Comparison of the Diagnostic Accuracy of Three Real-Time PCR Assays for the Detection of Arcobacter butzleri in Human Stool Samples Targeting Different Genes in a Test Comparison without a Reference Standard
Abstract
1. Introduction
2. Materials and Methods
2.1. Residual Volumes of Sample Materials Used for the Test Comparison, Inclusion and Exclusion Criteria
2.2. Nucleic Acid Extraction and Storage
2.3. Real-Time PCR Assays Comparatively Applied for the Detection of Arcobacter butzleri
2.4. Diagnostic Accuracy Estimation, Agreement and Comparison of Obtained Cycle Threshold (Ct) Values
2.5. Ethics
3. Results
3.1. Quantitative and Qualitative Results Obtained with Spiked Sample Materials
3.2. Sensitivity and Specificity of the Assays as Calculated Based on Latent Class Analysis (LCA), Agreement between the Compared Assays and Accuracy-Adjusted Prevalence Estimations
3.3. Comparison of the Recorded Cycle Threshold (Ct) Values
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
Target Pathogen | Target Gene | Forward Primer | Reverse Primer | Probe(s) as Well as Modifications at the 5′- and 3′-Ends | Reference |
---|---|---|---|---|---|
A(lia)rcobacter spp. * | gyrA | 5′-ATCTTTAGTATTCTTTACAAGAAATGG-3′ | 5′-AACTGTTGTTCGTTTTCCA-3′ | 5′-LC640-ATCAAGGAAGAAGTACAAGAGGTGTAAG-3′ & 5′-AGTCTTGGTCAATGTATTAGATTTGAACTTGAAAAAACAAG-Alexa488-3′ | [36] |
A. butzleri | rpoB/C | 5′-GCCACACCAGTGACAATATC-3′ & 5′-AAAAAATACTTTCTTGGTCTTGTGGTGTA-3′ | 5′-AACAACACCTTTGTATCTCATTTTTTTG-3′ | 5′-HEX-TTGGACCAGTAAAAGATTATGAGTGTCTTTGTGGTAAA-BHQ1-3′ | [37] |
A. butzleri | hsp60 | 5′-CTCTTCATTAAAAGAGATGTTACCAATTTT-3′ | 5′-CACCATCTACATCTTCWGCAATAATTACT-3′ | 5′-FAM-CTTCCTGATTGATTTACTGATT-MBG-NFQ-3′ | [38] |
gyrA Assay | rpoB/C Assay | hsp60 Assay | PhHV DNA-Based Inhibition Control Assay | |
---|---|---|---|---|
Reaction chemistry | ||||
Master Mix | HotStarTaq (Qiagen) | HotStarTaq (Qiagen) | HotStarTaq (Qiagen) | HotStarTaq (Qiagen) |
Reaction volume (µL) | 20 µL | 20 µL | 20 µL | 20 µL |
Forward primer concentration (nM) | 700 nM | 300 nM (each) | 300 nM | 300 nM |
Reverse primer concentration (nM) | 700 nM | 300 nM | 300 nM | 300 nM |
Probe concentration (nM) | 200 nM (each) | 100 nM | 100 nM | 100 nM |
Final Mg2+ concentration (nM) | 2.0 mM | 4.5 mM | 4.5 mM | 4.5 mM |
Bovine serum albumin (ng/µL) | none | 5 ng/µL | 5 ng/µL | 5 ng/µL |
Run conditions | ||||
Initial denaturation | 95 °C, 15 min. | 95 °C, 15 min. | 95 °C, 15 min. | 95 °C, 15 min. |
Cycle numbers | 50 | 40 | 40 | 40 |
Denaturation | 95 °C, 10 s | 95 °C, 15 s | 95 °C, 15 s | 95 °C, 15 s |
Annealing | 60 °C, 10 s | 60 °C, 1 min. | 60 °C, 1 min. | 60 °C, 1 min. |
Amplification | 72 °C, 25 s | Identical with annealing step | Identical with annealing step | Identical with annealing step |
Hold | 95 °C, 1 min. followed by 45 °C, 50 s before melting, finally 40 °C, 30 s after melting | 40 °C, 20 s | 40 °C, 20 s | 40 °C, 20 s |
