Identification of Vietnamese Flea Species and Their Associated Microorganisms Using Morphological, Molecular, and Protein Profiling
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Sites, Flea Collection and Morphological Identification
2.2. Flea Dissection and Specimen Preparation
2.3. DNA Extraction and Validation of Morphological Identification Using Molecular Analysis
2.4. MALDI-TOF MS Analysis
2.5. MALDI-TOF MS Parameters
2.6. Spectral Analysis
2.7. Reference Database Creation and Blind Test
2.8. PCR Detection of Microorganisms in Fleas
3. Results
3.1. Flea Collection and Morphological Identification
3.2. Molecular Identification
3.3. MS Spectra Analysis
3.4. MALDI-TOF MS Flea Identification
3.5. Detection of Microorganisms in Fleas
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Barbieri, R.; Signoli, M.; Chevé, D.; Costedoat, C.; Tzortzis, S.; Aboudharam, G.; Raoult, D.; Drancourt, M. Yersinia Pestis: The Natural History of Plague. Clin. Microbiol. Rev. 2020, 34, e00044-19. [Google Scholar] [CrossRef] [PubMed]
- Bitam, I.; Dittmar, K.; Parola, P.; Whiting, M.F.; Raoult, D. Fleas and Flea-Borne Diseases. Int. J. Infect. Dis. 2010, 14, e667–e676. [Google Scholar] [CrossRef] [PubMed]
- Hamzaoui, B.E.; Zurita, A.; Cutillas, C.; Parola, P. Fleas and Flea-Borne Diseases of North Africa. Acta Trop. 2020, 211, 105627. [Google Scholar] [CrossRef] [PubMed]
- Cavanaugh, D.C.; Dangerfield, H.G.; Hunter, D.H.; Joy, R.J.; Marshall, J.D.; Quy, D.V.; Vivona, S.; Winter, P.E. Some Observations on the Current Plague Outbreak in the Republic of Vietnam. Am. J. Public Health Nations Health 1968, 58, 742–752. [Google Scholar] [CrossRef]
- Pham, H.V.; Dang, D.T.; Tran Minh, N.N.; Nguyen, N.D.; Nguyen, T.V. Correlates of Environmental Factors and Human Plague: An Ecological Study in Vietnam. Int. J. Epidemiol. 2009, 38, 1634–1641. [Google Scholar] [CrossRef]
- El Hamzaoui, B.; Laroche, M.; Almeras, L.; Bérenger, J.-M.; Raoult, D.; Parola, P. Detection of Bartonella spp. in Fleas by MALDI-TOF MS. PLoS Negl. Trop. Dis. 2018, 12, e0006189. [Google Scholar] [CrossRef]
- Nguyen, V.-L.; Colella, V.; Greco, G.; Fang, F.; Nurcahyo, W.; Hadi, U.K.; Venturina, V.; Tong, K.B.Y.; Tsai, Y.-L.; Taweethavonsawat, P.; et al. Molecular Detection of Pathogens in Ticks and Fleas Collected from Companion Dogs and Cats in East and Southeast Asia. Parasit Vectors 2020, 13, 420. [Google Scholar] [CrossRef]
- Álvarez-Fernández, A.; Breitschwerdt, E.B.; Solano-Gallego, L. Bartonella Infections in Cats and Dogs Including Zoonotic Aspects. Parasit Vectors 2018, 11, 624. [Google Scholar] [CrossRef]
- Beugnet, F.; Marié, J.-L. Emerging Arthropod-Borne Diseases of Companion Animals in Europe. Vet. Parasitol. 2009, 163, 298–305. [Google Scholar] [CrossRef]
- Le-Viet, N.; Le, V.-N.; Chung, H.; Phan, D.-T.; Phan, Q.-D.; Cao, T.-V.; Abat, C.; Raoult, D.; Parola, P. Prospective Case-Control Analysis of the Aetiologies of Acute Undifferentiated Fever in Vietnam. Emerg. Microbes Infect. 2019, 8, 339–352. [Google Scholar] [CrossRef]
- Anh, L.T.L.; Balakirev, A.E.; Chau, N.V. Investigation of Multiple Infections with Zoonotic Pathogens of Rodents in Northern Vietnam. J. Vector Borne Dis. 2021, 58, 47–53. [Google Scholar] [CrossRef] [PubMed]
- Do, T.; Inpankaew, T.; Duong, D.H.; Bui, K.L. First Molecular Evidence of Pathogens in Fleas Collected from Dogs in Northern Vietnam. Pathogens 2021, 10, 1185. [Google Scholar] [CrossRef]
- Porshakov, A.M.; Korneev, M.G.; Chumachkova, E.A.; Chau, N.V.; Toan, T.V.; Cuong, V.V. Addition to the Flea Fauna of Vietnam. Entomol. Rev. 2021, 101, 1287–1292. [Google Scholar] [CrossRef]
- Kirkland, G.L. Guidelines for the Capture, Handling, and Care of Mammals as Approved by the American Society of Mammalogists. J. Mammal. 1998, 79, 1416–1431. [Google Scholar] [CrossRef]
- Pratt, H.D. Flea Diagram—With Structures Labeled. 8. Available online: https://stacks.cdc.gov/view/cdc/7681/cdc_7681_DS1.pdf (accessed on 2 March 2023).
