Next Article in Journal
Effects of Cellulase and Lactic Acid Bacteria on Ensiling Performance and Bacterial Community of Caragana korshinskii Silage
Next Article in Special Issue
Differential Effects of Viruses on the Growth Efficiency of Freshwater Bacterioplankton in Eutrophic Relative to Non-Eutrophic Lakes
Previous Article in Journal
Diversity of Bacterial Soft Rot-Causing Pectobacterium Species Affecting Cabbage in Serbia
Previous Article in Special Issue
Red Sea Atlas of Coral-Associated Bacteria Highlights Common Microbiome Members and Their Distribution across Environmental Gradients—A Systematic Review
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

A One-Year Systematic Study to Assess the Microbiological Profile in Oysters from a Commercial Harvesting Area in Portugal

by
Inês C. Rodrigues
1,†,
Nânci Santos-Ferreira
2,†,
Daniela Silva
1,
Carla Chiquelho da Silva
3,
Ângela S. Inácio
4,
Maria São José Nascimento
5 and
Paulo Martins da Costa
1,6,*
1
ICBAS-Instituto de Ciências Biomédicas Abel Salazar, Universidade do Porto, Rua de Jorge Viterbo Ferreira, 228, 4050-313 Porto, Portugal
2
KU Leuven-Department of Microbiology, Immunology and Transplantation, Rega Institute, Laboratory of Virology and Chemotherapy, B-3000 Leuven, Belgium
3
Department of Quality Control and Food Safety, Grupo Jerónimo Martins, Rua Nossa Sra. do Amparo, 4440-232 Porto, Portugal
4
CNC-Center for Neurosciences and Cell Biology, Faculty of Medicine, University of Coimbra, Rua Larga, Polo I, 3004–504 Coimbra, Portugal
5
Faculdade de Farmácia, Universidade do Porto, Rua de Jorge Viterbo Ferreira, 228, 4050-313 Porto, Portugal
6
Interdisciplinary Centre of Marine and Environmental Research (CIIMAR), Terminal de Cruzeiros do Porto, de Leixões, Av. General Norton de Matos s/n, 4450-208 Matosinhos, Portugal
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Microorganisms 2023, 11(2), 338; https://doi.org/10.3390/microorganisms11020338
Submission received: 29 December 2022 / Revised: 24 January 2023 / Accepted: 26 January 2023 / Published: 29 January 2023
(This article belongs to the Special Issue Microbiomes of Aquatic Organisms)

Abstract

:
As filter-feeding animals farmed in water bodies exposed to anthropogenic influences, oysters can be both useful bioremediators and high-risk foodstuffs, considering that they are typically consumed raw. Understanding the dynamic of bacterial and viral load in Pacific oyster (Crassostrea gigas) tissues, hemolymph, outer shell surface biofilm, and farming water is therefore of great importance for microbiological risk assessment. A one-year survey of oysters collected from a class B production area (Canal de Mira, on the Portuguese western coast) revealed that these bivalve mollusks have a good depurating capacity with regard to bacteria, as Salmonella spp. and viable enterococci were not detected in any oyster flesh (edible portion) samples, despite the fact that these bacteria have regularly been found in the farming waters. Furthermore, the level of Escherichia coli contamination was clearly below the legal limit in oysters reared in a class B area (>230–≤4600 MPN E. coli/100 g). On the contrary, norovirus was repeatedly detected in the digestive glands of oysters sampled in autumn, winter, and spring. However, their presence in farming waters was only detected during winter.

1. Introduction

As a seafood product with high nutritional value, the Pacific oyster (Crassostrea gigas) is farmed across the globe, being highly appreciated in the southern European markets [1,2]. This species is also the most produced oyster in Portugal, particularly in Canal de Mira [3].
Oysters are a very particular foodstuff and one of the few animal foods that are consumed whole and raw. Furthermore, adult oysters are capable of filtering approximately 200 L of water per day, retaining many bacteria and other suspended particles [4,5]. Thus, when oysters farmed in water bodies are exposed to anthropogenic influence, their bodies concentrate chemical pollutants and fecal microorganisms, some of which can constitute a risk to human health [5,6,7]. Among pathogenic microorganisms, Vibrio spp., norovirus (NoV), Salmonella spp., and Listeria monocytogenes (L. monocytogenes) are the ones most frequently associated with foodborne zoonosis outbreaks [8,9]. Other important zoonotic agents, such as hepatitis A virus (HAV), hepatitis E virus (HEV), Escherichia coli (E. coli), and Clostridium spp. can be associated with exposure to contaminated shellfish [10,11,12].
In order to protect consumers’ health and ensure that oysters meet strict food safety standards, rigorous controls need to be in place concerning farming and harvesting shellfish [13]. European Hygiene Regulations [14,15,16] state that shellfish business operators are responsible for ensuring that bivalve mollusks meet strict hygiene and health standards. Risk assessment and management currently rely on the classification of shellfish harvesting areas based on the results of monitoring E. coli in shellfish [17] as an indicator of fecal contamination. Depending on the shellfish production area classification (A, B, or C), oysters with less than 230 MPN (most probable number) of E. coli per 100 g of flesh and intra-valvular liquid may go to market for direct human consumption. Nevertheless, those harvested from Class B (>230–≤4600 MPN E. coli/100 g) may be collected and placed on the market for human consumption only after treatment in a purification center or after relaying; oysters harvested from C areas (less than 46,000 MPN of E. coli/100 g) must be submitted for relaying over a longer period or undergo heat treatment to eliminate pathogenic microorganisms before being sold to consumers [16].
From an ecological perspective, oysters are a keystone species in estuarine environments as reef-builders and as filter-feeders that can naturally remove pathogens from the seawater, reducing disease risk to humans and wildlife [18]. The persistence of bacteria in oyster tissues depends on their resistance to the bactericidal activity of the hemolymph [19]. Indeed, the host resident bacteria of this circulatory fluid provide health benefits to the oyster [20] this circulatory fluid can provide information pertinent to the health assessment of bivalve populations.
Despite being valuable biofilters, oysters and other bivalves are also able to discriminate and selectively feed on different foods based on shape, surface properties, and the charge and size of particles [21]. Particle discrimination may improve water quality by removing particulate organic matter, reducing the impact of these on the ecosystem [22].
This study aimed to evaluate bacterial and viral load in Pacific oyster (C. gigas) flesh, intra-valvular liquid, hemolymph, outer shell surface, and farming waters during a one-year survey by analyzing the total aerobic microorganisms, marine heterotrophic bacteria, E. coli, Pseudomonas spp., Clostridium perfringens (C. perfringens), coagulase-positive Staphylococcus, Enterococcus spp., Salmonella spp., L. monocytogenes, molds, yeasts, norovirus (NoV), hepatitis E virus (HEV), and hepatitis A virus (HAV). The commercial oysters included in this study were farmed in Canal de Mira, one of the leading producers on the Portuguese western coast, which receives a continuous seawater and freshwater supply, but also inland drainage and treated and untreated urban wastewater [23].

2. Materials and Methods

2.1. Sampling and Processing

Throughout a complete seasonal cycle, summer (July 2016), autumn (November 2016), winter (January 2017), and spring (May 2017), samples of 35 cultivated Pacific oysters (C. gigas) (with size 9–11 cm and weight 70–90 g) and the respective farming water (1 L collected three times within 60 min intervals in three different sample points) were collected from Canal de Mira (40°38′ N, 8°45′ W) (Figure 1), in the western Portuguese coast. At the time of collection, this production area was rated as class B, meaning that live oysters from this production site could only be placed on the market for human consumption after treatment in a purification center or after relaying [16].
Samples were transported within 3 h in temperature-controlled food boxes and immediately processed upon arrival at the laboratory. The oysters were thoroughly washed with sterile seawater to remove sand, mud, and slime before the measurement of their weight, length, height, and width. They were then divided into six pools, as illustrated in Figure 2. The edible content (flesh, hemolymph, and intra-valvular liquid) of five pools, composed of five oysters each, was transferred to sterile stomacher bags and homogeneously suspended in 1/10 buffered peptone water (BPW, Biokar, Allonne, France). The sixth pool (10 oysters) was used to perform microbiological analysis on the superficial biofilm (outer shell surface), intra-valvular liquid, and hemolymph; virological analysis on the digestive gland; and metabarcoding analysis on the hemolymph. The superficial biofilm was collected by washing the shells with 100 mL of BPW using a pair of sterile toothbrushes. Intra-valvular fluid was collected into a sterile falcon after filtration through a sterile gaze. The hemolymph was collected with a sterile syringe, followed by the dissection of the digestive glands.