Melting conditions | Ramp from 45 °C to 80 °C with 5 cycles touchdown, rising of 1 °C each step, waiting for 90 s of pre-melt conditioning on first step, waiting for 4 s of each step afterwards, acquiring on green (Alexa 488) channel | Not applicable | Not applicable | Not applicable |
Positive Control Insert Based on A. butzleri Sequences according to the NCBI Accession Numbers AB104481.1, AY628390.1 and DQ464331.1 |
---|
5′-ACAAAAAAATCTCTTCATTAAAAGAGATGTTACCAATTTTAGAATCAGTAAATCAATCAGGAAGACCTTTAGTAATTATTGCTGAAGATGTAGATGGTGAAGCATTAGCGAATTCGCAAGTCCAGAAAAAATACTTTCTTGGTCTTGTGGTGAAGTTAAAAAACCTGAAACAATTAATTATAGAACATTAAAACCAGAAAGAGATGGATTATTTTGTGCTAAAATTTTTGGACCAGTAAAAGATTATGAGTGTCTTTGTGGTAAATACAAAAAAATGAGATACAAAGGTGTTGTTTGCGAAAGAATTCACGAATCTAAATCTTTAGTATTCTTTACAAGAAATGGAATTATAAAAAGAACATCATTAAATGAATTCTCAAATATTAGAAGTAATGGTGTAAGAGCTATTGTTTTAGATGATGCAGATGAGATTGTAACAGCAAAAATTGCTGATGTAGAAACACAATACATTATGATATTTACAAGTCTTGGTCAATGTATTAGATTTGAACTTGAAAAAACAAGAGATCAAGGAAGAAGTACAAGAGGTGTAAGAGGTATTAAATTTAAAATTGATACAGACTTCGTTGTAGATGCTGATGTTATTAGTAGTGAAGATCAAGAAATATTAACAGTTTCAGAAAAAGGAATTGGAAAACGAACAACAGTTGAAGAGTATA-3′ |
References
- Kiehlbauch, J.A.; Brenner, D.J.; Nicholson, M.A.; Baker, C.N.; Patton, C.M.; Steigerwalt, A.G.; Wachsmuth, I.K. Campylobacter butzleri sp. nov. isolated from humans and animals with diarrheal illness. J. Clin. Microbiol. 1991, 29, 376–385. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Vandamme, P.; Vancanneyt, M.; Pot, B.; Mels, L.; Hoste, B.; Dewettinck, D.; Vlaes, L.; van den Borre, C.; Higgins, R.; Hommez, J.; et al. Polyphasic taxonomic study of the emended genus Arcobacter with Arcobacter butzleri comb. nov. and Arcobacter skirrowii sp. nov., an aerotolerant bacterium isolated from veterinary specimens. Int. J. Syst. Bacteriol. 1992, 42, 344–356. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Pérez-Cataluña, A.; Salas-Massó, N.; Diéguez, A.L.; Balboa, S.; Lema, A.; Romalde, J.L.; Figueras, M.J. Revisiting the Taxonomy of the Genus Arcobacter: Getting Order From the Chaos. Front. Microbiol. 2018, 9, 2077. [Google Scholar] [CrossRef] [PubMed]
- Pérez-Cataluña, A.; Salas-Massó, N.; Diéguez, A.L.; Balboa, S.; Lema, A.; Romalde, J.L.; Figueras, M.J. Corrigendum (2): Revisiting the Taxonomy of the Genus Arcobacter: Getting Order from the Chaos. Front. Microbiol. 2019, 10, 2253. [Google Scholar] [CrossRef] [PubMed]
- Vandamme, P.; Goossens, H. Taxonomy of Campylobacter, Arcobacter, and Helicobacter: A review. Zentralbl. Bakteriol. 1992, 276, 447–472. [Google Scholar] [CrossRef]
- Vandamme, P.; Falsen, E.; Rossau, R.; Hoste, B.; Segers, P.; Tytgat, R.; De Ley, J. Revision of Campylobacter, Helicobacter, and Wolinella taxonomy: Emendation of generic descriptions and proposal of Arcobacter gen. nov. Int. J. Syst. Bacteriol. 1991, 41, 88–103. [Google Scholar] [CrossRef][Green Version]
