Abstract
Trichomonas vaginalis causes trichomoniasis, the most recurrent sexually transmitted infection (STI) worldwide. Genital mycoplasmas, not considered STI agents, are frequently isolated from the female genital tract. A symbiosis between Mycoplasma species and T. vaginalis has been described. The aim of this study was to conduct molecular-based analyses of vaginal specimens, thus assessing the prevalence of non-STI Mycoplasma infections. In total, 582 samples from female patients and an additional 20 T. vaginalis isolates were analyzed by PCR using Mycoplasma specific 16S rRNA primers, and the obtained PCR products were sequenced. Mycoplasma species were detected in 28.2% of the collected vaginal samples. Mycoplasma hominis was found in 21.5% of the specimens, Ureaplasma species were found in 7.5% of the samples. The molecular data of the newly described species, Candidatus Mycoplasma girerdii, were obtained for the first time in Austria, in a sample also positive for T. vaginalis. Analyses of the cultivated T. vaginalis strains confirmed the presence of M. hominis in two out of 20 samples. A comparably high prevalence of genital mycoplasmas was revealed through advanced diagnostic assays, with M. hominis and U. parvum being the most prevalent species. The previously described symbiotic relationship between M. hominis and T. vaginalis was confirmed.
1. Introduction
Mycoplasma hominis, Ureaplasma urealyticum, and Ureaplasma parvum are often isolated from the human genital tract, and their presence correlates with age, sexual activity, pregnancy, and hormones; however, all three species are not considered classical sexually transmitted infectious agents [1,2]. M. hominis is a frequent isolate from the lower genital tract of women and is thought to play a minor role in urogenital tract disease; however, it can be associated with pelvic inflammatory disease (PID), bacteremia, and bacterial vaginosis (BV) [1].
BV, previously known as ‘Gardnerella vaginitis’, is a condition characterized by depletion of the normal Lactobacillus population. As a result, it is accompanied by an overgrowth of vaginal anaerobes and the loss of vaginal acidity [3]. Overall, half of the registered cases of BV are either asymptomatic, or women exhibit only mild symptoms. The concentration of certain bacteria including Prevotella spp. (Bacteroides), Gardnerella vaginalis, M. hominis, and Mobiluncus spp. is significant [3,4]. M. hominis and antibodies against the bacterium are detectable in the vagina of approximately 60% of women diagnosed with BV. The mechanism as to how M. hominis contributes to BV pathology is yet to be understood [3].
Ureaplasma spp. are the most frequent genital tract colonizers in females. Unlike U. parvum, U. urealyticum is identified predominantly in women experiencing reproductive morbidities. Currently, there is conflicting evidence regarding the pathogenic profile and medical relevance of these two species [5].
Recent studies on the vaginal microbiome identified a new Mycoplasma species, formerly known as Mnola [6] and renamed Candidatus Mycoplasma girerdii, which shows a strong and unique association with Trichomonas vaginalis [7] and has been proven recently to be an intracellular symbiont of T. vaginalis [8]. The bacterium is not cultivable in Mycoplasma-specific medium and has a small genome, lacking the genes essential for mycoplasma energy metabolism [7].
T. vaginalis is a human-specific sexually transmitted protozoan known as the causative agent of trichomoniasis. It causes over 220 million cases each year and is considered the most prevalent nonviral sexually transmitted infection worldwide [9]. The symbiotic relationship between M. hominis and T. vaginalis has been documented [10,11]. The bacterium can adhere to or enter into and proliferate inside trichomonad cells, aided by their shared property of metabolizing arginine [8,10,11]. This study investigated the prevalence of non-STI genital mycoplasmas and T. vaginalis infections in women attending the Outpatients Centre for the Diagnosis of Venero-Dermatological Diseases (OCD) in Vienna.