- Beaucournu, J.C.; Launay, H. Les Puces de La France et du Bassin Méditerranéen Occidental. Fédération Française des Sociétés de Sciences Naturelles; Lechevalier: Brêteau, France, 1990; ISBN 2-903052-10-7. [Google Scholar]
- Yssouf, A.; Socolovschi, C.; Leulmi, H.; Kernif, T.; Bitam, I.; Audoly, G.; Almeras, L.; Raoult, D.; Parola, P. Identification of Flea Species Using MALDI-TOF/MS. Comp. Immunol. Microbiol. Infect. Dis. 2014, 37, 153–157. [Google Scholar] [CrossRef]
- Vobis, M.; D’Haese, J.; Mehlhorn, H.; Mencke, N.; Blagburn, B.L.; Bond, R.; Denholm, I.; Dryden, M.W.; Payne, P.; Rust, M.K.; et al. Molecular Phylogeny of Isolates of Ctenocephalides felis and Related Species Based on Analysis of ITS1, ITS2 and Mitochondrial 16S RDNA Sequences and Random Binding Primers. Parasitol. Res. 2004, 94, 219–226. [Google Scholar] [CrossRef]
- Ahamada M’madi, S.; Diarra, A.Z.; Almeras, L.; Parola, P. Identification of Ticks from an Old Collection by MALDI-TOF MS. J. Proteom. 2022, 264, 104623. [Google Scholar] [CrossRef] [PubMed]
- Nebbak, A.; El Hamzaoui, B.; Berenger, J.-M.; Bitam, I.; Raoult, D.; Almeras, L.; Parola, P. Comparative Analysis of Storage Conditions and Homogenization Methods for Tick and Flea Species for Identification by MALDI-TOF MS. Med. Vet. Entomol. 2017, 31, 438–448. [Google Scholar] [CrossRef]
- Yssouf, A.; Almeras, L.; Raoult, D.; Parola, P. Emerging Tools for Identification of Arthropod Vectors. Future Microbiol. 2016, 11, 549–566. [Google Scholar] [CrossRef]
- Nebbak, A.; Willcox, A.C.; Bitam, I.; Raoult, D.; Parola, P.; Almeras, L. Standardization of Sample Homogenization for Mosquito Identification Using an Innovative Proteomic Tool Based on Protein Profiling. Proteomics 2016, 16, 3148–3160. [Google Scholar] [CrossRef]
- Yssouf, A.; Parola, P.; Lindström, A.; Lilja, T.; L’Ambert, G.; Bondesson, U.; Berenger, J.-M.; Raoult, D.; Almeras, L. Identification of European Mosquito Species by MALDI-TOF MS. Parasitol. Res. 2014, 113, 2375–2378. [Google Scholar] [CrossRef] [PubMed]
- Zurita, A.; Djeghar, R.; Callejón, R.; Cutillas, C.; Parola, P.; Laroche, M. Matrix-Assisted Laser Desorption/Ionization Time-of-Flight Mass Spectrometry as a Useful Tool for the Rapid Identification of Wild Flea Vectors Preserved in Alcohol. Med. Vet. Entomol. 2019, 33, 185–194. [Google Scholar] [CrossRef] [PubMed]
- Lafri, I.; El Hamzaoui, B.; Bitam, I.; Leulmi, H.; Lalout, R.; Mediannikov, O.; Chergui, M.; Karakellah, M.; Raoult, D.; Parola, P. Detection of Relapsing Fever Borrelia spp., Bartonella spp. and Anaplasmataceae Bacteria in Argasid Ticks in Algeria. PLoS Negl. Trop. Dis. 2017, 11, e0006064. [Google Scholar] [CrossRef]
- Djiba, M.L.; Mediannikov, O.; Mbengue, M.; Thiongane, Y.; Molez, J.-F.; Seck, M.T.; Fenollar, F.; Raoult, D.; Ndiaye, M. Survey of Anaplasmataceae Bacteria in Sheep from Senegal. Trop. Anim. Health Prod. 2013, 45, 1557–1561. [Google Scholar] [CrossRef]