- Snelling, W.J.; Matsuda, M.; Moore, J.E.; Dooley, J.S. Under the microscope: Arcobacter. Lett. Appl. Microbiol. 2006, 42, 7–14. [Google Scholar] [CrossRef]
- Cervenka, L. Survival and inactivation of Arcobacter spp., a current status and future prospect. Crit. Rev. Microbiol. 2007, 33, 101–108. [Google Scholar] [CrossRef]
- Chieffi, D.; Fanelli, F.; Fusco, V. Arcobacter butzleri: Up-to-date taxonomy, ecology, and pathogenicity of an emerging pathogen. Compr. Rev. Food Sci. Food Saf. 2020, 19, 2071–2109. [Google Scholar] [CrossRef]
- Shange, N.; Gouws, P.; Hoffman, L.C. Campylobacter and Arcobacter species in food-producing animals: Prevalence at primary production and during slaughter. World J. Microbiol. Biotechnol. 2019, 35, 146. [Google Scholar] [CrossRef]
- Lόpez-Vélez, R.; Lebens, M.; Bundy, L.; Barriga, J.; Steffen, R. Bacterial travellers’ diarrhoea: A narrative review of literature published over the past 10 years. Travel Med. Infect. Dis. 2022, 47, 102293. [Google Scholar] [CrossRef]
- Ramees, T.P.; Dhama, K.; Karthik, K.; Rathore, R.S.; Kumar, A.; Saminathan, M.; Tiwari, R.; Malik, Y.S.; Singh, R.K. Arcobacter: An emerging food-borne zoonotic pathogen, its public health concerns and advances in diagnosis and control—A comprehensive review. Vet. Q. 2017, 37, 136–161. [Google Scholar] [CrossRef][Green Version]
- Lau, S.K.; Woo, P.C.; Teng, J.L.; Leung, K.W.; Yuen, K.Y. Identification by 16S ribosomal RNA gene sequencing of Arcobacter butzleri bacteraemia in a patient with acute gangrenous appendicitis. Mol. Pathol. 2002, 55, 182–185. [Google Scholar] [CrossRef][Green Version]
- Minaeva, N.Z.; Minaev, V.I.; Sokolov, A.A.; Avilova, N.D.; Mitrokhin, S.D. Bacteria of the genus Arcobacter, a new etiological factor of nosocomial infections. Antibiot. Khimioter. 2006, 51, 18–22. [Google Scholar]
- Hänel, I.; Tomaso, H.; Neubauer, H. Arcobacter—An underestimated zoonotic pathogen? Bundesgesundheitsblatt Gesundh. Gesundh. 2016, 59, 789–794. [Google Scholar] [CrossRef]
- Ferreira, S.; Queiroz, J.A.; Oleastro, M.; Domingues, F.C. Insights in the pathogenesis and resistance of Arcobacter: A review. Crit. Rev. Microbiol. 2016, 42, 364–383. [Google Scholar]
- Miltenburg, M.G.; Cloutier, M.; Craiovan, E.; Lapen, D.R.; Wilkes, G.; Topp, E.; Khan, I.U.H. Real-time quantitative PCR assay development and application for assessment of agricultural surface water and various fecal matter for prevalence of Aliarcobacter faecis and Aliarcobacter lanthieri. BMC Microbiol. 2020, 20, 164. [Google Scholar] [CrossRef]
- Figueras, M.J.; Levican, A.; Pujol, I.; Ballester, F.; Rabada Quilez, M.J.; Gomez-Bertomeu, F. A severe case of persistent diarrhoea associated with Arcobacter cryaerophilus but attributed to Campylobacter sp. and a review of the clinical incidence of Arcobacter spp. New Microbes New Infect. 2014, 2, 31–37. [Google Scholar] [CrossRef][Green Version]