2. Materials and Methods
2.1. Study Design and Sample Collection
Vaginal swab specimens from 582 female patients attending the OCD were collected between April and September 2021 and analyzed. Vaginal swabs were obtained during routine pelvic examinations, and no repeated samples were taken. The vaginal swab material was transferred into 2 mL tubes containing phosphate-buffered saline (PBS) and was brought to the Institute for Specific Prophylaxis and Tropical Medicine (ISPTM) for DNA isolation. The QIAamp® DNA Mini Kit 250 (QIAGEN, Hilden, Germany) was used for the extraction of the DNA from the clinical samples, and the DNA was stored at −20° until further use. The Mycoplasma 16S rRNA gene fragment (717 bp) was amplified with conventional PCR using the GPO-1 (ACTCCTACGGGAGGCAGCAGTA) and MGSO (TGCACCATCTGTCACTCTGTTAACCTC) primers [12]. The PCR products were analyzed on 2% agarose gel using GelRedTM Nucleic Acid Gel Stain (Biotium, Hayward, CA, USA). The gene fragments were purified after visualization, using the IllustraTM GFXTM PCR DNA and Gel Purification Kit (GE Healthcare, Hatfield, UK). The purified DNA products were sequenced bidirectionally with the same set of primers, performed with the Applied Biosystems SeqStudio Genetic Analyzer (Thermo Fischer Scientific, Waltham, MA, USA). The consensus sequences were generated with the Prabi (https://doua.prabi.fr/software/cap3; accessed on 3 February 2022) Software, and were compared to the available sequences of genital mycoplasmas in GenBank using the basic local alignment search tool BLAST search (https://blast.ncbi.nlm.nih.gov/Blast.cgi; accessed on 18 January 2022).
2.2. Trichomonas vaginalis Samples from Pure Cultures
Twenty cultured T. vaginalis samples previously collected from male and female patients attending the OCD were investigated for the presence of symbiotic Mycoplasma species. The vaginal and urethral swabs were smeared onto T. vaginalis specific agar plates [13]. After microscopic observation for the presence of T. vaginalis at the OCD, positive samples were transferred to the ISPTM. Subsequently, the samples were suspended into liquid TYM Medium (Trypticase-Peptone Medium) and cultured microaerobically at 37 °C. The QIAamp® DNA Mini Kit 250 (QIAGEN, Hilden, Germany) was used to isolate DNA from the pure T. vaginalis cultures. To detect the intracellular/membrane-associated genital mycoplasmas, the MGSO/GPO-1 primers were used, and the PCR products were visualized and subsequently sequenced as described.
3. Results
3.1. Data Collection and the Characteristics of the Vaginal Swab Specimens
The women screened were aged 18–93 years (mean age 35.5), and the women positive for genital mycoplasmas were aged 22–63 years (mean age 32.9). For every sample, two swab specimens were collected from each patient, one of which was smeared on an agar plate for the detection of T. vaginalis, and the second was subjected to molecular analysis.
The vast majority of the patients attending the Clinic reported genital tract infection symptoms, discharge, or pain. Routine diagnostics revealed Candida spp., Ureaplasma spp., Chlamydia trachomatis, Neisseria gonorrhea, Gardnerella vaginalis, and Prevotella spp. The Amine Test was also performed for each specimen and if positive, together with an elevated vaginal pH as well as the presence of clue cells in the microscopic examination, this would be suggestive of BV, based on the Amsel criteria [14]. In total, 26 samples out of 582 patients fit the criteria of a BV diagnosis, yielding a positive rate of 4.4% (Table 1).
Table 1.
The characteristics of positive cases from patients diagnosed with BV.
3.2. The Prevalence of Mycoplasma spp. in the Swab Specimens
Overall, non-STI genital mycoplasmas were detected in 28.2% (164/582) of the samples. The most prevalent species was M. hominis 125/582 (21.5%) followed by Ureaplasmas: U. parvum 22/582 (3.8%) and U. urealyticum 16/582 (2.7%). No M. penetrans or M. fermentans were detected. T. vaginalis was detected in five specimens. In 4/5 (80%) of the specimens positive for T. vaginalis, M. hominis was also detected in the same patient. Lastly, Ca. M. girerdii was detected in 1/5 (20%) of the vaginal swabs positive for T. vaginalis (Table 2).
Table 2.
The characteristics of Mycoplasma/Ureaplasma spp. and T. vaginalis positive cases in women.
Representative examples of the obtained Mycoplasma spp./Ureaplasma spp. sequences were submitted to GenBank and are available under the following accession numbers: M. hominis (OP684355-OP684359), U. parvum (OP684677-OP684679), U. urealyticum (OP684935), and Ca. Mycoplasma girerdii (OP402867).
3.3. The Detection of Intracellular/Membrane-Associated Mycoplasma spp. in T. vaginalis Pure Culture
In total, 20 T. vaginalis isolates (eight from men and twelve from women), that had been passaged in TYM for three times, were analyzed by PCR for the detection of Mollicutes. Two samples 2/20 (10%), closely associated with M. hominis, were confirmed after successful amplification with the species-specific primers. Ca. M. girerdii and Ureaplasma spp. were not detected.