- Rolain, J.-M.; Stuhl, L.; Maurin, M.; Raoult, D. Evaluation of Antibiotic Susceptibilities of Three Rickettsial Species Including Rickettsia felis by a Quantitative PCR DNA Assay. Antimicrob. Agents Chemother. 2002, 46, 2747–2751. [Google Scholar] [CrossRef] [PubMed]
- Mediannikov, O.; Trape, J.-F.; Diatta, G.; Parola, P.; Fournier, P.-E.; Raoult, D. Rickettsia Africae, Western Africa. Emerg. Infect. Dis. 2010, 16, 571–573. [Google Scholar] [CrossRef] [PubMed]
- Rolain, J.-M.; Franc, M.; Davoust, B.; Raoult, D. Molecular Detection of Bartonella quintana, B. koehlerae, B. henselae, B. clarridgeiae, Rickettsia felis, and Wolbachia pipientis in Cat Fleas, France. Emerg. Infect. Dis. 2003, 9, 339–342. [Google Scholar] [CrossRef]
- Rolain, J.-M.; Raoult, D. Molecular Detection of Coxiella burnetii in Blood and Sera during Q Fever. QJM 2005, 98, 615–617. [Google Scholar] [CrossRef]
- Laidoudi, Y.; Levasseur, A.; Medkour, H.; Maaloum, M.; Ben Khedher, M.; Sambou, M.; Bassene, H.; Davoust, B.; Fenollar, F.; Raoult, D.; et al. An Earliest Endosymbiont, Wolbachia massiliensis Sp. Nov., Strain PL13 from the Bed Bug (Cimex hemipterus), Type Strain of a New Supergroup T. Int. J. Mol. Sci. 2020, 21, 8064. [Google Scholar] [CrossRef]
- Nguyen, H.M.; Theppannga, W.; Vongphayloth, K.; Douangngeun, B.; Blacksell, S.D.; Robinson, M.T. Screening of Ectoparasites from Domesticated Dogs for Bacterial Pathogens in Vientiane, Lao PDR. Zoonoses Public Health 2020, 67, 862–868. [Google Scholar] [CrossRef]
- Suntsov, V.V.; Huong, L.T.; Suntsova, N.I.; Gratz, N.G. Plague Foci in Viet Nam: Zoological and Parasitological Aspects. Bull. World Health Organ. 1997, 75, 117–123. [Google Scholar]
- Suntsov, V.V.; Huong, L.T.; Suntsova, N.I. Notes on fleas (Siphonaptera) in plague foci on the Tay Nguyen plateau (Vietnam). Parazitologiia 1992, 26, 516–520. [Google Scholar]
- Kernif, T.; Socolovschi, C.; Wells, K.; Lakim, M.B.; Inthalad, S.; Slesak, G.; Boudebouch, N.; Beaucournu, J.-C.; Newton, P.N.; Raoult, D.; et al. Bartonella and Rickettsia in Arthropods from the Lao PDR and from Borneo, Malaysia. Comp. Immunol. Microbiol. Infect. Dis. 2012, 35, 51–57. [Google Scholar] [CrossRef]
- Beaucournu, J.-C.; Sountsova, N.I.; Ly, T.V.H.; Sountsov, V.V. Contribution à l’étude de La Peste Au Vietnam: Historique et Inventaire Des Puces Signalées (Insecta—Siphonaptera) En Zones Anthropisées. Parasite 2002, 9, 3–10. [Google Scholar] [CrossRef][Green Version]
- Le, T.D.; Tran, N.H.; Tran, T.K.T.; Mai, D.T.; Doan, B.M. Research on Species Composition and Distribution of Some External Parasites Groups in Southern—Lam Dong Area. Available online: http://www.tapchiyhocduphong.vn/tap-chi-y-hoc-du-phong/2015/08/nghien-cuu-thanh-phan-loai-va-phan-bo-mot-so-nhom-ngoai-ky-sinh-tai-mot-so-diem--o81E20300.html (accessed on 21 July 2022).