- Whiteduck-Léveillée, K.; Whiteduck-Léveillée, J.; Cloutier, M.; Tambong, J.T.; Xu, R.; Topp, E.; Arts, M.T.; Chao, J.; Adam, Z.; André Lévesque, C.; et al. Arcobacter lanthieri sp. nov., isolated from pig and dairy cattle manure. Int. J. Syst. Evol. Microbiol. 2015, 65, 2709–2716. [Google Scholar] [CrossRef]
- Chuan, J.; Belov, A.; Cloutier, M.; Li, X.; Khan, I.U.H.; Chen, W. Comparative genomics analysis and virulence-related factors in novel Aliarcobacter faecis and Aliarcobacter lanthieri species identified as potential opportunistic pathogens. BMC Genom. 2022, 23, 471. [Google Scholar] [CrossRef]
- Kerkhof, P.J.; Van den Abeele, A.M.; Strubbe, B.; Vogelaers, D.; Vandamme, P.; Houf, K. Diagnostic approach for detection and identification of emerging enteric pathogens revisited: The (Ali)arcobacter lanthieri case. New Microbes New Infect. 2020, 39, 100829. [Google Scholar] [CrossRef] [PubMed]
- Zambri, M.; Cloutier, M.; Adam, Z.; Lapen, D.R.; Wilkes, G.; Sunohara, M.; Topp, E.; Talbot, G.; Khan, I.U.H. Novel virulence, antibiotic resistance and toxin gene-specific PCR-based assays for rapid pathogenicity assessment of Arcobacter faecis and Arcobacter lanthieri. BMC Microbiol. 2019, 19, 11. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Kim, N.H.; Park, S.M.; Kim, H.W.; Cho, T.J.; Kim, S.H.; Choi, C.; Rhee, M.S. Prevalence of pathogenic Arcobacter species in South Korea: Comparison of two protocols for isolating the bacteria from foods and examination of nine putative virulence genes. Food Microbiol. 2019, 78, 18–24. [Google Scholar] [CrossRef] [PubMed]
- Collado, L.; Figueras, M.J. Taxonomy, epidemiology, and clinical relevance of the genus Arcobacter. Clin. Microbiol. Rev. 2011, 24, 174–192. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Ho, H.T.; Lipman, L.J.; Gaastra, W. Arcobacter, what is known and unknown about a potential foodborne zoonotic agent! Vet. Microbiol. 2006, 115, 1–13. [Google Scholar] [CrossRef]
- Zautner, A.E.; Riedel, T.; Bunk, B.; Spröer, C.; Boahen, K.G.; Akenten, C.W.; Dreyer, A.; Färber, J.; Kaasch, A.J.; Overmann, J.; et al. Molecular characterization of Arcobacter butzleri isolates from poultry in rural Ghana. Front. Cell. Infect. Microbiol. 2023, 13, 1094067. [Google Scholar] [CrossRef]
- Ferreira, S.; Luís, Â.; Oleastro, M.; Pereira, L.; Domingues, F.C. A meta-analytic perspective on Arcobacter spp. antibiotic resistance. J. Glob. Antimicrob. Resist. 2019, 16, 130–139. [Google Scholar] [CrossRef]
- Bell, R.L.; Kase, J.A.; Harrison, L.M.; Balan, K.V.; Babu, U.; Chen, Y.; Macarisin, D.; Kwon, H.J.; Zheng, J.; Stevens, E.L.; et al. The Persistence of Bacterial Pathogens in Surface Water and Its Impact on Global Food Safety. Pathogens 2021, 10, 1391. [Google Scholar] [CrossRef]
- Iwu, C.D.; Ekundayo, T.C.; Okoh, A.I. A Systematic Analysis of Research on Arcobacter: Public Health Implications from a Food-Environment Interphase Perspective. Foods 2021, 10, 1673. [Google Scholar] [CrossRef]