2.2. Bacterial Analysis

The microbiological analysis of flesh and intra-valvular liquid samples was performed in compliance with the European Union microbiological criteria for live bivalve mollusks [17], taking also into account the potential microbiological hazards of raw oyster consumption. The analysis included the enumeration of total aerobic microorganisms at 7 °C and 30 °C, marine heterotrophic bacteria at 21 °C, E. coli, Pseudomonas spp., Clostridium perfringens (C. perfringens), coagulase-positive Staphylococcus, Enterococcus spp., molds and yeasts, and the detection of Salmonella spp. and L. monocytogenes. For bacterial enumeration, a pooled sample comprising 25 oysters was used. Regarding the detection of Salmonella spp. and L. monocytogenes, five pools comprising five oysters each were prepared. Total aerobic microorganisms at 30 °C, marine heterotrophic bacteria at 21 °C, E. coli, and Enterococcus spp. were also assessed on the superficial biofilm, intra-valvular liquid, and hemolymph samples (pool of 10 oysters). Finally, the total counts of aerobic microorganisms at 22 °C and 37 °C, marine heterotrophic bacteria at 21 °C, E. coli, Enterococcus spp., and Salmonella spp. were also evaluated in the farming water samples.
International Organization for Standardization (ISO) methods were used for the enumeration/detection of microorganisms: ISO 4833-1 (ISO 4833-1, 2013) and ISO 6222 (NF EN ISO 6222, 1999) for total aerobic microorganisms; ISO 16649-2 (NF ISO 16649-2, 2001) and ISO 16649-3 (ISO 16649-3, 2014) for E. coli; ISO 6579 (NF EN ISO 6579/A1, 2007) for Salmonella spp.; ISO 7937 (ISO 7937, 2004) for C. perfringens; ISO 6888-3 (ISO 6888-3, 2003) for coagulase-positive Staphylococcus; ISO 7899-2 (PN EN ISO 7899-2, 2004) for Enterococcus spp.; ISO 11290-1 (ISO 11290-1, 2017) for L. monocytogenes; and ISO 21527-2 (ISO 21527-2, 2003) for yeasts and molds (Table S1). The detection of both Pseudomonas spp. and marine heterotrophic bacteria was performed using an internal laboratory method (Table S1). Briefly, to detect marine heterotrophic bacteria, the pour-plate method was performed. In total, 1 mL of each sample was plated in marine agar medium (Condalab, Madrid, Spain) and incubated at 21 °C for 48 h. The detection of Pseudomonas spp. was performed using serial dilutions and spreading 100 µL of each sample on cephaloridin fucidin cetrimide (CFC) agar (Oxoid, Basingstoke, UK), and the plates were incubated at 30 °C for 48 h.
In addition, bacteria total counts on samples of superficial biofilm, intra-valvular liquid, and hemolymph collected during summer were also estimated by fluorescence in situ hybridization (FISH), as previously described by [24,25,26,27]. Eco440, PseaerA, and GV probes (MWG-Biotech, Ebersberg, Germany) were used to detect E. coli, P. aeruginosa, and Vibrio spp., respectively. The slides were mounted using Vectashield® Mounting Medium (Vector Laboratories, Newark, CA, USA) and immediately observed in a Nikon Eclipse E400 microscope (Nikon Instruments, Amsterdam, The Netherlands) at 1000× magnification with an oil immersion objective (HCX PLAN APD). All samples were analyzed in triplicate, and the data are presented as cell/milliliter.

2.3. Antimicrobial Susceptibility Testing

The antimicrobial susceptibility of all E. coli and Enterococcus spp. isolated from the farming waters, and from the flesh, superficial biofilm, intra-valvular liquid, and hemolymph of oysters was tested and interpreted according to the Clinical and Laboratory Standards Institute guidelines (CLSI, 2018), using the Kirby–Bauer method. A panel of 18 and 15 antimicrobial agents was used for the antimicrobial susceptibility testing of E. coli and Enterococcus spp. strains, respectively (Table 1). All antimicrobial disks were from Oxoid (Oxoid, Basingstoke, UK). Isolates resistant to at least one antibiotic agent of three or more antibacterial classes were considered multidrug-resistant (MDR) bacteria [28].

2.4. Detection of Food- and Waterborne Viruses

The detection of norovirus (NoV), hepatitis E virus (HEV), and hepatitis A virus (HAV) was performed on both the farming waters and the oysters’ digestive gland samples from all seasons (Figure 2) following ISO/TS 15216-1:2017 ‘Microbiology of food and animal feed—Horizontal method for determination of hepatitis A virus and norovirus in food using real-time RT-PCR—Part 1: Method for quantification’ and as previously described. [29,30]. Briefly, viral extraction was carried out from the homogenates of each sample and mixed with 2 mL of proteinase K (0.1 mg/mL). This mixture was spiked with 10 μL of a virus used to control extraction efficiency, the murine norovirus (MNV-1; 2.7 × 109 RNA copies/μL), followed by agitation for 1 h at 37 °C at 320 osc/min (ELMI DOS-10 M Digital Orbital Shaker, ELMI, Riga, Letonia). Then, it was incubated for 15 min at 60 °C and centrifuged for 5 min at 3000× g at room temperature. In total, 500 μL of supernatant was recovered and used for RNA extraction using an NZY Total RNA Isolation Kit (NZYTech, Lisbon, Portugal), according to the manufacturer’s instructions. RNA was eluted in 50 μL of RNA-free sterile water and stored at −80 °C until further analysis. NoV GI and GII and HAV were quantified using the primers/probes described in ISO 15216-1:2017. The detection and quantification of HEV were performed by an RTqPCR assay targeting the ORF3 region with the primers/probes previously described [30,31]. The RTqPCR assays were performed using the iTaq Universal PROBES One-Step Kit (Bio-Rad Laboratories, Hercules, CA, USA) in a final volume of 20 μL reaction mixture according to the manufacturer’s and run in a CFX Connect Real-Time System (Bio-Rad Laboratories).
The presence of oyster herpesvirus type 1 (OsHV-1) was also evaluated on oyster edible portions from all seasons (Figure 2). The DNA extraction of the oyster edible portions was performed using a QIAamp cador Pathogen Mini Kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions. Briefly, 50 mg of tissue and fluids were subjected to ‘Pretreatment T2–Enzymatic Digestion of Tissue’, followed by ‘Pretreatment B1–for Difficult-to-lyse Bacteria in whole blood or Pre-treated Tissue’ and finally ‘Purification of Pathogenic Nucleic acids from Fluid Samples’. Eluted DNA was stored at −80 °C until further analysis. OsHV-1 quantification was performed following an improved protocol published by Martenot et al., using a Taqman probe and primers that target the B region of the OsHV-1 genome. qPCR was performed using SsoAdvanced Universal PROBES Supermix (Bio-Rad Laboratories) [32].

2.5. Metabarcoding Analysis for Microbiome Composition

DNA extraction for metabarcoding analysis was performed using a QIAamp cador Pathogen Mini Kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions. For edible samples, ‘Pretreatment T2–Enzymatic Digestion of Tissue’ was used, followed by ‘Pretreatment B1–for Difficult-to-lyse Bacteria in whole blood or Pre-treated Tissue’, and for hemolymph samples, ‘Pretreatment B2–for Difficult-to-lyse Bacteria in Cell-free Fluids’ was used.
The metabarcoding analysis was carried out in edible portion samples collected in the four seasons and hemolymph samples collected in autumn and spring, using next-generation sequencing (GATC Microbiome Profiling (Combined Analysis)) (GATC Biotech, Constance, Germany). This amplicon-based method targeted the V1-V8 variable region of the 16S rRNA gene, using the primers 27F (AGAGTTTGATCCTGGCTCAG) and BS-R1407 (GACGGGCGGTGWGTRC), resulting in a fragment of 1381 bp. The data were checked for chimeras using UCHIME, and the corresponding sequences were removed from further analysis. Non-chimeric, unique sequences were then subjected to BLASTn analysis using non-redundant 16S rRNA reference sequences with an E-value cutoff 1 × 106. Reference 16S rRNA sequences were obtained from the Ribosomal Database Project. Only good quality and unique 16S rRNA sequences that have a taxonomic are considered and used as a reference database to assign operational taxonomic unit (OTU) status to the sequences. Taxonomic classification was based on NCBI Taxonomy [5]—http://www.ncbi.nlm.nih.gov/taxonomy (accessed on 15 December 2017). Except for the E-value cutoff (1 × 106), no other thresholds were used during the BLAST analysis. All the hits to reference the 16S rRNA database were considered, and specific filters were applied to the hits to remove false positives. Further, the best hit and multiple hits per sequence were analyzed separately to determine the discriminatory power of the sequences with respect to the assigned OTUs. Finally, the classification of OTU sequences was consolidated to compute relative abundancies (percentage composition).