- Porshakov, A.M.; Chumachkova, E.A.; Kas’yan, Z.A.; Oglodin, E.G.; Mo, L.T.; Cuong, V.V.; Van Toan, C.; Nga, B.T.T. Results of Epizootiological Survey on Plague and Other Zoonotic Infections in the Northern Provinces of the Socialist Republic of Vietnam During Spring Months of 2019. Probl. Part. Danger. Infect. 2020, 1, 133–138. [Google Scholar] [CrossRef]
- Crook, L.D.; Tempest, B. Plague: A Clinical Review of 27 Cases. Arch. Intern. Med. 1992, 152, 1253–1256. [Google Scholar] [CrossRef]
- Goyle, A.N. On the Transmission of Plague by Xenopsylla astia and X. cheopis. Preliminary Observations. Ind. Med. Gaz. 1927, 62, 317–318. [Google Scholar]
- Tun, M.M.; King, R.E. The Host/Parasite Relationships of Xenopsylla astia and X. cheopis on Bandicota Bengalensis in Rangoon, Burma. Southeast Asian J. Trop. Med. Public Health 1979, 10, 505–509. [Google Scholar]
- Zarea, A.A.K.; Bezerra-Santos, M.A.; Nguyen, V.-L.; Colella, V.; Dantas-Torres, F.; Halos, L.; Beugnet, F.; Tempesta, M.; Otranto, D.; Greco, G. Occurrence and Bacterial Loads of Bartonella and Haemotropic Mycoplasma Species in Privately Owned Cats and Dogs and Their Fleas from East and Southeast Asia. Zoonoses Public Health 2022, 69, 704–720. [Google Scholar] [CrossRef]
- Lawrence, A.L.; Hii, S.-F.; Jirsová, D.; Panáková, L.; Ionică, A.M.; Gilchrist, K.; Modrý, D.; Mihalca, A.D.; Webb, C.E.; Traub, R.J.; et al. Integrated Morphological and Molecular Identification of Cat Fleas (Ctenocephalides felis) and Dog Fleas (Ctenocephalides canis) Vectoring Rickettsia Felis in Central Europe. Vet. Parasitol. 2015, 210, 215–223. [Google Scholar] [CrossRef]
- Parola, P.; Davoust, B.; Raoult, D. Tick- and Flea-Borne Rickettsial Emerging Zoonoses. Vet. Res. 2005, 36, 469–492. [Google Scholar] [CrossRef]
- Parola, P.; Cornet, J.-P.; Sanogo, Y.O.; Miller, R.S.; Thien, H.V.; Gonzalez, J.-P.; Raoult, D.; Telford III, S.R.; Wongsrichanalai, C. Detection of Ehrlichia spp., Anaplasma spp., Rickettsia spp., and Other Eubacteria in Ticks from the Thai-Myanmar Border and Vietnam. J. Clin. Microbiol. 2003, 41, 1600–1608. [Google Scholar] [CrossRef] [PubMed]
- Dittrich, S.; Phommasone, K.; Anantatat, T.; Panyanivong, P.; Slesak, G.; Blacksell, S.D.; Dubot-Pérès, A.; Castonguay-Vanier, J.; Stenos, J.; Newton, P.N.; et al. Rickettsia felis Infections and Comorbid Conditions, Laos, 2003-2011. Emerg. Infect. Dis. 2014, 20, 1402–1404. [Google Scholar] [CrossRef] [PubMed]
- Mawuntu, A.H.P.; Johar, E.; Anggraeni, R.; Feliana, F.; Bernadus, J.B.B.; Safari, D.; Yudhaputri, F.A.; Dhenni, R.; Dewi, Y.P.; Kato, C.; et al. Rickettsia felis Identified in Two Fatal Cases of Acute Meningoencephalitis. PLoS Negl. Trop. Dis. 2020, 14, e0007893. [Google Scholar] [CrossRef]
- Mokhtar, A.S.; Tay, S.T. Molecular Detection of Rickettsia felis, Bartonella henselae, and B. clarridgeiae in Fleas from Domestic Dogs and Cats in Malaysia. Am. J. Trop. Med. Hyg. 2011, 85, 931–933. [Google Scholar] [CrossRef]
- Abreu-Yanes, E.; Abreu-Acosta, N.; Kosoy, M.; Foronda, P. Molecular Detection of Bartonella henselae, Bartonella clarridgeiae and Rickettsia felis in Cat and Dog Fleas in Tenerife, Canary Islands, Spain. J. Vector Ecol. 2020, 45, 233–240. [Google Scholar] [CrossRef] [PubMed]
- Miarinjara, A.; Bland, D.M.; Belthoff, J.R.; Hinnebusch, B.J. Poor Vector Competence of the Human Flea, Pulex irritans, to Transmit Yersinia pestis. Parasit Vectors 2021, 14, 317. [Google Scholar] [CrossRef] [PubMed]