4. Discussion
Among the 582 swab specimens investigated, roughly 28% were positive for non-STI mollicutes by PCR. M. hominis infections (21.5%) were significantly more prevalent than infections with Ureaplasma species taken together: 7.5%. The women positive for M. hominis infection (mean age 32.9) were mostly of reproductive age. An earlier study [15] confirmed a correlation between sexual activity and colonization with genital mycoplasmas. Although the mean age is not an indicator of the hormonal state, an association between the latter and the isolation of genital mycoplasmas in the female genitourinary tract has also been described [16]. In that study, the occurrence of U. urealyticum was low among women who were sexually inactive. The highest incidence of genital mycoplasmas was observed in pregnant women, followed by sexually active nonpregnant women [16]. Several studies on female patients in Asia have reported a higher prevalence of ureaplasmas than of M. hominis, with 30.8% and 1.2%, respectively [17]. Although the findings in the current study do not fully align with the data from other studies related to the prevalence, a similar distribution of infections has been reported [18], indicating a lower prevalence of U. urealyticum compared to U. parvum. These previous reports further corroborate the known discrepancy in the prevalence of non-STI mycoplasmas in women and the difference in the methodological approaches implemented [13,19]. Furthermore, there is a lack of case-control studies, as a means to correlate genital Mycoplasma spp. infection with disease development [19]. It is noteworthy that in this retrospective study the expected overall prevalence of genital mycoplasmas would be seemingly higher for M. hominis and Ureaplasma spp. due to the higher susceptibility to infection in women [5].
The infection rate of female patients diagnosed with Bacterial Vaginosis (BV) was 4.4%. In all patients, elevated levels of Prevotella spp. and G. vaginalis were detected, whereas M. hominis was detected in 23% of the total confirmed cases of BV. A study in the USA conducted over the span of four years revealed the prevalence of BV in women under the age of 50 years old to be 29.2% [20]. Although M. hominis alone is not able to instigate BV, its presence correlates with a depletion of Lactobacillus species [21,22]. In a study from Northern Ireland, high M. hominis and G. vaginalis coinfection rates were detected, whereas the same was not observed for M. genitalium or Ureaplasma spp [23]. The current study provides data on the correlation of BV prevalence as well as the bacteria indicative of the condition and emphasizes the need for additional diagnostics to explain the underlying risk factors.
In a 2018 statement from the European (STI) Guidelines Editorial Board, a routine-based testing of asymptomatic and symptomatic patients for U. parvum, U. urealyticum, and M. hominis was not recommended [19]. M. hominis and other genital Mollicutes are usually seen as commensals of the genitourinary tract and are detected in symptomatic as well as in asymptomatic patients. Their occurrence does not always result in discomfort or typical STI symptoms and thus they are not considered (solely) to be responsible for disease [1,5]. On the other hand, in a retrospective study conducted at the OCD [24], M. hominis was the only causative agent detected in male and female patients, some of whom reported symptoms of urogenital infections. This led to the assumption that the bacterium was exclusively a responsible causative agent. The introduction of multiplex PCR assays has facilitated the detection of STI agents also allowing for Ureaplasma spp. and M. hominis identification. In contrast to the current study, in routine diagnostics, genital mycoplasmal infections are mainly diagnosed by culture or culture rapid kits [13,19]. The latter have unsatisfactory specificity and sensitivity, which can lead to a clinically inaccurate interpretation of the etiological status of U. urealyticum and U. parvum. Here, we suggest that if an infection with genital mycoplasmas is suspected, laboratory diagnostics should be performed in the best manner possible. Moreover, the early data and ongoing research on genital mycoplasmas as important contributors to reproductive difficulties should not be overlooked.
The DNA of Ca. Mycoplasma girerdii was detected and amplified from a patient also positive for T. vaginalis. To our knowledge, our sequence represents the first molecular data on this bacterium in Austria to date. An interdependent relationship between Ca. M. girerdii and T. vaginalis was confirmed by Fettweis et al., and the adherent presence of Ca. M. girerdii at the time was not proven [7]. In the current study, coinfections with Mycoplasma species for all three samples positive for T. vaginalis were confirmed; however, the differentiation between the intracellular and adherent nature of the presence of M. hominis and Ca. M. girerdii was not investigated. In accordance with this assertion [6,25], that study also reported that the unculturable bacteria could be detected in association with T. vaginalis but not in pure protozoan cultures. Very recently, Margarita et al. confirmed the endosymbiotic nature of Ca. M. girerdii and its ability to multiply within trichomonad cells [8].