3. Results

3.1. Morphological Parameters

In each season, four morphological parameters were evaluated individually: total weight, height, length, and width (Figure S1 and Table S2). The total weight varied between 56.9 g ± 5.0 (spring; mean body weight ± S.D.) and 84.3 g ± 18.5 (winter). Considering the total height measurements, the minimum values recorded were 2.6 cm ± 0.4 (spring), and the maximum values were 3.0 cm ± 0.3 (winter). Regarding the total length measurements, the values varied between 8.4 cm ± 0.8 (spring and summer) and 10.2 cm ± 1.6 (winter). Finally, the total width values varied between 4.7 cm ± 0.6 and 5.2 cm ± 0.5, where the highest and lowest widths were observed in the winter and spring, respectively.

3.2. Bacterial Analysis

In the present study, the microbiological quality of oysters and their farming waters was examined in four seasonal sampling surveys (Table 2). Salmonella spp. and L. monocytogenes were not found in the flesh or intra-valvular liquid. The level of E. coli contamination was found to be between 20 (summer and spring) and 92 (winter) MPN E. coli/100 g in the edible portion. Furthermore, viable enterococci were not detected in any flesh or intra-valvular liquid samples. On the contrary, Salmonella spp., Enterococcus spp., and E. coli were detected in the farming waters. E. coli was detected in all seasons, whereas Enterococcus spp. was detected in summer, autumn, and winter, and Salmonella spp. was only detected in summer and winter in the farming water samples. The highest concentration of heterotrophic marine bacteria in the farming water (1.5 × 104 CFU/100 mL) was found in the sample collected in winter.
The number of total microorganisms on superficial biofilms (covering the outer shell) seems to have followed their abundance in the farming water, particularly in the samples collected in winter and spring. On the contrary, the number of marine heterotrophic bacteria on the surface biofilm of the oysters and their feeding waters was less articulated: whereas similar values were found in autumn, in summer and in spring, the difference exceeded two logarithms.
Regarding intra-valvular liquid samples, there were differences between the number of microorganisms detected in this physiological fluid and the quantity found in the farming water column. A higher concentration of microorganisms in the intra-valvular liquid was found compared to the farming water column during summer and autumn. Despite this, the number of fecal bacteria (E. coli and Enterococci) was generally higher in water than in the intra-valvular liquid, similarly to what was observed with the superficial biofilm. Likewise, marine heterotrophic bacteria in the intra-valvular liquid showed the same dynamics when compared to the superficial biofilm. Indeed, the highest value observed for this group of microorganisms was with the sample collected during summer. On the other hand, the hemolymph showed an increased number of marine heterotrophic bacteria in the summer and spring samples.
Analysis of the superficial biofilm, intra-valvular liquid, and hemolymph samples by the FISH protocol revealed the presence of Vibrio spp. in 100% of the samples (Table 3). The hemolymph was the most contaminated material (median, 4.1 × 106 cells/g), and the highest values of Vibrio spp. cells were observed during summer. The FISH method allowed the detection of E. coli cells in 75% of the superficial biofilm samples (summer, winter, and spring), whereas the bacteriological method only detected viable E. coli in the winter sample. A clear contrast between the traditional plating method and the FISH cell counting was also observed with regard to Pseudomonas spp.

3.3. Antimicrobial Susceptibility Testing

In this study, we have evaluated the antimicrobial susceptibility of 30 E. coli isolates that were obtained from the farming water (n = 18), edible portion (n = 10), intra-valvular liquid (n = 1), and superficial biofilm (n = 1), and 20 Enterococcus spp. isolated from the farming water (n = 10), superficial biofilm (n = 9) and intra-valvular liquid (n = 1). Overall, 27% of the E. coli and 1% of the enterococci isolates were susceptible to all of the antimicrobial drugs tested. The remaining 22 E. coli and 19 Enterococcus spp. isolates showed resistance to at least one antimicrobial drug. The frequency of antimicrobial susceptibility to each antimicrobial drug on E. coli and Enterococcus spp. isolates was calculated and is presented in Figure 3 and Figure 4, respectively.
Regarding E. coli isolates, the highest rate of drug resistance was observed for ampicillin and cephalothin (approximately 25%), followed by nalidixic acid (16.7%), amoxicillin/clavulanic acid, aminoglycosides (gentamicin, tobramycin, and streptomycin), aztreonam, cefoxitin, ciprofloxacin, tetracycline, and sulfamethoxazole/trimethoprim (8.3%), and chloramphenicol and doxycycline (4.2%). Concerning Enterococcus spp. isolates, nitrofurantoin revealed the highest prevalence of resistance, followed by linezolid, rifampicin, and tetracycline (16.7%), ampicillin (11.1%), doxycycline and quinupristin-dalfopristin (5.6%). It is worth mentioning that neither the third-generation of cephalosporin-resistant E. coli nor vancomycin-resistant Enterococcus were found. However, the high frequency of resistance to aminopenicillins, second-generation cephalosporins, and nalidixic acid in E. coli isolates, and the resistance levels against ampicillin and linezolid in enterococci, deserve to be highlighted.
Moreover, 30 susceptibility profiles of E. coli isolates and 20 susceptibility profiles of Enterococcus spp. isolates were analyzed, where 37% and 35% were revealed to be MDR E. coli isolates and MDR Enterococcus spp. isolates, respectively. The resistance profiles of MDR strains are shown in Table 3 and Table 4. MDR E. coli was isolated from the farming water (n = 6), edible portion (n = 4), and superficial biofilm (n = 1) (Table 4), and MDR Enterococcus spp. was detected in the farming water (n = 6) and superficial biofilm (n = 1) (Table 5). Regarding seasonality, MDR E. coli was found in farming water in summer, autumn, and winter samples, and the edible content in autumn and winter samples. On the other hand, during the winter, eight samples were found to be contaminated with MDR E. coli in the edible portion and superficial biofilm. The water contaminated with MDR Enterococcus spp. was collected during summer (n = 1), autumn (n = 3), and winter (n = 3). Furthermore, the superficial biofilm containing MDR Enterococcus spp. was collected during winter (n = 1).

3.4. Detection of Food- and Waterborne Viruses

The analysis of foodborne viral contamination was performed, and the results are shown in Table 6. NoV was detected in the digestive gland in the spring and summer samples, as well as in the farming water in spring. HEV was detected in the farming water in spring. HAV was not detected in any digestive gland or water samples. OsHV-1 was also not detected in any edible portion sample.

3.5. Metabarcoding Analysis

Metabarcoding analysis revealed that the microbiome of the edible portion and hemolymph throughout seasons were dominated by Vibrio spp. (22.3%), excluding the edible portion in the winter sample (O3C) (Figure 5). The most predominant microorganisms belong to the genus Vibrio followed by Psychrilyobacter (Table 7).