- Hornok, S.; Beck, R.; Farkas, R.; Grima, A.; Otranto, D.; Kontschán, J.; Takács, N.; Horváth, G.; Szőke, K.; Szekeres, S.; et al. High Mitochondrial Sequence Divergence in Synanthropic Flea Species (Insecta: Siphonaptera) from Europe and the Mediterranean. Parasit Vectors 2018, 11, 221. [Google Scholar] [CrossRef]
- Ratovonjato, J.; Rajerison, M.; Rahelinirina, S.; Boyer, S. Yersinia Pestis in Pulex irritans Fleas during Plague Outbreak, Madagascar. Emerg. Infect. Dis. 2014, 20, 1414–1415. [Google Scholar] [CrossRef]
- O’Donnell, M.; Elston, D.M. What’s Eating You? Human Flea (Pulex irritans). Cutis 2020, 106, 233–235. [Google Scholar] [CrossRef]
- Zurita, A.; Callejón, R.; De Rojas, M.; Gómez López, M.S.; Cutillas, C. Molecular Study of Stenoponia tripectinata Tripectinata (Siphonaptera: Ctenophthalmidae: Stenoponiinae) from the Canary Islands: Taxonomy and Phylogeny. Bull. Entomol. Res. 2015, 105, 704–711. [Google Scholar] [CrossRef] [PubMed]
- Zurita, A.; Gutiérrez, S.G.; Cutillas, C. Infection Rates of Wolbachia Sp. and Bartonella Sp. in Different Populations of Fleas. Curr. Microbiol. 2016, 73, 704–713. [Google Scholar] [CrossRef] [PubMed]
- Sevestre, J.; Diarra, A.Z.; Laroche, M.; Almeras, L.; Parola, P. Matrix-Assisted Laser Desorption/Ionization Time-of-Flight Mass Spectrometry: An Emerging Tool for Studying the Vectors of Human Infectious Diseases. Future Microbiol. 2021, 16, 323–340. [Google Scholar] [CrossRef]
- Tahir, D.; Almeras, L.; Varloud, M.; Raoult, D.; Davoust, B.; Parola, P. Assessment of MALDI-TOF Mass Spectrometry for Filariae Detection in Aedes aegypti Mosquitoes. PLoS Negl. Trop. Dis. 2017, 11, e0006093. [Google Scholar] [CrossRef] [PubMed]
- Diarra, A.Z.; Almeras, L.; Laroche, M.; Berenger, J.-M.; Koné, A.K.; Bocoum, Z.; Dabo, A.; Doumbo, O.; Raoult, D.; Parola, P. Molecular and MALDI-TOF Identification of Ticks and Tick-Associated Bacteria in Mali. PLoS Negl. Trop. Dis. 2017, 11, e0005762. [Google Scholar] [CrossRef]
- Huynh, L.N.; Diarra, A.Z.; Pham, Q.L.; Le-Viet, N.; Berenger, J.M.; Ho, V.H.; Nguyen, X.Q.; Parola, P. Morphological, Molecular and MALDI-TOF MS Identification of Ticks and Tick-Associated Pathogens in Vietnam. PLoS Negl. Trop. Dis. 2021, 15, e0009813. [Google Scholar] [CrossRef]
- Werren, J.H.; Baldo, L.; Clark, M.E. Wolbachia: Master Manipulators of Invertebrate Biology. Nat. Rev. Microbiol. 2008, 6, 741–751. [Google Scholar] [CrossRef]
- Tay, S.T. Wolbachia Endosymbionts, Rickettsia felis and Bartonella Species, in Ctenocephalides felis Fleas in a Tropical Region. J. Vector Ecol. 2013, 38, 200–202. [Google Scholar] [CrossRef]
- Gonçalves, L.R.; Harrus, S.; Herrera, H.M.; Gutiérrez, R.; Pedrassani, D.; Nantes, W.A.G.; Santos, F.M.; Porfírio, G.E.; Barreto, W.T.G.; de Macedo, G.C.; et al. Low Occurrence of Bartonella in Synanthropic Mammals and Associated Ectoparasites in Peri-Urban Areas from Central-Western and Southern Brazil. Acta Trop. 2020, 207, 105513. [Google Scholar] [CrossRef]
- Parola, P.; Raoult, D. Tropical Rickettsioses. Clin. Dermatol. 2006, 24, 191–200. [Google Scholar] [CrossRef]
- Parola, P.; Shpynov, S.; Montoya, M.; Lopez, M.; Houpikian, P.; Zeaiter, Z.; Guerra, H.; Raoult, D. First Molecular Evidence of New Bartonella spp. in Fleas and a Tick from Peru. Am. J. Trop. Med. Hyg. 2002, 67, 135–136. [Google Scholar] [CrossRef] [PubMed]
