Enterotoxigenic and Antimicrobic Susceptibility Profile of Staphylococcus aureus Isolates from Fresh Cheese in Croatia
Abstract
1. Introduction
2. Materials and Methods
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Nia, Y.; Mutel, I.; Assere, A.; Lombard, B.; Auvray, F.; Hennekinne, J.-A. Review Over a 3-Year Period of European Union Proficiency Tests for Detection of Staphylococcal Enterotoxins in Food Matrices. Toxins 2016, 8, 107. [Google Scholar] [CrossRef] [PubMed]
- Rajkovic, A.; Jovanovic, J.; Monteiro, S.; Decleer, M.; Andjelkovic, M.; Foubert, A.; Beloglazova, N.; Tsilla, V.; Sas, B.; Madder, A.; et al. Detection of toxins involved in foodborne diseases caused by Gram-positive bacteria. Compr. Rev. Food Sci. Food Saf. 2020, 19, 1605–1657. [Google Scholar] [CrossRef] [PubMed]
- De Buyser, M.-L.; Dufour, B.; Maire, M.; Lafarge, V. Implication of milk and milk products in food-borne diseases in France and in different industrialised countries. Int. J. Food Microbiol. 2001, 67, 1–17. [Google Scholar] [CrossRef] [PubMed]
- Delmas, G.; Gallay, A.; Espié, E.; Haeghebaert, S.; Pihier, N.; Weill, F.X.; De Valk, H.; Vaillant, V.; Desenclos, J.C. Les toxi-infections alimentaires collectives en France entre 1996 et 2005. Bull. Epidemiol. Hebd. 2006, 51–52, 418–422. [Google Scholar]
- Gajewska, J.; Zakrzewski, A.; Chajęcka-Wierzchowska, W.; Zadernowska, A. Meta-analysis of the global occurrence of S. aureus in raw cattle milk and artisanal cheeses. Food Control 2023, 147, 109603. [Google Scholar] [CrossRef]
- Cenci-Goga, B.T.; Karama, M.; Rossitto, P.V.; Morgante, R.A.; Cullor, J.S. Enterotoxin Production by Staphylococcus aureus Isolated from Mastitic Cows. J. Food Prot. 2003, 66, 1693–1696. [Google Scholar] [CrossRef] [PubMed]
- Grispoldi, L.; Karama, M.; Armani, A.; Hadjicharalambous, C.; Cenci-Goga, B.T. Staphylococcus aureus enterotoxin in food of animal origin and staphylococcal food poisoning risk assessment from farm to table. Ital. J. Anim. Sci. 2021, 20, 677–690. [Google Scholar] [CrossRef]
- Grispoldi, L.; Karama, M.; Ianni, F.; La Mantia, A.; Pucciarini, L.; Camaioni, E.; Sardella, R.; Sechi, P.; Natalini, B.; Cenci-Goga, B.T. The Relationship between S. aureus and Branched-Chain Amino Acids Content in Composite Cow Milk. Animals 2019, 9, 981. [Google Scholar] [CrossRef]
- Wan, Y.; Yang, L.; Li, Q.; Wang, X.; Zhou, T.; Chen, D.; Li, L.; Wang, Y.; Wang, X. Stability and emetic activity of enterotoxin like X (SElX) with high carrier rate of food poisoning Staphylococcus aureus. Int. J. Food Microbiol. 2023, 404, 110352. [Google Scholar] [CrossRef]
- Hu, D.-L.; Wang, L.; Fang, R.; Okamura, M.; Ono, H.K. Chapter 3—Staphylococcus aureus Enterotoxins. In Staphylococcus aureus; Fetsch, A., Ed.; Academic Press: New York, NY, USA, 2018; pp. 39–55. [Google Scholar]
- Balaban, N.; Rasooly, A. Staphylococcal enterotoxins. Int. J. Food Microbiol. 2000, 61, 1–10. [Google Scholar] [CrossRef]
- Ostyn, A.; De Buyser, M.L.; Guillier, F.; Groult, J.; Félix, B.; Salah, S.; Delmas, G.; Hennekinne, J.A. First evidence of a food poisoning outbreak due to staphylococcal enterotoxin type E, France, 2009. Eurosurveillance 2010, 15, 19528. [Google Scholar] [CrossRef] [PubMed]
- Zhang, P.; Zhang, Y.; Ruan, F.; Chang, G.; Lü, Z.; Tian, L.; Ji, H.; Zhou, T.; Wang, X. Genotypic diversity of staphylococcal enterotoxin B gene (seb) and its association with molecular characterization and antimicrobial resistance of Staphylococcus aureus from retail food. Int. J. Food Microbiol. 2024, 408, 110444. [Google Scholar] [CrossRef] [PubMed]