4. Discussion

Presently, official controls to prevent food poisoning associated with raw oyster consumption are based on the classification of their harvesting areas. Oysters examined in this study were harvested on the Canal de Mira, which is under threat of organic pollution and limited water renewal as it is a long narrow inlet of the seacoast, where freshwater from the Vouga River mixes with seawater from the Atlantic Ocean [3]. Therefore, the low rainfall and the increase in tourism during summer [36] are possible contributors to the rise of heterotrophic marine bacteria and Salmonella contamination in the farming water. Indeed, the higher prevalence of Salmonella in Portugal during the summer months [37] might help its spread into the aquatic environment. On the other hand, the detection of this pathogenic bacterial species during winter is most likely due to rainfall or surface runoff [38]. Enterococci and E. coli monitoring confirmed that this oyster farming area is exposed to fecal pollution, although the level of contamination was not as high as expected, considering that Canal de Mira is under anthropogenic pressure and receives treated/untreated sewage discharges [39].
Regardless of the sampling period, the edible portion of oysters showed compliance with the microbiological safety criteria set out in [16,17,33,34,35]. The level of E. coli contamination was clearly below the legal limit for E. coli contamination in oysters reared in a class B area (>230–≤4600 NMP E. coli/100 g). However, samples collected in the rainy seasons of autumn and winter showed the highest total microorganisms, Pseudomonas and C. perfringens contamination. In the spring, the bacterium C. perfringens was found below the detection level of 10 CFU/g, and the MPN of E. coli per 100 g of flesh was the lowest and only comparable to that obtained in the summer sampling. However, the biometric measurements during this study suggested that oysters should be harvested during the winter due to their greater growth during this season. Previous work [40] found that the summer months have a negative impact on oyster growth and their immunological parameters as the oysters are exposed to high temperatures and low food availability, recovering during the autumn and winter months.
Nevertheless, taking into account only the bacteriological assessment, oysters could be harvested at any time of the year, as the microorganisms of greatest concern (Salmonella spp. and L. monocytogenes) were not detected in any of the samples collected, and fecal indicator bacteria contamination levels were also low compared to those reported by other authors [7,41,42,43]. Furthermore, E. coli contamination levels were clearly below the European Union legal end product standard (230 MPN/100 g) [17] and enterococci, which are broadly recognized by their resistance to environmental stress [44], were not found (<10 UFC/g) in any flesh sample included in this study.
Despite having been proven that microbial colonization of oyster outer shell is shaped by the number and nature of microorganisms present in the farming water [45,46], neither Salmonella spp. nor enterococci were found, and E. coli was only found in the winter sample. Similarly, hemolymph analysis did not show contamination with the fecal bacteria that were detected in the farming water and the intra-valvular liquid.
As filter feeders, oysters developed a highly sophisticated innate immune system that is able to recognize and eliminate various microorganisms via an array of orchestrated immune reactions [47,48]. This “depuration capacity” has been previously reported in Anodonta cygnea for enterococci and E. coli [49], and also in C. gigas for Salmonella Newport [50]. Hemolymph is pivotal in oyster immune defense, and hemocytes are the main effector cell population, capable of selectively recognizing, adsorbing, internalizing, and inactivating non-symbiotic microorganisms [51,52]. Indeed, oysters’ hemolymph is not sterile, being a rich microbial environment (102–105 bacteria per g) composed mainly of organisms of the genera Vibrio, Pseudomonas, Aeromonas, and Alteroromas [51].
Analysis of the hemolymph by the FISH protocol revealed the presence of Vibrio spp., P. aeruginosa, and E. coli cells in 100%, 75%, and 25% of the samples, respectively, whereas the bacteriological method was unable to detect any colony-forming E. coli in hemolymph or pseudomonas in the flesh. These contrasting data were most likely due to the presence of viable but non-culturable (VBNC) bacterial cells, which are characterized by having a better fitness for survival under stressful conditions. In 2021, Wagley et al. [53] showed that V. parahaemolyticus VBNC cells could be resuscitated (100% revival) under favorable conditions.
In this study, we observed that the peak of Vibrio spp. cells on the surface of shells and intra-valvular liquid observed in summer was most likely the result of the proliferation of this genus with warmer water temperatures [6,54,55]. Metabarcoding analysis revealed high levels of Vibrio spp. in both the flesh and hemolymph during summer and autumn. Vibrio spp. plays an important role in oyster welfare, but also in public health, as it could be either an oyster pathogen, associated with mass summer mortalities of Crassostrea gigas or a zoonotic pathogen, including V. parahaemolyticus (the principal causes of seafood-borne disease linked to the consumption of shellfish) and V. vulnificus, which may cause serious wound infections [54,56,57]. Moreover, this study showed that hemolymph contained more Vibrio spp. compared to the edible content, which could be explained by the immunological function of hemolymph. Indeed, the overall microbiome of oysters displays a seasonal influence, also mentioned by Scannes et al. (2021) [58].
This is, to our knowledge, the first study that the occurrence of norovirus (NoV), hepatitis A virus (HAV), hepatitis E virus (HEV), and oyster herpesvirus type 1 (OsHV-1) in the Canal de Mira production area. NoV and HEV were both detected, but NoV was more frequent and the only one found simultaneously in the digestive gland and water samples collected during winter. According to Lowther et al. (2012) [43], this seasonality is typical in Europe and it might be explained by the convergence of several factors: the higher prevalence of noroviruses in the human population, the greater persistence of viral particles under winter environmental conditions (low temperature and low solar irradiation), and lower viral clearance in oysters due to the slowing of the metabolism. In the present investigation, HAV and OsHV-1 were not found in any of the samples analyzed. Since 2008, OSHV-1 has been causing epidemics with high mortality in C. gigas throughout Europe. To the best of our knowledge, OSHV-1 has only been detected in one sample of C. gigas harvested in Portugal, although the authors reported that this animal could have been imported from France.
Antimicrobial resistance remains a serious global health concern, being considered one of the most pressing global issues by the World Health Organization (2020) [59]. Paradoxically, wastewater treatment can favor the emergence and spreading of antimicrobial resistance (AMR) as resident bacterial communities are exposed to sub-inhibitory concentrations of antimicrobials (due to the elimination of these substances in the feces and urine of medicated individuals), favoring the transfer of genes between bacteria and their subsequent dissemination into aquatic environments [60,61]. The consequences of these events were found in this research, as evidenced by the isolation of both E. coli and Enterococcus spp. multidrug-resistant strains and the high frequency of resistance to important classes of antimicrobial drugs.

5. Conclusions

The present study was performed with a limited number of samples, which may result in a misestimation of prevalence. However, this is the first report assessing a wide range of microbiological parameters of oysters and their farming waters, combining genomics and classical plating methods to both commensal and microorganisms of great concern. In common with previous studies, the contrast between the results for the presence of E. coli and norovirus demonstrates the limitations of using E. coli to estimate and manage the risk of human enteric virus in oysters.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/microorganisms11020338/s1, Figure S1: (a) Total weight variation in grams; (b) total height variation in centimeters; (c) total length variation in centimeters; (d) total width variation in centimeters of oysters during each season; Table S1: Summary of the methodology used for bacteriologic analysis; Table S2: Summary of morphological parameters throughout the seasons.

Author Contributions

Conceptualization, P.M.d.C., M.S.J.N., Â.S.I. and I.C.R.; methodology, N.S.-F., Â.S.I., D.S. and C.C.d.S.; writing—original draft preparation, I.C.R., N.S.-F. and C.C.d.S.; writing—review and editing, P.M.d.C. and Â.S.I.; supervision, P.M.d.C. and M.S.J.N.; project administration, N.S.-F. and Â.S.I.; funding acquisition, P.M.d.C. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Structured R&D&I Project INNOVMAR–“Innovation and Sustainability in the Management and Exploitation of Marine Resources” (ref. NORTE-01-0145-FEDER-000035) within the research line “INSEAFOOD-Innovation and valorization of seafood products: meeting local challenges and opportunities”, founded by the Northern Regional Operational Programme (NORTE 2020) through the European Regional Development Fund (ERDF); and funded by the project OCEAN3R (NORTE-01-0145-FEDER-000064), supported by the North Portugal Regional Operational Program (NORTE2020), under the PORTUGAL 2020 Partnership Agreement and through the European Regional Development Fund (ERDF).

Data Availability Statement

The original contributions presented in the study are included in the article. Further enquiries can be directed to the corresponding author.