- Meng, J.; Doyle, M.P. Emerging issues in microbiological food safety. Annu. Rev. Nutr. 1997, 17, 255–275. [Google Scholar] [CrossRef]
- Hsu, T.T.; Lee, J. Global Distribution and Prevalence of Arcobacter in Food and Water. Zoonoses Public Health 2015, 62, 579–589. [Google Scholar] [CrossRef]
- Calvo, G.; Arias, M.L.; Fernández, H. Arcobacter: A foodborne emerging pathogen. Arch. Latinoam. Nutr. 2013, 63, 164–172. [Google Scholar]
- Adesiji, Y.O.; Oloke, J.K.; Emikpe, B.O.; Coker, A.O. Arcobacter, an emerging opportunistic food borne pathogen—A review. Afr. J. Med. Med. Sci. 2014, 43, 5–11. [Google Scholar]
- Lehner, A.; Tasara, T.; Stephan, R. Relevant aspects of Arcobacter spp. as potential foodborne pathogen. Int. J. Food Microbiol. 2005, 102, 127–135. [Google Scholar] [CrossRef]
- Levican, A.; Figueras, M.J. Performance of five molecular methods for monitoring Arcobacter spp. BMC Microbiol. 2013, 13, 220. [Google Scholar] [CrossRef][Green Version]
- Abdelbaqi, K.; Buissonnière, A.; Prouzet-Mauleon, V.; Gresser, J.; Wesley, I.; Mégraud, F.; Ménard, A. Development of a real-time fluorescence resonance energy transfer PCR to detect Arcobacter species. J. Clin. Microbiol. 2007, 45, 3015–3021. [Google Scholar] [CrossRef][Green Version]
- Brightwell, G.; Mowat, E.; Clemens, R.; Boerema, J.; Pulford, D.J.; On, S.L. Development of a multiplex and real time PCR assay for the specific detection of Arcobacter butzleri and Arcobacter cryaerophilus. J. Microbiol. Methods 2007, 68, 318–325. [Google Scholar] [CrossRef]
- de Boer, R.F.; Ott, A.; Güren, P.; van Zanten, E.; van Belkum, A.; Kooistra-Smid, A.M. Detection of Campylobacter species and Arcobacter butzleri in stool samples by use of real-time multiplex PCR. J. Clin. Microbiol. 2013, 51, 253–259. [Google Scholar] [CrossRef][Green Version]
- Liu, L.; Cloutier, M.; Craiovan, E.; Edwards, M.; Frey, S.K.; Gottschall, N.; Lapen, D.R.; Sunohara, M.; Topp, E.; Khan, I.U.H. Quantitative real-time PCR-based assessment of tile drainage management influences on bacterial pathogens in tile drainage and groundwater. Sci. Total Environ. 2018, 624, 1586–1597. [Google Scholar] [CrossRef]
- González, A.; Suski, J.; Ferrús, M.A. Rapid and accurate detection of Arcobacter contamination in commercial chicken products and wastewater samples by real-time polymerase chain reaction. Foodborne Pathog. Dis. 2010, 7, 327–338. [Google Scholar] [CrossRef]
- Shrestha, R.G.; Tanaka, Y.; Malla, B.; Tandukar, S.; Bhandari, D.; Inoue, D.; Sei, K.; Sherchand, J.B.; Haramoto, E. Development of a Quantitative PCR Assay for Arcobacter spp. and its Application to Environmental Water Samples. Microbes Environ. 2018, 33, 309–316. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Hausdorf, L.; Neumann, M.; Bergmann, I.; Sobiella, K.; Mundt, K.; Fröhling, A.; Schlüter, O.; Klocke, M. Occurrence and genetic diversity of Arcobacter spp. in a spinach-processing plant and evaluation of two Arcobacter-specific quantitative PCR assays. Syst. Appl. Microbiol. 2013, 36, 235–243. [Google Scholar] [CrossRef] [PubMed]