- Argudín, M.Á.; Mendoza, M.C.; Rodicio, M.R. Food Poisoning and Staphylococcus aureus Enterotoxins. Toxins 2010, 2, 1751–1773. [Google Scholar] [CrossRef] [PubMed]
- Chao, G.; Bao, G.; Cao, Y.; Yan, W.; Wang, Y.; Zhang, X.; Zhou, L.; Wu, Y. Prevalence and diversity of enterotoxin genes with genetic background of Staphylococcus aureus isolates from different origins in China. Int. J. Food Microbiol. 2015, 211, 142–147. [Google Scholar] [CrossRef] [PubMed]
- Kérouanton, A.; Hennekinne, J.A.; Letertre, C.; Petit, L.; Chesneau, O.; Brisabois, A.; De Buyser, M.L. Characterization of Staphylococcus aureus strains associated with food poisoning outbreaks in France. Int. J. Food Microbiol. 2007, 115, 369–375. [Google Scholar] [CrossRef] [PubMed]
- Omoe, K.; Hu, D.-L.; Takahashi-Omoe, H.; Nakane, A.; Shinagawa, K. Comprehensive analysis of classical and newly described staphylococcal superantigenic toxin genes in Staphylococcus aureus isolates. FEMS Microbiol. Lett. 2005, 246, 191–198. [Google Scholar] [CrossRef] [PubMed]
- Sato’o, Y.; Omoe, K.; Naito, I.; Ono, H.K.; Nakane, A.; Sugai, M.; Yamagishi, N.; Hu, D.-L. Molecular Epidemiology and Identification of a Staphylococcus aureus Clone Causing Food Poisoning Outbreaks in Japan. J. Clin. Microbiol. 2014, 52, 2637–2640. [Google Scholar] [CrossRef] [PubMed]
- Pineda, A.P.A.; Cueva, C.L.R.; Chacón, R.D.; Ramírez, M.; de Almeida, O.G.G.; de Oliveira, D.P.; Franco, B.D.G.M.; Lacorte, G.; Landgraf, M.; Silva, N.C.C.; et al. Genomic characterization of Staphylococcus aureus from Canastra Minas Artisanal Cheeses. Braz. J. Microbiol. 2023, 54, 2103–2116. [Google Scholar] [CrossRef]
- Carfora, V.; Caprioli, A.; Marri, N.; Sagrafoli, D.; Boselli, C.; Giacinti, G.; Giangolini, G.; Sorbara, L.; Dottarelli, S.; Battisti, A.; et al. Enterotoxin genes, enterotoxin production, and methicillin resistance in Staphylococcus aureus isolated from milk and dairy products in Central Italy. Int. Dairy J. 2015, 42, 12–15. [Google Scholar] [CrossRef]
- Cremonesi, P.; Perez, G.; Pisoni, G.; Moroni, P.; Morandi, S.; Luzzana, M.; Brasca, M.; Castiglioni, B. Detection of enterotoxigenic Staphylococcus aureus isolates in raw milk cheese. Lett. Appl. Microbiol. 2007, 45, 586–591. [Google Scholar] [CrossRef]
- Morandi, S.; Brasca, M.; Lodi, R.; Cremonesi, P.; Castiglioni, B. Detection of classical enterotoxins and identification of enterotoxin genes in Staphylococcus aureus from milk and dairy products. Vet. Microbiol. 2007, 124, 66–72. [Google Scholar] [CrossRef] [PubMed]
- Normanno, G.; La Salandra, G.; Dambrosio, A.; Quaglia, N.C.; Corrente, M.; Parisi, A.; Santagada, G.; Firinu, A.; Crisetti, E.; Celano, G.V. Occurrence, characterization and antimicrobial resistance of enterotoxigenic Staphylococcus aureus isolated from meat and dairy products. Int. J. Food Microbiol. 2007, 115, 290–296. [Google Scholar] [CrossRef] [PubMed]
- Rola, J.G.; Czubkowska, A.; Korpysa-Dzirba, W.; Osek, J. Occurrence of Staphylococcus aureus on Farms with Small Scale Production of Raw Milk Cheeses in Poland. Toxins 2016, 8, 62. [Google Scholar] [CrossRef] [PubMed]
- Akineden, Ö.; Hassan, A.A.; Schneider, E.; Usleber, E. Enterotoxigenic properties of Staphylococcus aureus isolated from goats’ milk cheese. Int. J. Food Microbiol. 2008, 124, 211–216. [Google Scholar] [CrossRef] [PubMed]