Acknowledgments

The authors would like to acknowledge Francisco Arenas’ group for the oyster collection and Jesus L. Romalde, João Rodrigo Mesquita, Elizabete Lopes, and Joana Freitas da Silva for comments and assistance. The authors also acknowledge the support and the valuable contributions added by Diana Resende in the scope of “Siderophore efflux pump inhibitors (SEPIs) conjugates: A new concept for environmental problems” project, with the reference EXPL/CTA-AMB/0810/2021.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Botta, R.; Asche, F.; Borsum, J.S.; Camp, E.V. A review of global oyster aquaculture production and consumption. Mar. Policy 2020, 117, 103952. [Google Scholar] [CrossRef]
  2. Naylor, R.L.; Hardy, R.W.; Buschmann, A.H.; Bush, S.R.; Cao, L.; Klinger, D.H.; Little, D.C.; Lubchenco, J.; Shumway, S.E.; Troell, M. A 20-year retrospective review of global aquaculture. Nature 2021, 591, 551–563. [Google Scholar] [CrossRef] [PubMed]
  3. Gadelha, J.R.; Rocha, A.C.; Camacho, C.; Eljarrat, E.; Peris, A.; Aminot, Y.; Readman, J.W.; Boti, V.; Nannou, C.; Kapsi, M.; et al. Persistent and emerging pollutants assessment on aquaculture oysters (Crassostrea gigas) from NW Portuguese coast (Ria De Aveiro). Sci. Total Environ. 2019, 666, 731–742. [Google Scholar] [CrossRef]
  4. Silva, A.I.M.; Vieira, R.H.S.F.; Menezes, F.G.R.; Fonteles-Filho, A.A.; Torres, R.C.O.; Sant’Anna, E.S. Bacteria of fecal origin in mangrove oysters (Crassostrea rhizophorae) in the Cocó river estuary, Ceará State, Brazil. Braz. J. Microbiol. 2004, 35, 126–130. [Google Scholar] [CrossRef] [Green Version]
  5. Fiorito, F.; Di Concilio, D.; Lambiase, S.; Amoroso, M.G.; Langellotti, A.L.; Martello, A.; Esposito, M.; Galiero, G.; Fusco, G. Oyster Crassostrea gigas, a good model for correlating viral and chemical contamination in the marine environment. Mar. Pollut. Bull. 2021, 172, 112825. [Google Scholar] [CrossRef]
  6. Depaola, A. Managing vibrio risk in oysters. Food Prot. Trends 2019, 39, 338–347. [Google Scholar]
  7. Giusti, A.; Costa, E.; Traina, A.; Nucera, D.; Serratore, P.; Orlandi, M.; Armani, A. Analysis of the sanitary survey 2015-2017 conducted in the gulf of La Spezia (Italy): Reclassification of the areas of production of live bivalve molluscs. Ital. J. Food Saf. 2020, 9, 8448. [Google Scholar] [CrossRef] [PubMed]
  8. EFSA The European Union One Health 2021 Zoonoses Report. EFSA J. 2022, 19, e06971. [CrossRef]
  9. Potasman, I.; Paz, A.; Odeh, M. Infectious outbreaks associated with bivalve shellfish consumption: A worldwide perspective. Clin. Infect. Dis. 2002, 35, 921–928. [Google Scholar] [CrossRef] [Green Version]
  10. Wier, M.; Rajic, A.; Dutil, L.; Uhland, C.; Bruneau, N. Zoonotic bacteria and antimicrobial resistance in aquaculture: Opportunities for surveillance in Canada. Special Report. Can. Vet. J. 2012, 50, 1153–1161. [Google Scholar]
  11. Balière, C.; Rincé, A.; Blanco, J.; Dahbi, G.; Harel, J.; Vogeleer, P.; Giard, J.C.; Mariani-Kurkdjian, P.; Gourmelon, M. Prevalence and characterization of Shiga toxin-producing and enteropathogenic Escherichia coli in shellfish-harvesting areas and their watersheds. Front. Microbiol. 2015, 6, 1356. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  12. Rivadulla, E.; Varela, M.F.; Mesquita, J.R.; Nascimento, M.S.J.; Romalde, J.L. Detection of hepatitis E virus in shellfish harvesting areas from galicia (Northwestern Spain). Viruses 2019, 11, 618. [Google Scholar] [CrossRef]
  13. FAO; WHO. Technical Guidance for the Development of the Growing Area Aspects of Bivalve Mollusc Sanitation Programmes, 2nd ed.; FAO: Rome, Italy, 2021; ISBN 9789251345917. [Google Scholar]
  14. European Commission. Regulation (EC) No 178/2002 of 28 January 2002 laying down the general principles and requirements of food law, establishing the European Food Safety Authority and laying down procedures in matters of food safety. Off. J. Eur. Communities 2002, L 31, 1–24. [Google Scholar]
  15. European Commission. Regulation (EC) No 852/2004 of the European Parliament and of the council of 29 April 2004 laying down on the hygiene of foodstuffs. Off. J. Eur. Union 2004, L 139, 1463–1466. [Google Scholar]
  16. European Commission. Regulation (EC) No 853/2004 of the European Parlamient and of the Council of 29 April 2004 laying down specific hygiene rules for on the hygiene of foodstuffs. Off. J. Eur. Union 2004, L 139, 55. [Google Scholar]
  17. European Commission. Commission Regulation (EC) No 2073/2005 of 15 November 2005 on microbiological criteria for foodstuffs. Off. J. Eur. Union 2005, L 338, 1. [Google Scholar]
  18. Burge, C.A.; Closek, C.J.; Friedman, C.S.; Groner, M.L.; Jenkins, C.M.; Shore-Maggio, A.; Welsh, J.E. The Use of Filter-feeders to Manage Disease in a Changing World. Integr. Comp. Biol. 2016, 56, 573–587. [Google Scholar] [CrossRef] [Green Version]
  19. Defer, D.; Desriac, F.; Henry, J.; Bourgougnon, N.; Baudy-Floc’h, M.; Brillet, B.; Le Chevalier, P.; Fleury, Y. Antimicrobial peptides in oyster hemolymph: The bacterial connection. Fish Shellfish Immunol. 2013, 34, 1439–1447. [Google Scholar] [CrossRef] [Green Version]
  20. Yeh, H.; Skubel, S.A.; Patel, H.; Cai Shi, D.; Bushek, D.; Chikindas, M.L. From Farm to Fingers: An Exploration of Probiotics for Oysters, from Production to Human Consumption. Probiotics Antimicrob. Proteins 2020, 12, 351–364. [Google Scholar] [CrossRef]
  21. Weissberger, E.J.; Glibert, P.M. Diet of the eastern oyster, Crassostrea virginica, growing in a eutrophic tributary of Chesapeake Bay, Maryland, USA. Aquac. Rep. 2021, 20, 100655. [Google Scholar] [CrossRef]
  22. Lefebvre, S.; Barillé, L.; Clerc, M. Pacific oyster (Crassostrea gigas) feeding responses to a fish-farm effluent. Aquaculture 2000, 187, 185–198. [Google Scholar] [CrossRef]
  23. Guerrero-Meseguer, L.; Veiga, P.; Sampaio, L.; Rubal, M. Sediment characteristics determine the flowering effort of Zostera noltei meadows inhabiting a human-dominated lagoon. Plants 2021, 10, 1387. [Google Scholar] [CrossRef]
  24. Oliveira, M.; Serrano, I.; Van Harten, S.; Bessa, L.J.; Bernardo, F.; da Costa, P.M. Fecal contamination of wastewater treatment plants in Portugal. Environ. Sci. Pollut. Res. 2016, 23, 14671–14675. [Google Scholar] [CrossRef]
  25. Eilers, H.; Pernthaler, J.; Glöckner, F.O.; Amann, R. Culturability and in situ abundance of pelagic Bacteria from the North Sea. Appl. Environ. Microbiol. 2000, 66, 3044–3051. [Google Scholar] [CrossRef] [Green Version]
  26. Fuchs, B.M.; Wallner, G.; Beisker, W.; Schwippl, I.; Ludwig, W.; Amann, R. Flow cytometric analysis of the in situ accessibility of Escherichia coli 16S rRNA for fluorescently labeled oligonucleotide probes. Appl. Environ. Microbiol. 1998, 64, 4973–4982. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  27. Hogardt, M.; Trebesius, K.; Geiger, A.M.; Hornef, M.; Rosenecker, J.; Heesemann, J. Specific and rapid detection by fluorescent in situ hybridization of bacteria in clinical samples obtained from cystic fibrosis patients. J. Clin. Microbiol. 2000, 38, 818–825. [Google Scholar] [CrossRef]