- Diarra, A.Z.; Kone, A.K.; Doumbo Niare, S.; Laroche, M.; Diatta, G.; Atteynine, S.A.; Coulibaly, M.; Sangare, A.K.; Kouriba, B.; Djimde, A.; et al. Molecular Detection of Microorganisms Associated with Small Mammals and Their Ectoparasites in Mali. Am. J. Trop. Med. Hyg. 2020, 103, 2542–2551. [Google Scholar] [CrossRef]
- Yin, X.; Zhao, S.; Yan, B.; Tian, Y.; Ba, T.; Zhang, J.; Wang, Y. Bartonella rochalimae, B. grahamii, B. elizabethae, and Wolbachia spp. in Fleas from Wild Rodents near the China-Kazakhstan Border. Korean J. Parasitol. 2019, 57, 553–559. [Google Scholar] [CrossRef] [PubMed]
- Gundi, V.A.K.B.; Taylor, C.; Raoult, D.; La Scola, B. Bartonella rattaustraliani Sp. Nov., Bartonella queenslandensis Sp. Nov. and Bartonella coopersplainsensis Sp. Nov., Identified in Australian Rats. Int. J. Syst. Evol. Microbiol. 2009, 59, 2956–2961. [Google Scholar] [CrossRef] [PubMed]
- Saengsawang, P.; Kaewmongkol, G.; Phoosangwalthong, P.; Chimnoi, W.; Inpankaew, T. Detection of Zoonotic Bartonella Species in Ticks and Fleas Parasitizing Free-Ranging Cats and Dogs Residing in Temples of Bangkok, Thailand. Vet. Parasitol. Reg. Stud. Rep. 2021, 25, 100612. [Google Scholar] [CrossRef] [PubMed]
- Inoue, K.; Maruyama, S.; Kabeya, H.; Yamada, N.; Ohashi, N.; Sato, Y.; Yukawa, M.; Masuzawa, T.; Kawamori, F.; Kadosaka, T.; et al. Prevalence and Genetic Diversity of Bartonella Species Isolated from Wild Rodents in Japan. Appl. Environ. Microbiol. 2008, 74, 5086–5092. [Google Scholar] [CrossRef][Green Version]
- Gundi, V.A.K.B.; Kosoy, M.Y.; Myint, K.S.A.; Shrestha, S.K.; Shrestha, M.P.; Pavlin, J.A.; Gibbons, R.V. Prevalence and Genetic Diversity of Bartonella Species Detected in Different Tissues of Small Mammals in Nepal. Appl. Environ. Microbiol. 2010, 76, 8247–8254. [Google Scholar] [CrossRef][Green Version]
- Winoto, I.L.; Goethert, H.; Ibrahim, I.N.; Yuniherlina, I.; Stoops, C.; Susanti, I.; Kania, W.; Maguire, J.D.; Bangs, M.J.; Telford, S.R.; et al. Bartonella Species in Rodents and Shrews in the Greater Jakarta Area. Southeast Asian J. Trop. Med. Public Health 2005, 36, 1523–1529. [Google Scholar]
- Jiyipong, T.; Morand, S.; Jittapalapong, S.; Rolain, J.-M. Bartonella spp. Infections in Rodents of Cambodia, Lao PDR, and Thailand: Identifying Risky Habitats. Vector Borne Zoonotic Dis. 2015, 15, 48–55. [Google Scholar] [CrossRef]
- Logan, J.M.J.; Hall, J.L.; Chalker, V.J.; O’Connell, B.; Birtles, R.J. Bartonella clarridgeiae Infection in a Patient with Aortic Root Abscess and Endocarditis. Access Microbiol. 2019, 1, e000064. [Google Scholar] [CrossRef]
- Kordick, D.L.; Hilyard, E.J.; Hadfield, T.L.; Wilson, K.H.; Steigerwalt, A.G.; Brenner, D.J.; Breitschwerdt, E.B. Bartonella clarridgeiae, a Newly Recognized Zoonotic Pathogen Causing Inoculation Papules, Fever, and Lymphadenopathy (Cat Scratch Disease). J. Clin. Microbiol. 1997, 35, 1813–1818. [Google Scholar] [CrossRef]
- André, M.R.; Canola, R.A.M.; Braz, J.B.; Perossi, I.F.S.; Calchi, A.C.; Ikeda, P.; Machado, R.Z.; de Vasconcelos, R.O.; Camacho, A.A. Aortic Valve Endocarditis Due to Bartonella Clarridgeiae in a Dog in Brazil. Rev. Bras. Parasitol. Vet. 2019, 28, 661–670. [Google Scholar] [CrossRef] [PubMed]
- Loan, H.K.; Cuong, N.V.; Takhampunya, R.; Klangthong, K.; Osikowicz, L.; Kiet, B.T.; Campbell, J.; Bryant, J.; Promstaporn, S.; Kosoy, M.; et al. Bartonella Species and Trombiculid Mites of Rats from the Mekong Delta of Vietnam. Vector Borne Zoonotic Dis. 2015, 15, 40–47. [Google Scholar] [CrossRef] [PubMed]
- Anh, P.H.; Van Cuong, N.; Son, N.T.; Tue, N.T.; Kosoy, M.; Woolhouse, M.E.J.; Baker, S.; Bryant, J.E.; Thwaites, G.; Carrique-Mas, J.J.; et al. Diversity of Bartonella spp. in Bats, Southern Vietnam. Emerg. Infect. Dis. 2015, 21, 1266–1267. [Google Scholar] [CrossRef]
- Parola, P.; Miller, R.S.; McDaniel, P.; Telford, S.R.; Rolain, J.-M.; Wongsrichanalai, C.; Raoult, D. Emerging Rickettsioses of the Thai-Myanmar Border. Emerg. Infect. Dis. 2003, 9, 592–595. [Google Scholar] [CrossRef]
- Chomel, B.B.; Carlos, E.T.; Kasten, R.W.; Yamamoto, K.; Chang, C.C.; Carlos, R.S.; Abenes, M.V.; Pajares, C.M. Bartonella henselae and Bartonella clarridgeiae Infection in Domestic Cats from The Philippines. Am. J. Trop. Med. Hyg. 1999, 60, 593–597. [Google Scholar] [CrossRef] [PubMed]
- Marston, E.L.; Finkel, B.; Regnery, R.L.; Winoto, I.L.; Graham, R.R.; Wignal, S.; Simanjuntak, G.; Olson, J.G. Prevalence of Bartonella henselae and Bartonella clarridgeiae in an Urban Indonesian Cat Population. Clin. Diagn. Lab. Immunol. 1999, 6, 41–44. [Google Scholar] [CrossRef]
- Mizukami, M.; Sato, S.; Nabeshima, K.; Kabeya, H.; Ueda, D.; Suzuki, K.; Maruyama, S. Molecular Survey of Bartonella rochalimae in Japanese Raccoon Dogs (Nyctereutes Procyonoides Viverrinus). J. Wildl. Dis. 2020, 56, 560. [Google Scholar] [CrossRef]
- Eremeeva, M.E.; Gerns, H.L.; Lydy, S.L.; Goo, J.S.; Ryan, E.T.; Mathew, S.S.; Ferraro, M.J.; Holden, J.M.; Nicholson, W.L.; Dasch, G.A.; et al. Bacteremia, Fever, and Splenomegaly Caused by a Newly Recognized Bartonella Species. N. Engl. J. Med. 2007, 356, 2381–2387. [Google Scholar] [CrossRef]
- Henn, J.B.; Gabriel, M.W.; Kasten, R.W.; Brown, R.N.; Koehler, J.E.; MacDonald, K.A.; Kittleson, M.D.; Thomas, W.P.; Chomel, B.B. Infective Endocarditis in a Dog and the Phylogenetic Relationship of the Associated “Bartonella rochalimae” Strain with Isolates from Dogs, Gray Foxes, and a Human. J. Clin. Microbiol. 2009, 47, 787–790. [Google Scholar] [CrossRef]
- Tay, S.T.; Mokhtar, A.S.; Zain, S.N.M.; Low, K.C. Isolation and Molecular Identification of Bartonellae from Wild Rats (Rattus Species) in Malaysia. Am. J. Trop. Med. Hyg. 2014, 90, 1039–1042. [Google Scholar] [CrossRef] [PubMed]
- Helan, J.N.V.G.; Grinberg, A.; Gedye, K.; Potter, M.; Harrus, S. Molecular Detection of Bartonella coopersplainsensis and B. henselae in Rats from New Zealand. N. Z. Vet. J. 2018, 66, 257–260. [Google Scholar] [CrossRef]
- Li, D.-M.; Hou, Y.; Song, X.-P.; Fu, Y.-Q.; Li, G.-C.; Li, M.; Eremeeva, M.E.; Wu, H.-X.; Pang, B.; Yue, Y.-J.; et al. High Prevalence and Genetic Heterogeneity of Rodent-Borne Bartonella Species on Heixiazi Island, China. Appl. Environ. Microbiol. 2015, 81, 7981–7992. [Google Scholar] [CrossRef] [PubMed]
- Mardosaitė-Busaitienė, D.; Radzijevskaja, J.; Balčiauskas, L.; Bratchikov, M.; Jurgelevičius, V.; Paulauskas, A. Prevalence and Diversity of Bartonella Species in Small Rodents from Coastal and Continental Areas. Sci. Rep. 2019, 9, 12349. [Google Scholar] [CrossRef] [PubMed]
Microorganisms | Targeted Sequence/Amplicon Size (bp) | Primers (5′-3′) and Probes (Used for qPCR Screening or Sequencing) | References |
---|---|---|---|
Anaplasmataceae | 23S | f_TGACAGCGTACCTTTTGCAT r_GTAACAGGTTCGGTCCTCCA p_6FAM-GGATTAGACCCGAAACCAAG | [26] |
23S (485) | f_ATAAGCTGCGGGGAATTGTC r_TGCAAAAGGTACGCTGTCAC | ||
Rickettsia spp. | gltA(RKND03) | f_GTGAATGAAAGATTACACTATTTAT r_GTATCTTAGCAATCATTCTAATAGC p_6FAM-CTATTATGCTTGCGGCTGTCGGTTC | [27] |
Borrelia spp. | ITS4 | f_GGCTTCGGGTCTACCACATCTA r_CCGGGAGGGGAGTGAAATAG p_TGCAAAAGGCACGCCATCACC | [28] |