- Basanisi, M.G.; Nobili, G.; La Bella, G.; Russo, R.; Spano, G.; Normanno, G.; La Salandra, G. Molecular characterization of Staphylococcus aureus isolated from sheep and goat cheeses in southern Italy. Small Rumin. Res. 2016, 135, 17–19. [Google Scholar] [CrossRef]
- Cavicchioli, V.Q.; Scatamburlo, T.M.; Yamazi, A.K.; Pieri, F.A.; Nero, L.A. Occurrence of Salmonella, Listeria monocytogenes, and enterotoxigenic Staphylococcus in goat milk from small and medium-sized farms located in Minas Gerais State, Brazil. J. Dairy Sci. 2015, 98, 8386–8390. [Google Scholar] [CrossRef] [PubMed]
- De Buyser, M.L.; Dilasser, F.; Hummel, R.; Bergdoll, M.S. Enterotoxin and toxic shock syndrome toxin-1 production by staphylococci isolated from goat’s milk. Int. J. Food Microbiol. 1987, 5, 301–309. [Google Scholar] [CrossRef]
- Gonano, M.; Hein, I.; Zangerl, P.; Rammelmayr, A.; Wagner, M. Phenotypic and molecular characterization of Staphylococcus aureus strains of veterinary, dairy and human origin. Epidemiol. Infect. 2009, 137, 688–699. [Google Scholar] [CrossRef]
- Hàjek, V. Identification of enterotoxigenic staphylococci from sheep and sheep cheese. Appl. Environ. Microbiol. 1978, 35, 264–268. [Google Scholar] [CrossRef]
- Jørgensen, H.J.; Mørk, T.; Høgåsen, H.R.; Rørvik, L.M. Enterotoxigenic Staphylococcus aureus in bulk milk in Norway. J. Appl. Microbiol. 2005, 99, 158–166. [Google Scholar] [CrossRef]
- Katsuda, K.; Hata, E.; Kobayashi, H.; Kohmoto, M.; Kawashima, K.; Tsunemitsu, H.; Eguchi, M. Molecular typing of Staphylococcus aureus isolated from bovine mastitic milk on the basis of toxin genes and coagulase gene polymorphisms. Vet. Microbiol. 2005, 105, 301–305. [Google Scholar] [CrossRef] [PubMed]
- Kav, K.; Col, R.; Ardic, M. Characterization of Staphylococcus aureus isolates from white-brined Urfa cheese. J. Food Prot. 2011, 74, 1788–1796. [Google Scholar] [CrossRef] [PubMed]
- Lamprell, H.; Villard, L.; Chamba, J.F.; Beuvier, E.; Borges, E.; Maurin, F.; Mazerolles, G.; Noel, Y.; Kodjo, A. Identification and biotyping of coagulase positive staphylococci (CPS) in ripened French raw milk cheeses and their in vitro ability to produce enterotoxins. Rev. Med. Vet. 2004, 155, 92–96. [Google Scholar]
- Loncarevic, S.; Jørgensen, H.J.; Løvseth, A.; Mathisen, T.; Rørvik, L.M. Diversity of Staphylococcus aureus enterotoxin types within single samples of raw milk and raw milk products. J. Appl. Microbiol. 2005, 98, 344–350. [Google Scholar] [CrossRef] [PubMed]
- Normanno, G.; Firinu, A.; Virgilio, S.; Mula, G.; Dambrosio, A.; Poggiu, A.; Decastelli, L.; Mioni, R.; Scuota, S.; Bolzoni, G.; et al. Coagulase-positive Staphylococci and Staphylococcus aureus in food products marketed in Italy. Int. J. Food Microbiol. 2005, 98, 73–79. [Google Scholar] [CrossRef] [PubMed]
- Ostyn, A.; De Buyser, M.L.; Guillier, F.; Krys, S.; Hennekinne, J.A. Benefits of the Combined Use of Immunological- and PCR-Based Methods for Determination of Staphylococcal Enterotoxin Food Safety Criteria in Cheeses. Food Anal. Methods 2012, 5, 173–178. [Google Scholar] [CrossRef]
- Pelisser, M.R.; Klein, C.S.; Ascoli, K.R.; Zotti, T.R.; Arisi, A.C. Ocurrence of Staphylococcus aureus and multiplex pcr detection of classic enterotoxin genes in cheese and meat products. Braz. J. Microbiol. Publ. Braz. Soc. Microbiol. 2009, 40, 145–148. [Google Scholar] [CrossRef]