  28. Magiorakos, A.-P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, C.G.; Harbarth, S.; Hindler, J.F.; Kahlmeter, G.; Olsson-Liljequist, B.; et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef] [Green Version]
  29. Santos-Ferreira, N.; Mesquita, J.R.; Rivadulla, E.; Inácio, Â.S.; Nascimento, M.S.J.; Romalde, J.; Martins da Costa, P. Norovirus contamination of sea urchins (Paracentrotus lividus): Potential food risk for consumers. Food Control 2020, 111, 107041. [Google Scholar] [CrossRef]
  30. Santos-Ferreira, N.; Mesquita, J.R.; Rivadulla, E.; Inácio, Â.S.; Martins da Costa, P.; Romalde, J.L.; Nascimento, M.S.J. Hepatitis E virus genotype 3 in echinoderms: First report of sea urchin (Paracentrotus lividus) contamination. Food Microbiol. 2020, 89, 103415. [Google Scholar] [CrossRef]
  31. Jothikumar, N.; Cromeans, T.L.; Robertson, B.H.; Meng, X.J.; Hill, V.R. A broadly reactive one-step real-time RT-PCR assay for rapid and sensitive detection of hepatitis E virus. J. Virol. Methods 2006, 131, 65–71. [Google Scholar] [CrossRef]
  32. Martenot, C.; Oden, E.; Travaillé, E.; Malas, J.P.; Houssin, M. Comparison of two real-time PCR methods for detection of ostreid herpesvirus 1 in the Pacific oyster Crassostrea gigas. J. Virol. Methods 2010, 170, 86–89. [Google Scholar] [CrossRef]
  33. Centre for Food Safety. Microbiological Guidelines for Food; Centre for Food Safety: Hong Kong, China, 2014; pp. 1–38. Available online: https://www.cfs.gov.hk/english/food_leg/files/food_leg_Microbiological_Guidelines_for_Food_e.pdf (accessed on 31 May 2017).
  34. FSANZ. Compendium of Microbiological Criteria for Food. 2016. Available online: www.foodstandards.govt.nz (accessed on 31 May 2017).
  35. Food Standards Australia New Zealand. Microbiological Limits in Food, Federal Register of Legislative Instruments, 2016; Food Standards Australia New Zealand: Canberra, Australia, 2016; pp. 2–4. Available online: https://dairy-safe.com.au/wp-content/uploads/Microbiological-Limits-in-Food.pdf (accessed on 1 September 2022).
  36. Freitas, R.O.; Fraga, M. Relatório Sanitário Para Zonas De Produção De Moluscos Bivalves: Ria De Aveiro; IPMA: Lisbon, Portugal, 2020; 76p. Available online: https://www.ipma.pt/pt/bivalves/docs/files/rspzmb_Ria_de_Aveiro_Ed01_aprovado_CD.pdf (accessed on 1 September 2022).
  37. Seixas, R.; Nunes, T.; Machado, J.; Tavares, L.; Owen, S.P.; Bernardo, F.; Oliveira, M. Demographic characterization and spatial cluster analysis of human Salmonella 1,4,[5],12:i:- infections in Portugal: A 10 year study. J. Infect. Public Health 2018, 11, 178–182. [Google Scholar] [CrossRef]
  38. Liu, H.; Whitehouse, C.A.; Li, B. Presence and Persistence of Salmonella in Water: The Impact on Microbial Quality of Water and Food Safety. Front. Public Health 2018, 6, 159. [Google Scholar] [CrossRef] [PubMed]
  39. Rada, J.P.A.; Duarte, A.C.; Pato, P.; Cachada, A.; Carreira, R.S. Sewage contamination of sediments from two Portuguese Atlantic coastal systems, revealed by fecal sterols. Mar. Pollut. Bull. 2016, 103, 319–324. [Google Scholar] [CrossRef]
  40. Mosca, F.; Tiscar, P.G.; Hattab, J.; D’Antonuo, A.M.; D’Onofrio, D.; Arcangeli, G.; Vetri, A.; Bertolini, C.; Pastres, R. Crassostrea gigas (Thunberg 1793) cultivation in southern Adriatic Sea (Italy): A one-year monitoring study of the oyster health. Aquac. Res. 2021, 52, 2879–2890. [Google Scholar] [CrossRef]
  41. Chinnadurai, S.; Elavarasan, K.; Geethalakshmi, V.; Kripa, V.; Mohamed, K.S. Evaluation of static and flow-through depuration system on depuration of naturally contaminated farmed edible oyster Crassostrea madrasensis (Preston, 1916). Aquaculture 2021, 545, 737141. [Google Scholar] [CrossRef]
  42. Strubbia, S.; Lyons, B.P.; Lee, R.J. Geographical and temporal variation of E. coli and norovirus in mussels. Mar. Pollut. Bull. 2016, 107, 66–70. [Google Scholar] [CrossRef]
  43. Lowther, J.A.; Gustar, N.E.; Powell, A.L.; Hartnell, R.E.; Lees, D.N. Two-year systematic study to assess norovirus contamination in oysters from commercial harvesting areas in the United Kingdom. Appl. Environ. Microbiol. 2012, 78, 5812–5817. [Google Scholar] [CrossRef] [Green Version]
  44. Byappanahalli, M.N.; Nevers, M.B.; Korajkic, A.; Staley, Z.R.; Harwood, V.J. Enterococci in the Environment. Microbiol. Mol. Biol. Rev. 2012, 76, 685–706. [Google Scholar] [CrossRef] [Green Version]
  45. Guo, K.; Freguia, S.; Dennis, P.G.; Chen, X.; Donose, B.C.; Keller, J.; Gooding, J.J.; Rabaey, K. Effects of surface charge and hydrophobicity on anodic biofilm formation, community composition, and current generation in bioelectrochemical systems. Environ. Sci. Technol. 2013, 47, 7563–7570. [Google Scholar] [CrossRef]
  46. Mizan, M.F.R.; Jahid, I.K.; Ha, S. Do Microbial biofilms in seafood: A food-hygiene challenge. Food Microbiol. 2015, 49, 41–55. [Google Scholar] [CrossRef] [PubMed]
  47. Bachère, E.; Rosa, R.D.; Schmitt, P.; Poirier, A.C.; Merou, N.; Charrière, G.M.; Destoumieux-Garzón, D. The new insights into the oyster antimicrobial defense: Cellular, molecular and genetic view. Fish Shellfish Immunol. 2015, 46, 50–64. [Google Scholar] [CrossRef] [Green Version]
  48. Wang, L.; Song, X.; Song, L. The oyster immunity. Dev. Comp. Immunol. 2018, 80, 99–118. [Google Scholar] [CrossRef] [PubMed]
  49. Antunes, F.; Hinzmann, M.; Lopes-Lima, M.; Machado, J.; da Costa, P.M. Association Between Environmental Microbiota and Indigenous Bacteria Found in Hemolymph, Extrapallial Fluid and Mucus of Anodonta cygnea (Linnaeus, 1758). Microb. Ecol. 2010, 60, 304–309. [Google Scholar] [CrossRef] [PubMed]
  50. Morrison, C.M.; Armstrong, A.E.; Evans, S.; Mild, R.M.; Langdon, C.J.; Joens, L.A. Survival of Salmonella Newport in oysters. Int. J. Food Microbiol. 2011, 148, 93–98. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  51. King, W.L.; Jenkins, C.; Seymour, J.R.; Labbate, M. Oyster disease in a changing environment: Decrypting the link between pathogen, microbiome and environment. Mar. Environ. Res. 2019, 143, 124–140. [Google Scholar] [CrossRef]
  52. Mao, F.; Mu, H.; Wong, N.K.; Liu, K.; Song, J.; Qiu, J.; Lin, Y.; Zhang, X.; Xu, D.; Xiang, Z.; et al. Hemocyte phagosomal proteome is dynamically shaped by cytoskeleton remodeling and interorganellar communication with endoplasmic reticulum during phagocytosis in a marine invertebrate, Crassostrea gigas. Sci. Rep. 2020, 10, 6577. [Google Scholar] [CrossRef] [Green Version]
  53. Wagley, S.; Morcrette, H.; Kovacs-Simon, A.; Yang, Z.R.; Power, A.; Tennant, R.K.; Love, J.; Murray, N.; Titball, R.W.; Butler, C.S. Bacterial dormancy: A subpopulation of viable but non-culturable cells demonstrates better fitness for revival. PLoS Pathog. 2021, 17, e1009194. [Google Scholar] [CrossRef]
  54. Mohamad, N.; Amal, M.N.A.; Yasin, I.S.M.; Zamri Saad, M.; Nasruddin, N.S.; Al-saari, N.; Mino, S.; Sawabe, T. Vibriosis in cultured marine fishes: A review. Aquaculture 2019, 512, 734289. [Google Scholar] [CrossRef]