With respect to the assessment of the symbiotic relationship between Mycoplasma spp. and T. vaginalis, the presence of M. hominis was confirmed in all four vaginal swabs positive for T. vaginalis, as well as in 10% of cultured T. vaginalis. In Italy, a strong association between these two microorganisms was found in 78.6% of all T. vaginalis-positive samples [26]. A study from the Netherlands detected M. hominis in 79% of the T. vaginalis-confirmed isolates [27], whereas in the USA a lower prevalence of M. hominis in T. vaginalis (20%) was reported [28]. The two microorganisms can separately establish long-term infections in the genitourinary tract [29]; however, it has been corroborated that the pathogenicity of both is greatly affected by their symbiotic relationship [30]. Xiao et al. suggested that M. hominis symbiosis with T. vaginalis may confer better resistance against metronidazole in vitro [31]. Fürnkranz et al. found that T. vaginalis strains infected with M. hominis in vitro exhibited a twofold increase in the minimal inhibitory concentration (MIC) to metronidazole with concomitant alterations in the expression levels of the genes correlated with metronidazole resistance [32]. Hence, it may be inferred that M. hominis may influence the drug susceptibility of T. vaginalis. However, the sensitivity to metronidazole was not assessed in the present study. Many clinical and in vitro studies have confirmed the establishment of long-term infections with these two microorganisms separately, and the pathogenicity and resistance against metronidazole of the protozoan is greatly affected by their symbiotic relationship [10,31,32]. In conclusion, our findings provide an insight into the prevalence of genital mycoplasmal infections among female patients in Vienna, Austria, as well as an assessment of the endosymbiotic relationship between Mycoplasma spp. and T. vaginalis. The reported findings of Ca. M. girerdii are still very recent, and the knowledge regarding its pathogenic potential is limited. This study underlines the importance of implementing advanced molecular diagnostic techniques, thus enabling a better screening of patients and further elucidating the role of Mycoplasma spp., Ureaplasma spp., and T. vaginalis in sexually transmitted diseases.
Author Contributions
Conceptualization, U.F.; methodology, I.H., U.F. and I.L.-M.; validation, I.H. and U.F.; formal analysis, I.H.; investigation, I.H.; resources, J.W., A.S. and U.F.; writing—original draft preparation, I.H.; writing—review and editing, I.H., I.L.-M., A.S., J.W. and U.F.; visualization, I.H.; supervision, U.F.; project administration, U.F.; funding acquisition, U.F. All authors have read and agreed to the published version of the manuscript.
Funding
This research was funded by the Austrian Science Fund (FWF), project number: KLI 751-B.
Data Availability Statement
Not applicable.
Conflicts of Interest
The authors declare no conflict of interest.
References
- Taylor-Robinson, D.; McCormack, W.M. The Genital Mycoplasmas. N. Engl. J. Med. 1980, 302, 1003–1010. [Google Scholar] [CrossRef] [PubMed]
- Larsen, B.; Hwang, J. Mycoplasma, Ureaplasma, and adverse pregnancy outcomes: A fresh look. Infect. Dis. Obstet. Gynecol. 2010, 2010, 521921. [Google Scholar] [CrossRef]
- Hay, P. Bacterial vaginosis. Medicine 2005, 33, 58–61. [Google Scholar] [CrossRef]
- Waites, K.B.; Katz, B.; Schelonka, R.L. Mycoplasmas and Ureaplasmas as Neonatal Pathogens. Clin. Microbiol. Rev. 2005, 18, 757–789. [Google Scholar] [CrossRef]