- Caruso, M.; Latorre, L.; Santagada, G.; Fraccalvieri, R.; Difato, L.M.; Miccolupo, A.; Capozzi, L.; Bonerba, E.; Mottola, A.; Parisi, A. Arcobacter spp. in bovine milk: An emerging pathogen with potential zoonotic risk. Ital. J. Food Saf. 2019, 7, 7685. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Marta, C.; Giovanni, N.; Angela, M.; Loredana, C.; Elisabetta, B.; Laura, D.; Anna, M.; Angela, D.P.; Gianfranco, S.; Antonio, P. Large genetic diversity of Arcobacter butzleri isolated from raw milk in Southern Italy. Food Microbiol. 2020, 89, 103403. [Google Scholar] [CrossRef]
- González, A.; Ferrús, M.A. Study of Arcobacter spp. contamination in fresh lettuces detected by different cultural and molecular methods. Int. J. Food Microbiol. 2011, 145, 311–314. [Google Scholar] [CrossRef]
- Ferreira, S.; Júlio, C.; Queiroz, J.A.; Domingues, F.C.; Oleastro, M. Molecular diagnosis of Arcobacter and Campylobacter in diarrhoeal samples among Portuguese patients. Diagn. Microbiol. Infect. Dis. 2014, 78, 220–225. [Google Scholar] [CrossRef]
- Lee, C.; Agidi, S.; Marion, J.W.; Lee, J. Arcobacter in Lake Erie beach waters: An emerging gastrointestinal pathogen linked with human-associated fecal contamination. Appl. Environ. Microbiol. 2012, 78, 5511–5519. [Google Scholar] [CrossRef][Green Version]
- Hahn, A.; Podbielski, A.; Meyer, T.; Zautner, A.E.; Loderstädt, U.; Schwarz, N.G.; Krüger, A.; Cadar, D.; Frickmann, H. On detection thresholds—A review on diagnostic approaches in the infectious disease laboratory and the interpretation of their results. Acta Trop. 2020, 205, 105377. [Google Scholar] [CrossRef]
- Qu, Y.; Tan, M.; Kutner, M.H. Random effects models in latent class analysis for evaluating accuracy of diagnostic tests. Biometrics 1996, 52, 797–810. [Google Scholar] [CrossRef]
- Eberhardt, K.A.; Sarfo, F.S.; Dompreh, A.; Kuffour, E.O.; Geldmacher, C.; Soltau, M.; Schachscheider, M.; Drexler, J.F.; Eis-Hübinger, A.M.; Häussinger, D.; et al. Helicobacter pylori Coinfection Is Associated With Decreased Markers of Immune Activation in ART-Naive HIV-Positive and in HIV-Negative Individuals in Ghana. Clin. Infect. Dis. 2015, 61, 1615–1623. [Google Scholar] [CrossRef][Green Version]
- Sarfo, F.S.; Eberhardt, K.A.; Dompreh, A.; Kuffour, E.O.; Soltau, M.; Schachscheider, M.; Drexler, J.F.; Eis-Hübinger, A.M.; Häussinger, D.; Oteng-Seifah, E.E.; et al. Helicobacter pylori Infection Is Associated with Higher CD4 T Cell Counts and Lower HIV-1 Viral Loads in ART-Naïve HIV-Positive Patients in Ghana. PLoS ONE 2015, 10, e0143388. [Google Scholar] [CrossRef][Green Version]
- Bossuyt, P.M.; Reitsma, J.B.; Bruns, D.E.; Gatsonis, C.A.; Glasziou, P.P.; Irwig, L.; Lijmer, J.G.; Moher, D.; Rennie, D.; de Vet, H.C.; et al. STARD 2015: An updated list of essential items for reporting diagnostic accuracy studies. BMJ 2015, 351, h5527. [Google Scholar] [CrossRef][Green Version]
- Niesters, H.G. Quantitation of viral load using real-time amplification techniques. Methods 2001, 25, 419–429. [Google Scholar] [CrossRef]
- Goodman, L.A. Latent class analysis: The empirical study of latent types, latent variables, and latent structures. In Applied Latent Class Analysis; Hagenaars, J.A., McCutcheon, A.L., Eds.; Cambridge University Press: Cambridge, UK, 2002; pp. 3–55. [Google Scholar]
- Landis, J.R.; Koch, G.G. The measurement of observer agreement for categorical data. Biometrics 1977, 33, 159–174. [Google Scholar] [CrossRef][Green Version]
- Dekker, D.; Eibach, D.; Boahen, K.G.; Akenten, C.W.; Pfeifer, Y.; Zautner, A.E.; Mertens, E.; Krumkamp, R.; Jaeger, A.; Flieger, A.; et al. Fluoroquinolone-Resistant Salmonella enterica, Campylobacter spp., and Arcobacter butzleri from Local and Imported Poultry Meat in Kumasi, Ghana. Foodborne Pathog. Dis. 2019, 16, 352–358. [Google Scholar] [CrossRef][Green Version]
- Krumkamp, R.; Sarpong, N.; Schwarz, N.G.; Adlkofer, J.; Loag, W.; Eibach, D.; Hagen, R.M.; Adu-Sarkodie, Y.; Tannich, E.; May, J. Gastrointestinal infections and diarrheal disease in Ghanaian infants and children: An outpatient case-control study. PLoS Negl. Trop. Dis. 2015, 9, e0003568. [Google Scholar]
- Eibach, D.; Krumkamp, R.; Hahn, A.; Sarpong, N.; Adu-Sarkodie, Y.; Leva, A.; Käsmaier, J.; Panning, M.; May, J.; Tannich, E. Application of a multiplex PCR assay for the detection of gastrointestinal pathogens in a rural African setting. BMC Infect. Dis. 2016, 16, 150. [Google Scholar] [CrossRef][Green Version]
rReal-Time PCR Target | gyrA | rpoB/C | hsp60 |
---|---|---|---|
Number and percentage of positive signals with samples spiked with A. butzleri, n/n (%) | 30/30 (100%) | 30/30 (100%) | 30/30 (100%) |
Ct values measured with samples spiked with A. butzleri, mean (±SD) | 22.2 (±4.6) | 16.4 (±3.8) | 16.6 (±3.4) |
Melting temperature in °C (±SD) with A. butzleri | 65.7 (±<0.1) | n.a. | n.a. |
Number and percentage of positive signals with samples spiked with A. cryaerophilus, n/n (%) | 0/22 (0%) ° | 16/22 (72.7%) | 6/22 (27.3%) |
Ct values measured with samples spiked with A. cryaerophilus, mean (±SD) | n.a. | 20.9 (±2.7) | 31.5 (±0.6) |
Melting temperature in °C (±SD) with A. cryaerophilus | 60.5 (±0.3) | n.a. | n.a. |
Number and percentage of positive signals with samples spiked with A. lanthieri, n/n (%) | 0/12 (0%) | 0/12 (0%) | 0/12 (0%) |
Ct values measured with samples spiked with A. lanthieri, mean (±SD) | n.a. | n.a. | n.a. |
Melting temperature in °C (±SD) with A. lanthieri | n.a. | n.a. | n.a. |
Significance level P for differences of the measured Ct values of A. butzleri and A. cryaerophilus * | n.e. | 0.0003 | <0.0001 |
Assay | Total Number (n) of Included Samples | Positives (%) | Sensitivity (0.95 CI) | Specificity (0.95 CI) | Kappa (0.95 CI) |
---|---|---|---|---|---|
gyrA | 1495 | 30 (1.91) | 0.1267 (0.0876, 0.1797) | 0.9984 (0.9936, 0.9996) | 0.436 (0.403, 0.472) |
rpoB/C | 1495 | 244 (16.32) | 1 (0, 1) | 0.9818 (0.9499, 0.9935) | |
hsp60 | 1495 | 245 (16.39) | 0.9298 (0.7513, 0.9831) | 0.9688 (0.9576, 0.9771) | |
Prevalence (0.95 CI) | 0.1477 (0.1258, 0.1726) |
gyrA | rpoB/C | hsp60 | |||||
---|---|---|---|---|---|---|---|
Negative | Positive | Negative | Positive | Negative | Positive | ||
gyrA | Negative | 1465 | |||||
Positive | 0 | 30 | |||||
rpoB/C | Negative | 1249 | 2 | 1251 | |||
Positive | 216 | 28 | 0 | 244 | |||
hsp60 | Negative | 1246 | 4 | 1212 | 38 | 1250 | |
Positive | 219 | 26 | 39 | 206 | 0 | 245 |
n | Mean (SD) | Median (q25, q75) | |
---|---|---|---|
gyrA | 30 | 39.83 (2.41) | 40.5 (39, 41) |
rpoB/C | 244 | 33.55 (1.77) | 34 (33, 35) |
hsp60 | 245 | 31.86 (1.58) | 32 (31, 33) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Binder, R.; Hahn, A.; Eberhardt, K.A.; Hagen, R.M.; Rohde, H.; Loderstädt, U.; Feldt, T.; Sarfo, F.S.; Di Cristanziano, V.; Kahlfuss, S.; et al. Comparison of the Diagnostic Accuracy of Three Real-Time PCR Assays for the Detection of Arcobacter butzleri in Human Stool Samples Targeting Different Genes in a Test Comparison without a Reference Standard. Microorganisms 2023, 11, 1313. https://doi.org/10.3390/microorganisms11051313
Binder R, Hahn A, Eberhardt KA, Hagen RM, Rohde H, Loderstädt U, Feldt T, Sarfo FS, Di Cristanziano V, Kahlfuss S, et al. Comparison of the Diagnostic Accuracy of Three Real-Time PCR Assays for the Detection of Arcobacter butzleri in Human Stool Samples Targeting Different Genes in a Test Comparison without a Reference Standard. Microorganisms. 2023; 11(5):1313. https://doi.org/10.3390/microorganisms11051313
Chicago/Turabian StyleBinder, Ramona, Andreas Hahn, Kirsten Alexandra Eberhardt, Ralf Matthias Hagen, Holger Rohde, Ulrike Loderstädt, Torsten Feldt, Fred Stephen Sarfo, Veronica Di Cristanziano, Sascha Kahlfuss, and et al. 2023. "Comparison of the Diagnostic Accuracy of Three Real-Time PCR Assays for the Detection of Arcobacter butzleri in Human Stool Samples Targeting Different Genes in a Test Comparison without a Reference Standard" Microorganisms 11, no. 5: 1313. https://doi.org/10.3390/microorganisms11051313
APA StyleBinder, R., Hahn, A., Eberhardt, K. A., Hagen, R. M., Rohde, H., Loderstädt, U., Feldt, T., Sarfo, F. S., Di Cristanziano, V., Kahlfuss, S., Frickmann, H., & Zautner, A. E. (2023). Comparison of the Diagnostic Accuracy of Three Real-Time PCR Assays for the Detection of Arcobacter butzleri in Human Stool Samples Targeting Different Genes in a Test Comparison without a Reference Standard. Microorganisms, 11(5), 1313. https://doi.org/10.3390/microorganisms11051313