  55. Mok, J.S.; Ryu, A.; Kwon, J.Y.; Kim, B.; Park, K. Distribution of Vibrio species isolated from bivalves and bivalve culture environments along the Gyeongnam coast in Korea: Virulence and antimicrobial resistance of Vibrio parahaemolyticus isolates. Food Control 2019, 106, 106697. [Google Scholar] [CrossRef]
  56. Wang, H.; Yang, B.; Li, X.; Li, Q.; Liu, S. Screening of bacterial pathogens associated with mass summer mortality of the Pacific oyster, Crassostrea gigas, in China. Aquac. Rep. 2021, 20, 100672. [Google Scholar] [CrossRef]
  57. Janda, J.M. Clinical Decisions: Detecting Vibriosis in the Modern Era. Clin. Microbiol. Newsl. 2020, 42, 45–50. [Google Scholar] [CrossRef]
  58. Scanes, E.; Parker, L.M.; Seymour, J.R.; Siboni, N.; King, W.L.; Danckert, N.P.; Wegner, K.M.; Dove, M.C.; O’Connor, W.A.; Ross, P.M. Climate change alters the haemolymph microbiome of oysters. Mar. Pollut. Bull. 2021, 164, 111991. [Google Scholar] [CrossRef]
  59. WHO. Antimicrobial Resistance. Available online: https://www.who.int/news-room/fact-sheets/detail/antimicrobial-resistance (accessed on 13 November 2022).
  60. Hayward, J.L.; Huang, Y.; Hansen, L.T.; Yost, C.K.; Lake, C.; Jamieson, R.C. Fate and distribution of determinants of antimicrobial resistance in lateral flow sand filters used for treatment of domestic wastewater. Sci. Total Environ. 2021, 767, 145481. [Google Scholar] [CrossRef] [PubMed]
  61. Le Quesne, W.J.F.; Baker-Austin, C.; Verner-Jeffreys, D.W.; Al-Sarawi, H.A.; Balkhy, H.H.; Lyons, B.P. Antimicrobial resistance in the Gulf Cooperation Council region: A proposed framework to assess threats, impacts and mitigation measures associated with AMR in the marine and aquatic environment. Environ. Int. 2018, 121, 1003–1010. [Google Scholar] [CrossRef]
Figure 1. Schematic figure representing the Canal de Mira arm of Ria de Aveiro. This channel is an elongated and shallow arm, 25 km long, that runs south-southwest, parallel to the west Portuguese coastline.
Figure 1. Schematic figure representing the Canal de Mira arm of Ria de Aveiro. This channel is an elongated and shallow arm, 25 km long, that runs south-southwest, parallel to the west Portuguese coastline.
Microorganisms 11 00338 g001
Figure 2. Experimental diagram. OsHV-1: oyster herpes virus; HAV: hepatitis A virus; HEV: hepatitis E virus; FISH: fluorescence in situ hybridization.
Figure 2. Experimental diagram. OsHV-1: oyster herpes virus; HAV: hepatitis A virus; HEV: hepatitis E virus; FISH: fluorescence in situ hybridization.
Microorganisms 11 00338 g002
Figure 3. Percentage of resistance in E. coli isolated from the farming water and the edible portion of oysters. AMC: amoxicillin/clavulanic acid, AMK: amikacin, AMP: ampicillin, ATM: aztreonam, CAZ: ceftazidime, CEF: cephalothin CHL: chloramphenicol, CIP: ciprofloxacin, CTX: cefotaxime, DOX: doxycycline, FOX: cefoxitin, GEN: gentamicin, IPM: imipenem, NAL: nalidixic acid, NIT: nitrofurantoin, STR: streptomycin, SXT: sulfamethoxazole/trimethoprim, TET: tetracycline, TOB: tobramycin.
Figure 3. Percentage of resistance in E. coli isolated from the farming water and the edible portion of oysters. AMC: amoxicillin/clavulanic acid, AMK: amikacin, AMP: ampicillin, ATM: aztreonam, CAZ: ceftazidime, CEF: cephalothin CHL: chloramphenicol, CIP: ciprofloxacin, CTX: cefotaxime, DOX: doxycycline, FOX: cefoxitin, GEN: gentamicin, IPM: imipenem, NAL: nalidixic acid, NIT: nitrofurantoin, STR: streptomycin, SXT: sulfamethoxazole/trimethoprim, TET: tetracycline, TOB: tobramycin.
Microorganisms 11 00338 g003
Figure 4. Percentage of resistance in Enterococcus spp. isolated from the farming water and the edible portion of oysters. AMP: ampicillin, CHL: chloramphenicol, CIP: ciprofloxacin, DOX: doxycycline, ERY: erythromycin, FOF: fosfomycin, GEN: gentamicin, LZD: linezolid, NIT: nitrofurantoin, PEN: penicillin, QD: quinupristin-dalfopristin, RIF: rifampicin, TEC: teicoplanin, TET: tetracycline, VAN: vancomycin.
Figure 4. Percentage of resistance in Enterococcus spp. isolated from the farming water and the edible portion of oysters. AMP: ampicillin, CHL: chloramphenicol, CIP: ciprofloxacin, DOX: doxycycline, ERY: erythromycin, FOF: fosfomycin, GEN: gentamicin, LZD: linezolid, NIT: nitrofurantoin, PEN: penicillin, QD: quinupristin-dalfopristin, RIF: rifampicin, TEC: teicoplanin, TET: tetracycline, VAN: vancomycin.
Microorganisms 11 00338 g004
Figure 5. Genus distribution of microbiome of oysters. O4H: hemolymph in spring; O4C: edible portion in spring; O3C: edible portion in winter; O2H: hemolymph in autumn; O2C: edible portion in autumn; O1C: edible portion in summer.
Figure 5. Genus distribution of microbiome of oysters. O4H: hemolymph in spring; O4C: edible portion in spring; O3C: edible portion in winter; O2H: hemolymph in autumn; O2C: edible portion in autumn; O1C: edible portion in summer.
Microorganisms 11 00338 g005
Table 1. Antimicrobial agents used to evaluate the resistance profile of E. coli and Enterococcus spp. isolated from farming water, edible portion, hemolymph, and superficial biofilm samples.
Table 1. Antimicrobial agents used to evaluate the resistance profile of E. coli and Enterococcus spp. isolated from farming water, edible portion, hemolymph, and superficial biofilm samples.
MicroorganismAntimicrobial AgentAcronymDisc Content (μg)
E. coliAmoxicillin/clavulanic acidAMC30
AmikacinAMK30
AmpicillinAMP10
AztreonamATM30
ChloramphenicolCHL30
CephalothinCEF30
CefoxitinFOX30
CefotaximeCTX30
CeftazidimeCAZ30
CiprofloxacinCIP5
DoxycyclineDOX30
GentamicinGEN10
ImipenemIMP10
Nalidixic acidNAL30
StreptomycinSTR10
Sulfamethoxazole/trimethoprimSXT25
TetracyclineTET30
TobramycinTOB10
Enterococcus spp.AmpicillinAMP10
ChloramphenicolCHL30
CiprofloxacinCIP5
DoxycyclineDOX30
ErythromycinERY15
FosfomycinFOF200
GentamicinGEN10
NitrofurantoinNIT300
PenicillinPEN10
Quinupristin-dalfopristinQ-D15
RifampicinRIF5
TeicoplaninTEC30
TetracyclineTET30
VancomycinVAN30
LinezolidLZD30
Table 2. Microbiological analysis of farming waters, edible portions (flesh, hemolymph, and intra-valvular liquid), superficial biofilm, intra-valvular liquid, and hemolymph during all seasons, using classic methods.
Table 2. Microbiological analysis of farming waters, edible portions (flesh, hemolymph, and intra-valvular liquid), superficial biofilm, intra-valvular liquid, and hemolymph during all seasons, using classic methods.
MicroorganismsSamples
SummerAutumnWinterSpring
Farming water (CFU/100 mL)Total microorganisms22 °C2.3 × 1032.0 × 1041.5 × 1031.1 × 103
37 °C2.8 × 1032.5 × 1038.0 × 1022.0 × 102
Marine heterotrophic bacteria1.5 × 1043.6 × 1032.3 × 1033.2 × 103
E. coli3.8 × 1001.8 × 1016.0 × 1001.0 × 100
Salmonella spp.Present in 1LAbsence in 1LPresent in 1LAbsence in 1L
Enterococcus spp.3.09.2 × 1012.0<1
Edible portionTotal microorganisms (CFU/g)30 °C4.4 × 102 (S B)1.2 × 103 (S B)1.2 × 103 (S B)1.3 × 102 (S B)
7 °C2.5 × 102 (S B)6.0 × 102 (S B)8.2 × 102 (S B)1.1 × 102 (S B)
Marine heterotrophic bacteria (CFU/g)9.0 × 1031.6 × 1043.8 × 1045.9 × 104
E. coli (MPN)/100 g)20.0 (S A)36.0 (S A)92.0 (S A)20.0 (S A)