Bartonella spp. | ITS2 | f_GATGCCGGGGAAGGTTTTC r_GCCTGGGAGGACTTGAACCT p_GCGCGCGCTTGATAAGCGTG | [29] |
gltA (1000 bp) | f_ACGTCGAAAAGAYAAAAATG r_GTAATRCCAGAAATARAAATC | ||
Coxiellia burnetii | IS30A | f_CGCTGACCTACAGAAATATGTCC r_GGGGTAAGTAAATAATACCTTCTGG p_CATGAAGCGATTTATCAATACGTGTATG | [30] |
Wolbachia spp. | 23S rRNA | Wol-301-f (5′-TGGAACTGAGATACGGTCCAG-3′) Wol-478-r (5′-GCACGGAGTTAGCCAGGACT-3′) Wol-347-p (6FAM-AATATTGGACAATGGGCGAA) | [31] |
16S rRNA (rrs) | W-Spec_f (5′-CATACCTATTCGAAGGGATAG-3′) W-Spec_r (5′-AGCTTCGAGTGAAACCAATTC-3′) | [26] |
Morphological Identification | N° Tested MALDI-TOF MS/Collected | N° Obtained/Tested and MolecularID* (%identity; GenBank Accession Number) | N° of Good Spectra/ Tested | N° of Spectra Added to DB& | MALDI-TOF MS ID* (Number Identified) | LSVs$ (Low–High) |
---|---|---|---|---|---|---|
Pulex irritans | 3/4 | 3/3 Pulex irritans (99–100%; KX982861) | 0/3 | 0 | Not applicable | Not applicable |
Xenopsylla cheopis | 2/3 | 1/2 Xenopsylla cheopis (100%; DQ295059) | 0/2 | 0 | Not applicable | Not applicable |
Xenopsylla astia | 5/8 | 5/5 Xenopsylla cheopis (83.16–90%; KX982860 | 0/5 | 0 | Not applicable | Not applicable |
Ctenocephalides felis | 48/51 | 5/5 Ctenocephalides felis (100%; MT895636, HF583247) | 45/48 | 5 | Ctenocephalides felis (40) | 1.731–2.733 |
Ctenocephalides canis | 242/436 | 5/5 Ctenocephalides canis (100%; MH895642) | 212/242 | 5 | Ctenocephalides canis (207) | 1.708–2.438 |
5 flea species | 300/502 | 257/300 |
Microorganisms Tested | Flea Species | |||
---|---|---|---|---|
X. astia | C. canis | C. felis | Total (%) | |
Anaplasmataceae | 5 | 148 | 21 | 174 (58%) |
Bartonella spp. | 4 | 10 | - | 7 (2.3%) |
Rickettsia spp. | - | - | - | - |
Borrelia spp. | - | - | - | - |
Coxiella burnetii | - | - | - | - |
Microorganisms Tested | Flea Species | ||||
---|---|---|---|---|---|
Per Ident (%) | X. astia | C. canis | C. felis | Total (%) | |
Wolbachia endosymbiont | 99.69–100 | 3 | 2 | NA | |
Wolbachia pipiens | 5 | - | NA | ||
Bartonella clarridgeiae | 99.2–100 | - | 3 | - | 3 (1%) |
Bartonella rochalimae | 100 | 3 | - | - | 3 (1%) |
Bartonella coopersplainsensis | 100 | 1 | - | - | 1 (0.3%) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Huynh, L.N.; Diarra, A.Z.; Pham, Q.L.; Berenger, J.-M.; Ho, V.H.; Nguyen, X.Q.; Parola, P. Identification of Vietnamese Flea Species and Their Associated Microorganisms Using Morphological, Molecular, and Protein Profiling. Microorganisms 2023, 11, 716. https://doi.org/10.3390/microorganisms11030716
Huynh LN, Diarra AZ, Pham QL, Berenger J-M, Ho VH, Nguyen XQ, Parola P. Identification of Vietnamese Flea Species and Their Associated Microorganisms Using Morphological, Molecular, and Protein Profiling. Microorganisms. 2023; 11(3):716. https://doi.org/10.3390/microorganisms11030716
Chicago/Turabian StyleHuynh, Ly Na, Adama Zan Diarra, Quang Luan Pham, Jean-Michel Berenger, Van Hoang Ho, Xuan Quang Nguyen, and Philippe Parola. 2023. "Identification of Vietnamese Flea Species and Their Associated Microorganisms Using Morphological, Molecular, and Protein Profiling" Microorganisms 11, no. 3: 716. https://doi.org/10.3390/microorganisms11030716
APA StyleHuynh, L. N., Diarra, A. Z., Pham, Q. L., Berenger, J.-M., Ho, V. H., Nguyen, X. Q., & Parola, P. (2023). Identification of Vietnamese Flea Species and Their Associated Microorganisms Using Morphological, Molecular, and Protein Profiling. Microorganisms, 11(3), 716. https://doi.org/10.3390/microorganisms11030716