- Taylor-Robinson, D. Mollicutes in vaginal microbiology: Mycoplasma hominis, Ureaplasma urealyticum, Ureaplasma parvum and Mycoplasma genitalium. Res. Microbiol. 2017, 168, 875–881. [Google Scholar] [CrossRef]
- Martin, D.H.; Zozaya, M.; Lillis, R.A.; Myers, L.; Nsuami, M.J.; Ferris, M.J. Unique vaginal microbiota that includes an unknown Mycoplasma-like organism is associated with Trichomonas vaginalis infection. J. Infect. Dis. 2013, 207, 1922–1931. [Google Scholar] [CrossRef] [PubMed]
- Fettweis, J.M.; Serrano, M.G.; Huang, B.; Brooks, J.P.; Glascock, A.L.; Sheth, N.U.; Consortium, V.M.; Strauss, J.F.; Jefferson, K.K.; Buck, G.A. An Emerging Mycoplasma Associated with Trichomoniasis, Vaginal Infection and Disease. PLoS ONE 2014, 9, e110943. [Google Scholar] [CrossRef]
- Margarita, V.; Bailey, N.P.; Rappelli, P.; Diaz, N.; Dessì, D.; Fettweis, J.M.; Hirt, R.P.; Fiori, P.L. Two Different Species of Mycoplasma Endosymbionts Can Influence Trichomonas vaginalis Pathophysiology. mBio 2022, 13, e0091822. [Google Scholar] [CrossRef] [PubMed]
- World Health Organization. Global Incidence and Prevalence of Selected Curable Sexually Transmitted Infections: 2008. Reprod. Health Matters 2012, 20, 207–208. [Google Scholar] [CrossRef]
- Dessi, D.; Rappelli, P.; Diaz, N.; Cappuccinelli, P.; Fiori, P.L. Mycoplasma hominis and Trichomonas vaginalis: A unique case of symbiotic relationship between two obligate human parasites. Front. Biosci. 2006, 11 (Suppl. 1), 2028–2034. [Google Scholar] [CrossRef]
- Fichorova, R.; Fraga, J.; Rappelli, P.; Fiori, P.L. Trichomonas Vaginalis Infection in Symbiosis with Trichomonas virus and Mycoplasma. Res. Microbiol. 2017, 168, 882–891. [Google Scholar] [CrossRef]
- van Kuppeveld, F.J.; van der Logt, J.T.; Angulo, A.F.; van Zoest, M.J.; Quint, W.G.; Niesters, H.G.; Galama, J.M.; Melchers, W.J. Genus- and Species-Specific Identification of Mycoplasmas by 16S rRNA Amplification. Appl. Environ. Microbiol. 1992, 58, 2606–2615. [Google Scholar] [CrossRef]
- Stary, A.; Kuchinka-Koch, A.; Teodorowicz, L. Detection of Trichomonas Vaginalis on Modified Columbia Agar in the Routine Laboratory. J. Clin. Microbiol. 2002, 40, 3277–3280. [Google Scholar] [CrossRef] [PubMed]
- Amsel, R.; Totten, P.A.; Spiegel, C.A.; Chen, K.C.S.; Eschenbach, D.; Holmes, K.K. Nonspecific vaginitis: Diagnostic criteria and microbial and epidemiologic associations. Am. J. Med. 1983, 74, 14–22. [Google Scholar] [CrossRef] [PubMed]
- McCormack, W.M.; Almeida, P.C.; Bailey, P.E.; Grady, E.M.; Lee, Y.H. Sexual Activity and Vaginal Colonization with Genital Mycoplasmas. JAMA 1972, 221, 1375–1377. [Google Scholar] [CrossRef]
- Iwasaka, T.; Wada, T.; Kidera, Y.; Sugimori, H. Hormonal status and mycoplasma colonization in the female genital tract. Obstet. Gynecol. 1986, 68, 263–266. [Google Scholar]
- Lee, J.Y.; Yang, J.S. Prevalence and Antimicrobial Susceptibility of Mycoplasma hominis and Ureaplasma Species in Nonpregnant Female Patients in South Korea Indicate an Increasing Trend of Pristinamycin-Resistant Isolates. Antimicrob. Agents Chemother. 2020, 64, e01065-20. [Google Scholar] [CrossRef] [PubMed]
- Gupta, V.; Dhawan, B.; Khanna, N.; Agarwal, N.; Bhattacharya, S.N.; Sreenivas, V.; Chaudhry, R. Detection and biovar discrimination of Ureaplasma urealyticum in Indian patients with genital tract infections. Diagn. Microbiol. Infect. Dis. 2008, 60, 95–97. [Google Scholar] [CrossRef]
- Horner, P.; Donders, G.; Cusini, M.; Gomberg, M.; Jensen, J.; Unemo, M. Should We Be Testing for Urogenital Mycoplasma Hominis, Ureaplasma Parvum and Ureaplasma Urealyticum in Men and Women? —A Position Statement from the European Sti Guidelines Editorial Board. J. Eur. Acad. Dermatol. Venereol. 2018, 32, 1845–1851. [Google Scholar] [CrossRef] [PubMed]
- Koumans, E.H.; Sternberg, M.; Bruce, C.; McQuillan, G.; Kendrick, J.; Sutton, M.; Markowitz, L.E. The prevalence of bacterial vaginosis in the United States, 2001-2004; associations with symptoms, sexual behaviors, and reproductive health. Sex. Transm. Dis. 2007, 34, 864–869. [Google Scholar] [CrossRef] [PubMed]
- Nilsson, U.; Hellberg, D.; Shoubnikova, M.; Nilsson, S.; Mårdh, P.A. Sexual behavior risk factors associated with bacterial vaginosis and Chlamydia trachomatis infection. Sex. Transm. Dis. 1997, 24, 241–246. [Google Scholar] [CrossRef]
- Margolis, E.; Fredricks, D.N. Bacterial Vaginosis-Associated Bacteria. Mol. Med. Microbiol. (Second Ed.) 2015, 3, 1487–1496. [Google Scholar] [CrossRef]
- Cox, C.; Watt, A.P.; McKenna, J.P.; Coyle, P.V. Mycoplasma hominis and Gardnerella vaginalis display a significant synergistic relationship in bacterial vaginosis. Eur. J. Clin. Microbiol. Infect. Dis. 2016, 35, 481–487. [Google Scholar] [CrossRef] [PubMed]
- Lesiak-Markowicz, I.; Walochnik, J.; Stary, A.; Fürnkranz, U. Characterisation of Trichomonas vaginalis Isolates Collected from Patients in Vienna between 2019 and 2021. Int. J. Mol. Sci. 2022, 23, 12422. [Google Scholar] [CrossRef]
- Allen-Daniels, M.J.; Serrano, M.G.; Pflugner, L.P.; Fettweis, J.M.; Prestosa, M.A.; Koparde, V.N.; Brooks, J.P.; Strauss, J.F.; Romero, R.; Chaiworapongsa, T.; et al. Identification of a gene in Mycoplasma hominis associated with preterm birth and microbial burden in intra-amniotic infection. Am. J. Obstet. Gynecol. 2015, 212, 779.e1–779.e13. [Google Scholar] [CrossRef]
- Diaz, N.; Dessì, D.; Dessole, S.; Fiori, P.L.; Rappelli, P. Rapid detection of coinfections by Trichomonas vaginalis, Mycoplasma hominis, and Ureaplasma urealyticum by a new multiplex polymerase chain reaction. Diagn. Microbiol. Infect. Dis. 2010, 67, 30–36. [Google Scholar] [CrossRef] [PubMed]
- van Belkum, A.; van der Schee, C.; van der Meijden, W.I.; Verbrugh, H.A.; Sluiters, H.J.F. A clinical study on the association of Trichomonas vaginalis and Mycoplasma hominis infections in women attending a sexually transmitted disease (STD) outpatient clinic. FEMS Immunol. Med. Microbiol. 2001, 32, 27–32. [Google Scholar] [CrossRef]
- Butler, S.E.; Augostini, P.; Secor, W.E. Mycoplasma hominis infection of Trichomonas vaginalis is not associated with metronidazole-resistant trichomoniasis in clinical isolates from the United States. Parasitol. Res. 2010, 107, 1023–1027. [Google Scholar] [CrossRef]
- Taylor-Robinson, D.; Rappelli, P.; Addis, M.F.; Carta, F.; Fiori, P.L. Mycoplasma hominis parasitism of Trichomonas vaginalis. Lancet 1998, 352, 2022–2023. [Google Scholar] [CrossRef]
- Dessì, D.; Margarita, V.; Cocco, A.R.; Marongiu, A.; Fiori, P.L.; Rappelli, P. Trichomonas vaginalis and Mycoplasma hominis: New tales of two old friends. Parasitology 2019, 146, 1150–1155. [Google Scholar] [CrossRef]
- Xiao, J.C.; Xie, L.F.; Fang, S.L.; Gao, M.Y.; Zhu, Y.; Song, L.Y.; Zhong, H.M.; Lun, Z.R. Symbiosis of Mycoplasma hominis in Trichomonas vaginalis may link metronidazole resistance in vitro. Parasitol. Res. 2006, 100, 123–130. [Google Scholar] [CrossRef] [PubMed]
- Fürnkranz, U.; Henrich, B.; Walochnik, J. Mycoplasma hominis impacts gene expression in Trichomonas vaginalis. Parasitol. Res. 2018, 117, 841–847. [Google Scholar] [CrossRef] [PubMed]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).