Pseudomonas spp. (CFU/g)<100<100<100<100
Salmonella spp.Absence in 25 g (S A)Absence in 25 g (S A)Absence in 25 g (S A)Absence in 25 g (S A)
Clostridium perfringens (CFU/g)<10 (S B)2.0 × 101 (U B)3.0 × 101 (U B)<10 (S B)
coagulase + Staphylococcus (CFU/g)<100 (S C)<100 (S C)<100 (S C)<100 (S C)
Enterococcus spp. (CFU/g)<10<10<10<10
Listeria monocytogenesAbsence in 25 g S BAbsence in 25 g S BAbsence in 25 g S BAbsence in 25 g S B
Molds (CFU/g)<25 S B<25 S B5.0 × 101 S B1.0 × 102 S B
Yeasts (CFU/g)<25 S B5.0 × 101 S B<25 S B5.0 × 101 S B
Intra-valvular liquid (CFU/mL)Total aerobic microorganisms at 30 °C2.4 × 1042.0 × 1043.8 × 1026.0 × 102
Marine heterotrophic bacteria3.1 × 1052.3 × 1025.1 × 1034.6 × 104
E. coli6.7 × 102<1<1<1
Enterococcus spp.<1<15.0<1
Superficial biofilm (CFU/g)Total aerobic microorganisms at 30 °C3.6 × 1042.1 × 1052.6 × 1034.5 × 103
Marine heterotrophic bacteria1.5 × 1062.7 × 1034.9 × 1045.1 × 105
E. coli<0.1<0.11.1<0.1
Enterococcus spp.9.2 × 10−1<0.11.97.3 × 10−1
Hemolymph (CFU/mL)Total aerobic microorganisms at 30 °C2.0 × 1037.6 × 1034.3 × 1031.4 × 102
Marine heterotrophic bacteria3.3 × 1051.6 × 102.0 × 1023.5 × 105
E. coli<1<1<1<1
Enterococcus spp.<1<1<1<1
S A: Satisfactory according to [17]; S B/U B: Satisfactory/Unsatisfactory according to [33,34]; S C: Satisfactory according to [35]. CFU: colony-forming unit, MPN: most probable number.
Table 3. Bacterial quantification using the FISH method on superficial biofilm, intra-valvular liquid, and hemolymph in four seasonal sampling surveys.
Table 3. Bacterial quantification using the FISH method on superficial biofilm, intra-valvular liquid, and hemolymph in four seasonal sampling surveys.
MicroorganismSampleSummerAutumnWinterSpring
P. aeruginosaSuperficial biofilm5.0 × 1029.0 × 1021.5 × 1031.3 × 103
Intra-valvular liquid5.0 × 1021.3 × 1064.3 × 1038.0 × 102
Hemolymph2.0 × 1026.0 × 1026.8 × 103<100
Vibrio spp.Superficial biofilm3.9 × 1075.0 × 1024.0 × 1021.0 × 103
Intra-valvular liquid2.3 × 1073.4 × 1037.0 × 1022.2 × 104
Hemolymph5.0 × 1064.6 × 1062.3 × 1036.8 × 106
E. coliSuperficial biofilm5.0 × 102<1002.0 × 1026.0 × 102
Intra-valvular liquid1.3 × 107<100<100<100
Hemolymph3.2 × 107<100<100<100
Data are expressed as cells/mL (intra-valvular liquid and hemolymph) and as cells/g (superficial biofilm).
Table 4. Resistance patterns in E. coli MDR strains isolated from the farming waters, edible portions, and superficial biofilm samples.
Table 4. Resistance patterns in E. coli MDR strains isolated from the farming waters, edible portions, and superficial biofilm samples.
IsolateSeasonSampleResistance Profile
1SummerWaterAMP R CEF I CIP R DOX I NAL R STR R SXT R TET R
2AutumnWaterATM R CEF R STR I
3AutumnEdible portionAMC R AMP R CEF R STR I TET I
4WinterEdible portionCEF R NAL I STR I
5WinterEdible portionCEF R GEN R NAL R STR I TET R
6WinterEdible portionAMC R AMP R CEF R FOX R NAL R
7WinterSuperficial biofilmAMC R AMP R FOX R
8WinterWaterAMC I AMP R CHL R CIP R CEF R DOX R GEN R NAL I STR R SXT R TET R TOB R
9WinterWaterAMK I AMP R CEF I NAL R STR I
10WinterWaterCEF R DOX R STR I TET R
11WinterWaterDOX R NAL R STR R TET R
AMC: amoxicillin/clavulanic acid, AMP: ampicillin, CEF: cephalothin, CHL: chloramphenicol, CIP: ciprofloxacin, DOX: doxycycline, FOX: cefoxitin, GEN: gentamicin, NAL: nalidixic acid, STR: streptomycin, TET: tetracycline, TOB: tobramycin, SXT: sulfamethoxazole/trimethoprim, R: resistant, I: intermediate.
Table 5. Resistance patterns in Enterococcus spp. MDR strains isolated from the farming water, edible portion, and superficial biofilm samples.
Table 5. Resistance patterns in Enterococcus spp. MDR strains isolated from the farming water, edible portion, and superficial biofilm samples.
IsolateSeasonSampleResistance Profile
1SummerWaterCIP I DOX I ERY I RIF I TET I
2AutumnWaterCIP I Q-D R TET R
3AutumnWaterDOX R ERY I FOF I LZD R Q-D I RIF R TET I
4AutumnWaterAMP R CIP I LZD I
5WinterWaterCIP I ERY I LZD I Q-D R RIF R
6WinterWaterAMP R CIP I ERY I RIF R
7WinterSuperficial biofilmCIP I LZD R TET I
AMP: ampicillin, CIP: ciprofloxacin, DOX: doxycycline, ERY: erythromycin, FOF: fosfomicine, LZD: linezolide, Q-D: quinupristin-dalfopristin, RIF: rifampicin, TET: tetracycline, R: resistant, I: intermediate.
Table 6. Detection of norovirus (NoV) hepatitis A virus (HAV), hepatitis E virus (HEV), and oyster herpesvirus type 1 (OsHV-1) in sampled matrix.
Table 6. Detection of norovirus (NoV) hepatitis A virus (HAV), hepatitis E virus (HEV), and oyster herpesvirus type 1 (OsHV-1) in sampled matrix.
SeasonSampleNoVHAVHEVOsHV-1
SummerDigestive glandNDNDNDNA
WaterNANANANA
Edible portionNANANAND
AutumnDigestive glandDetectedNDNDNA
WaterNDNDNDNA
Edible portionNANANAND
WinterDigestive glandDetectedNDNDNA
WaterNDNDNDNA
Edible portionNANANAND
SpringDigestive glandDetectedNDNDNA
WaterDetectedNDDetectedNA
Edible portionNANANAND
ND: Not Detected, NA: Not Applicable.
Table 7. Genus composition (in percentage) of edible portion and hemolymph during all seasons.
Table 7. Genus composition (in percentage) of edible portion and hemolymph during all seasons.
GenusO1CO2CO2HO3CO4CO4H
Vibrio43.2%74.2%77.6%1.3%12.5%18.0%
Clostridium0.1%0.1%0.4%1.8%0.0%0.0%
Psychrilyobacter29.3%1.0%1.2%2.6%9.7%41.3%
Polynucleobacter0.1%0.7%0.3%11.0%23.6%0.3%
Prolixibacter16%0.1%1.1%0.0%0.0%26.2%
Desulfobacter0.5%1.0%3.3%0.9%4.2%0.5%
Arcobacter0.4%2.4%0.0%1.8%2.8%1.3%
O1C: edible portion in summer, O2C: edible portion in autumn, O2H: hemolymph in autumn, O3C: edible portion in winter, O4C: edible portion in spring, O4H: hemolymph in spring.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Rodrigues, I.C.; Santos-Ferreira, N.; Silva, D.; da Silva, C.C.; Inácio, Â.S.; Nascimento, M.S.J.; da Costa, P.M. A One-Year Systematic Study to Assess the Microbiological Profile in Oysters from a Commercial Harvesting Area in Portugal. Microorganisms 2023, 11, 338. https://doi.org/10.3390/microorganisms11020338

AMA Style

Rodrigues IC, Santos-Ferreira N, Silva D, da Silva CC, Inácio ÂS, Nascimento MSJ, da Costa PM. A One-Year Systematic Study to Assess the Microbiological Profile in Oysters from a Commercial Harvesting Area in Portugal. Microorganisms. 2023; 11(2):338. https://doi.org/10.3390/microorganisms11020338

Chicago/Turabian Style

Rodrigues, Inês C., Nânci Santos-Ferreira, Daniela Silva, Carla Chiquelho da Silva, Ângela S. Inácio, Maria São José Nascimento, and Paulo Martins da Costa. 2023. "A One-Year Systematic Study to Assess the Microbiological Profile in Oysters from a Commercial Harvesting Area in Portugal" Microorganisms 11, no. 2: 338. https://doi.org/10.3390/microorganisms11020338

APA Style

Rodrigues, I. C., Santos-Ferreira, N., Silva, D., da Silva, C. C., Inácio, Â. S., Nascimento, M. S. J., & da Costa, P. M. (2023). A One-Year Systematic Study to Assess the Microbiological Profile in Oysters from a Commercial Harvesting Area in Portugal. Microorganisms, 11(2), 338. https://doi.org/10.3390/microorganisms11020338

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop