech. 2012, 31, 931–941. [Google Scholar] [CrossRef] [PubMed]
- Gholamiandehkordi, A.; Eeckhaut, V.; Lanckriet, A.; Timbermont, L.; Bjerrum, L.; Ducatelle, R.; Haesebrouck, F.; Van Immerseel, F. Antimicrobial resistance in Clostridium perfringens isolates from broilers in Belgium. Vet. Res. Commun. 2009, 33, 1031–1037. [Google Scholar] [CrossRef]
- Chan, G.; Farzan, A.; Soltes, G.; Nicholson, V.M.; Pei, Y.; Friendship, R.; Prescott, J.F. The epidemiology of Clostridium perfringens type A on Ontario swine farms, with special reference to cpb2-positive isolates. BMC Vet. Res. 2012, 8, 156. [Google Scholar] [CrossRef]
- Athira, C.K.; Milton, A.A.P.; Reddy, A.; Rajendrakumar, A.M.; Abhishek; Verma, M.R.; Kumar, A.; Nagaleekar, V.K.; Agarwal, R.K. Diversity of toxin-genotypes among Clostridium perfringens isolated from healthy and diarrheic neonatal cattle and buffalo calves. Anaerobe 2018, 49, 99–102. [Google Scholar] [CrossRef] [PubMed]
- Uzal, F.A.; Vidal, J.E.; McClane, B.A.; Gurjar, A.A. Clostridium Perfringens Toxins Involved in Mammalian Veterinary Diseases. Open Toxinol. J. 2010, 3, 24–42. [Google Scholar] [CrossRef]
- Songer, J.G.; Uzal, F.A. Clostridial Enteric Infections in Pigs. J. Vet. Diagn. Investig. 2005, 17, 528–536. [Google Scholar] [CrossRef]
- Baker, A.A.; Davis, E.; Rehberger, T.; Rosener, D. Prevalence and Diversity of Toxigenic Clostridium perfringens and Clostridium difficile among Swine Herds in the Midwest. Appl. Environ. Microbiol. 2010, 76, 2961–2967. [Google Scholar] [CrossRef]
- De Cesare, A.; Borilova, G.; Svobodova, I.; Bondioli, V.; Manfreda, G. Clostridium perfringens occurrence and ribotypes in healthy broilers reared in different European countries. Poult. Sci. 2009, 88, 1850–1857. [Google Scholar] [CrossRef][Green Version]
- Fancher, C.A.; Thames, H.T.; Colvin, M.G.; Zhang, L.; Nuthalapati, N.; Kiess, A.; Dinh, T.T.; Sukumaran, A.T. Research Note: Prevalence and molecular characteristics of Clostridium perfringens in “no antibiotics ever” broiler farms. Poult. Sci. 2021, 100, 101414. [Google Scholar] [CrossRef] [PubMed]
- Miki, Y.; Miyamoto, K.; Kaneko-Hirano, I.; Fujiuchi, K.; Akimoto, S. Prevalence and Characterization of Enterotoxin Gene-Carrying Clostridium perfringens Isolates from Retail Meat Products in Japan. Appl. Environ. Microbiol. 2008, 74, 5366–5372. [Google Scholar] [CrossRef] [PubMed]
- Llanco, L.; Nakano, V.; Ajp, F.; Avila-Campos, M. Toxinotyping and antimicrobial susceptibility of Clostridium perfringens isolated from broiler chickens with necrotic enteritis. Int. J. Microbiol. Res. 2012, 4, 290–294. [Google Scholar]
- Jeong, D.; Kim, D.-H.; Kang, I.-B.; Chon, J.-W.; Kim, H.; Om, A.-S.; Lee, J.-Y.; Moon, J.-S.; Oh, D.-H.; Seo, K.-H. Prevalence and toxin type of Clostridium perfringens in beef from four different types of meat markets in Seoul, Korea. Food Sci. Biotechnol. 2017, 26, 545–548. [Google Scholar] [CrossRef]
- Kouassi, K.A.; Dadie, A.T.; N’Guessan, K.F.; Dje, K.M.; Loukou, Y.G. Clostridium perfringens and Clostridium difficile in cooked beef sold in Côte d’Ivoire and their antimicrobial susceptibility. Anaerobe 2014, 28, 90–94. [Google Scholar] [CrossRef]
- Imre, K.; Herman, V.; Morar, A. Scientific Achievements in the Study of the Occurrence and Antimicrobial Susceptibility Profile of Major Foodborne Pathogenic Bacteria in Foods and Food Processing Environments in Romania: Review of the Last Decade. BioMed Res. Int. 2020, 2020, 5134764. [Google Scholar] [CrossRef] [PubMed]

| Gene | Name of Primer | Primer Sequence (5′–3′) | Product Size (bp) | Reference |
|---|---|---|---|---|
| cpa | CPA-F | gctaatgttactgccgttga | 324 | [15] |
| CPA-R | cctctgatacatcgtgtaag | |||
| cpe | CPE-F | ggagatggttggatattagg | 233 | [9,15,16] |
| CPE-R | ggaccagcagttgtagata | |||
| becA | becA-F | caatggggcgaagaaaatta | 499 | [17] |
| becA-R | aaccatgatcaattaaaacctca | |||
| becB | becB-F | tgcaaatgacccttacactga | 416 | [17] |
| becB-R | agattggagcagagccagaa |
| Antimicrobial Agent | Disc Concentration | Number of Resistant Isolates | Resistance (%) |
|---|---|---|---|
| Tetracycline | 30 μg | 10 | 71.4 |
| Erythromycin | 15 μg | 6 | 42.8 |
| Gentamicin | 10 μg | 1 | 7.1 |
| Vancomycin | 10 μg | 0 | 0 |
| Rifampicin | 5 μg | 0 | 0 |
| Penicillin | 10 UI | 9 | 64.2 |
| Bacitracin | 10 UI | 2 | 14.2 |
| Lincomycin | 2 μg | 0 | 0 |
| Enrofloxacin | 5 μg | 5 | 35.7 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Beres, C.; Colobatiu, L.; Tabaran, A.; Mihaiu, R.; Mihaiu, M. Prevalence and Characterisation of Clostridium perfringens Isolates in Food-Producing Animals in Romania. Microorganisms 2023, 11, 1373. https://doi.org/10.3390/microorganisms11061373
Beres C, Colobatiu L, Tabaran A, Mihaiu R, Mihaiu M. Prevalence and Characterisation of Clostridium perfringens Isolates in Food-Producing Animals in Romania. Microorganisms. 2023; 11(6):1373. https://doi.org/10.3390/microorganisms11061373
Chicago/Turabian StyleBeres, Corina, Liora Colobatiu, Alexandra Tabaran, Romolica Mihaiu, and Marian Mihaiu. 2023. "Prevalence and Characterisation of Clostridium perfringens Isolates in Food-Producing Animals in Romania" Microorganisms 11, no. 6: 1373. https://doi.org/10.3390/microorganisms11061373
APA StyleBeres, C., Colobatiu, L., Tabaran, A., Mihaiu, R., & Mihaiu, M. (2023). Prevalence and Characterisation of Clostridium perfringens Isolates in Food-Producing Animals in Romania. Microorganisms, 11(6), 1373. https://doi.org/10.3390/microorganisms11061373