- Rall, V.L.M.; Vieira, F.P.; Rall, R.; Vieitis, R.L.; Fernandes, A.; Candeias, J.M.G.; Cardoso, K.F.G.; Araújo, J.P. PCR detection of staphylococcal enterotoxin genes in Staphylococcus aureus strains isolated from raw and pasteurized milk. Vet. Microbiol. 2008, 132, 408–413. [Google Scholar] [CrossRef]
- Scherrer, D.; Corti, S.; Muehlherr, J.E.; Zweifel, C.; Stephan, R. Phenotypic and genotypic characteristics of Staphylococcus aureus isolates from raw bulk-tank milk samples of goats and sheep. Vet. Microbiol. 2004, 101, 101–107. [Google Scholar] [CrossRef]
- Valle, J.; Gomez-Lucia, E.; Piriz, S.; Goyache, J.; Orden, J.A.; Vadillo, S. Enterotoxin production by staphylococci isolated from healthy goats. Appl. Environ. Microbiol. 1990, 56, 1323–1326. [Google Scholar] [CrossRef]
- Bianchi, D.M.; Gallina, S.; Bellio, A.; Chiesa, F.; Civera, T.; Decastelli, L. Enterotoxin gene profiles of Staphylococcus aureus isolated from milk and dairy products in Italy. Lett. Appl. Microbiol. 2014, 58, 190–196. [Google Scholar] [CrossRef] [PubMed]
- Hummerjohann, J.; Naskova, J.; Baumgartner, A.; Graber, H.U. Enterotoxin-producing Staphylococcus aureus genotype B as a major contaminant in Swiss raw milk cheese. J. Dairy Sci. 2014, 97, 1305–1312. [Google Scholar] [CrossRef] [PubMed]
- Johler, S.; Macori, G.; Bellio, A.; Acutis, P.L.; Gallina, S.; Decastelli, L. Short communication: Characterization of Staphylococcus aureus isolated along the raw milk cheese production process in artisan dairies in Italy. J. Dairy Sci. 2018, 101, 2915–2920. [Google Scholar] [CrossRef] [PubMed]
- Poli, A.; Guglielmini, E.; Sembeni, S.; Spiazzi, M.; Dellaglio, F.; Rossi, F.; Torriani, S. Detection of Staphylococcus aureus and enterotoxin genotype diversity in Monte Veronese, a Protected Designation of Origin Italian cheese. Lett. Appl. Microbiol. 2007, 45, 529–534. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Wang, J.; Jin, J.; Li, X.; Zhang, H.; Shi, X.; Zhao, C. Prevalence, antibiotic resistance, and enterotoxin genes of Staphylococcus aureus isolated from milk and dairy products worldwide: A systematic review and meta-analysis. Food Res. Int. 2022, 162, 111969. [Google Scholar] [CrossRef] [PubMed]
- Hennekinne, J.A.; De Buyser, M.L.; Dragacci, S. Staphylococcus aureus and its food poisoning toxins: Characterization and outbreak investigation. FEMS Microbiol. Rev. 2012, 36, 815–836. [Google Scholar] [CrossRef] [PubMed]
- Asao, T.; Kumeda, Y.; Kawai, T.; Shibata, T.; Oda, H.; Haruki, K.; Nakazawa, H.; Kozaki, S. An extensive outbreak of staphylococcal food poisoning due to low-fat milk in Japan: Estimation of enterotoxin A in the incriminated milk and powdered skim milk. Epidemiol. Infect. 2003, 130, 33–40. [Google Scholar] [CrossRef] [PubMed]
- Notermans, S.; Dormans, J.A.M.A.; Mead, G.C. Contribution of surface attachment to the establishment of micro-organisms in food processing plants: A review. Biofouling 1991, 5, 21–36. [Google Scholar] [CrossRef]
- Ljevaković-Musladin, I.; Lakić, M.; Levak, S.; Kozačinski, L. Microbiological Quality of Domestic Cheese in Dubrovnik Croatia Region. In Prooceedings of the Hygiena Alimentorum XXXVII, Safety and Quality of Dairy and Vegetable Commodities, Štrbské pleso, Slovakia, 18–20 May 2016; pp. 228–233. [Google Scholar]
- EN ISO 6888-1:2021; C.S. Mikrobiologija u Lancu Hrane—Horizontalna Metoda Određivanja Broja Koagulaza-Pozitivnih Stafilokoka (Staphylococcus aureus i Ostale Vrste)—1. Dio: Postupak Primjene Baird-Parker Agara. Croatian Standards Institute: Zagreb, Croatia, 2021.
- (EUCAST) European Committee on Antimicrobial Susceptibility Testing. Disk Diffusion Method for Antimicrobial Susceptibility Testing Manual, Version 8.0. Available online: https://www.eucast.org (accessed on 18 September 2020).
- (EUCAST) European Committee on Antimicrobial Susceptibility Testing. Breakpoint Tables for Interpretation of MICs and Zone Diameters, Version 13.1. Available online: https://www.eucast.org (accessed on 18 October 2023).
- Nakayama, A.; Okayama, A.; Hashida, M.; Yamamoto, Y.; Takebe, H.; Ohnaka, T.; Tanaka, T.; Imai, S. Development of a routine laboratory direct detection system of staphylococcal enterotoxin genes. J. Med. Microbiol. 2006, 55, 273–277. [Google Scholar] [CrossRef]
- Salasia, S.I.; Khusnan, Z.; Lammler, C.; Zschock, M. Comparative studies on pheno- and genotypic properties of Staphylococcus aureus isolated from bovine subclinical mastitis in central Java in Indonesia and Hesse in Germany. J. Vet. Sci. 2004, 5, 103–109. [Google Scholar] [CrossRef][Green Version]
- Jaki Taklec, V. Detection of Genes Encoding Virulence Factors and mecA Gene in Staphylococcus aureus Field Strains Isolated from Mastitic Cows; University of Zagreb: Zagreb, Croatia, 2013. [Google Scholar]
- Stephan, R.; Annemüller, C.; Hassan, A.A.; Lämmler, C. Characterization of enterotoxigenic Staphylococcus aureus strains isolated from bovine mastitis in north-east Switzerland. Vet. Microbiol. 2001, 78, 373–382. [Google Scholar] [CrossRef] [PubMed]
- Jørgensen, H.J.; Mørk, T.; Rørvik, L.M. The Occurrence of Staphylococcus aureus on a Farm with Small-Scale Production of Raw Milk Cheese. J. Dairy Sci. 2005, 88, 3810–3817. [Google Scholar] [CrossRef] [PubMed]
- Hájek, V.; Marsálek, E. A study of staphylococci of bovine origin Staphylococcus aureus var. bovis. Zentralblatt Bakteriol. Parasitenkd. Infekt. Hyg. 1969, 209, 154–160. [Google Scholar]
- André, M.C.D.P.B.; Campos, M.R.H.; Borges, L.J.; Kipnis, A.; Pimenta, F.C.; Serafini, Á.B. Comparison of Staphylococcus aureus isolates from food handlers, raw bovine milk and Minas Frescal cheese by antibiogram and pulsed-field gel electrophoresis following SmaI digestion. Food Control 2008, 19, 200–207. [Google Scholar] [CrossRef]
- Grispoldi, L.; Massetti, L.; Sechi, P.; Iulietto, M.F.; Ceccarelli, M.; Karama, M.; Popescu, P.A.; Pandolfi, F.; Cenci-Goga, B.T. Short communication: Characterization of enterotoxin-producing Staphylococcus aureus isolated from mastitic cows. J. Dairy Sci. 2019, 102, 1059–1065. [Google Scholar] [CrossRef] [PubMed]
- Papadopoulos, P.; Papadopoulos, T.; Angelidis, A.S.; Kotzamanidis, C.; Zdragas, A.; Papa, A.; Filioussis, G.; Sergelidis, D. Prevalence, antimicrobial susceptibility and characterization of Staphylococcus aureus and methicillin-resistant Staphylococcus aureus isolated from dairy industries in north-central and north-eastern Greece. Int. J. Food Microbiol. 2019, 291, 35–41. [Google Scholar] [CrossRef] [PubMed]
- Hunt, K.; Schelin, J.; Rådström, P.; Butler, F.; Jordan, K. Classical enterotoxins of coagulase-positive Staphylococcus aureus isolates from raw milk and products for raw milk cheese production in Ireland. Dairy Sci. Technol. 2012, 92, 487–499. [Google Scholar] [CrossRef]
- Shalaby, M.; Reboud, J.; Forde, T.; Zadoks, R.N.; Busin, V. Distribution and prevalence of enterotoxigenic Staphylococcus aureus and staphylococcal enterotoxins in raw ruminants’ milk: A systematic review. Food Microbiol. 2024, 118, 104405. [Google Scholar] [CrossRef]
- Morandi, S.; Brasca, M.; Andrighetto, C.; Lombardi, A.; Lodi, R. Phenotypic and Genotypic Characterization of Staphylococcus aureus Strains from Italian Dairy Products. Int. J. Microbiol. 2009, 2009, 501362. [Google Scholar] [CrossRef]
- Ertas, N.; Gonulalan, Z.; Yildirim, Y.; Kum, E. Detection of Staphylococcus aureus enterotoxins in sheep cheese and dairy desserts by multiplex PCR technique. Int. J. Food Microbiol. 2010, 142, 74–77. [Google Scholar] [CrossRef]
- Rosec, J.P.; Gigaud, O. Staphylococcal enterotoxin genes of classical and new types detected by PCR in France. Int. J. Food Microbiol. 2002, 77, 61–70. [Google Scholar] [CrossRef]
- Rosec, J.P.; Guiraud, J.P.; Dalet, C.; Richard, N. Enterotoxin production by staphylococci isolated from foods in France. Int. J. Food Microbiol. 1997, 35, 213–221. [Google Scholar] [CrossRef]
- Tamarapu, S.; McKillip, J.L.; Drake, M. Development of a Multiplex Polymerase Chain Reaction Assay for Detection and Differentiation of Staphylococcus aureus in Dairy Products. J. Food Prot. 2001, 64, 664–668. [Google Scholar] [CrossRef]
- Fueyo, J.M.; Martín, M.C.; González-Hevia, M.A.; Mendoza, M.C. Enterotoxin production and DNA fingerprinting in Staphylococcus aureus isolated from human and food samples. Relations between genetic types and enterotoxins. Int. J. Food Microbiol. 2001, 67, 139–145. [Google Scholar] [CrossRef]
- Borelli, B.M.; Ferreira, E.G.; Lacerda, I.C.A.; Santos, D.A.; Carmo, L.S.; Dias, R.S.; Silva, M.C.C. Enteroxigenic Staphylococcus spp. and other microbial contaminants during production of Canastra cheese. Brazil. Braz. J. Microbiol. 2006, 37, 545–550. [Google Scholar] [CrossRef]
- Holecková, B.; Holoda, E.; Fotta, M.; Kalinácova, V.; Gondol, J.; Grolmus, J. Occurrence of enterotoxigenic Staphylococcus aureus in food. Ann. Agric. Environ. Med. AAEM 2002, 9, 179–182. [Google Scholar] [PubMed]


| Gene | Primer/Probe | Oligonucleotide Sequence (5′-3′) [54] | Position * | GenBank Accession no. |
|---|---|---|---|---|
| sea | eta-F | TTTGGAAACGGTTAAAACGAATAAG | 489–513 | M18970 |
| eta-R | TTTCCTGTAAATAACGTCTTGCTTGA | 543–568 | ||
| eta-T | FAM-CTGTTCAGGAGTTGGATC-MGB | 524–541 | ||
| seb | etb-F | AGGTGACTGCTCAAGAATTAGATTACC | 785–811 | M11118 |
| etb-R | AAGGCGAGTTGTTAAATTCATAGAGTT | 842–868 | ||
| etb-T | FAM-AACTCGTCACTATTTGGTG-MGB | 813–831 | ||
| sec | etc-F | GGCGATAAGTTTGACCAATCTAAATAT | 811–837 | X05815 |
| etc-R | AAGGTGGACTTCTATCTTCACACTTTT | 864–900 | ||
| etc-T | FAM-TGTACAACGACAATAAA-MGB | 845–861 | ||
| sed | etd-F | CACAAGCAAGGCGCTATTTG | 836–855 | M28521 |
| etd-R | TCGGGAAAATCACCCTTAACA | 966–986 | ||
| etd-T | FAM-ATACAGCGCGGAAA-MGB | 901–914 | ||
| see | ete-F | CTTTGGCGGTAAGGTGCAA | 594–612 | M21319 |
| ete-R | ACCGTGGACCCTTCAGAAGA | 634–653 | ||
| ete-T | FAM-AGGCTTGATTGTGTTTCA-MGB | 615–632 |
| Gene | Primer | Oligonucleotide Sequence (5′-3′) [54,55] | Amplification Conditions |
|---|---|---|---|
| sea | eta-F | AAAGTCCCGATCAATTTATGGCTA | 94 °C 5′; 94 °C 3′; 58 °C 30″; 72 °C 5″; 30 cycles 72°C 10′ |
| eta-R | GTAATTAACCGAAGGTTCTGTAGA | ||
| seb | etb-F | TCGCATCAAACTGACAAACG | 94 °C 5′; 94 °C 2′ 55 °C 2′; 72 °C 1′; 30 cycles 72 °C 10′ |
| etb-R | GCAGGTACTCTATAAGTGCC | ||
| sec | etc-F | GACATAAAAGCTAGGAATTT | 94 °C 5′; 94 °C 2′ 55 °C 2′; 72 °C 1′; 30 cycles 72 °C 10′ |
| etc-R | AAATCGGATTAACATTATCC | ||
| sed | etd-F | CTAGTTTGGTAATATCTCCT | 94 °C 5′; 94 °C 2′ 55 °C 2′; 72 °C 1′; 30 cycles 72 °C 10′ |
| etd-R | TAATGCTATATCTTATAGGG | ||
| see | ete-F | AGGTTTTTTCACAGGTCATCC | 94 °C 5′; 94 °C 2′ 57 °C 2′; 72 °C 1′; 35 cycles 72 °C 7′ |
| ete-R | CTTTTTTTTCTTCGGTCAATC |
| Coagulase | Latex Agglutination | Egg Yolk Reaction | Catalase | Dnase | Haemolysis | |
|---|---|---|---|---|---|---|
| Positive | 175 | 175 | 94 a + 32 b | 175 | 175 | 103 c + 64 d |
| Negative | 0 | 0 | 49 | 0 | 0 | 8 |
| Sample | No. of Isolates | RPLA Phenotype | Real-Time PCR Genotype | Classical PCR Genotype |
|---|---|---|---|---|
| S1 | 7 | SEC (5) | sec (5) | sec (4) |
| S2 | 9 | SEC (9) | sec (9) | sec (9) |
| S3 | 10 | Negative | Negative | - |
| S4 | 10 | Negative | Negative | - |
| S8 | 10 | Negative | Negative | - |
| S11 | 10 | Negative | Negative | - |
| S12 | 10 | Negative | Negative | - |
| S13 | 10 | Negative | Negative | - |
| S14 | 10 | SEC (7) | sec (7) | sec (5) |
| S15 | 9 | Negative | Negative | - |
| S16 | 10 | SEC (8) | sec (8) | sec (8) |
| S17 | 10 | Negative | Negative | - |
| S21 | 10 | SEC (1) | sec (1) | sec (1) |
| S22 | 10 | SEC (1) | sec (1) | sec (1) |
| S23 | 10 | SEC (3) | sec (3) | sec (3) |
| S28 | 10 | Negative | Negative | - |
| S29 | 10 | Negative | Negative | - |
| S30 | 10 | Negative | Negative | - |
| Total | 175 | 34 | 34 | 31 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ljevaković-Musladin, I.; Kozačinski, L.; Krilanović, M.; Vodnica Martucci, M.; Lakić, M.; Grispoldi, L.; Cenci-Goga, B.T. Enterotoxigenic and Antimicrobic Susceptibility Profile of Staphylococcus aureus Isolates from Fresh Cheese in Croatia. Microorganisms 2023, 11, 2993. https://doi.org/10.3390/microorganisms11122993
Ljevaković-Musladin I, Kozačinski L, Krilanović M, Vodnica Martucci M, Lakić M, Grispoldi L, Cenci-Goga BT. Enterotoxigenic and Antimicrobic Susceptibility Profile of Staphylococcus aureus Isolates from Fresh Cheese in Croatia. Microorganisms. 2023; 11(12):2993. https://doi.org/10.3390/microorganisms11122993
Chicago/Turabian StyleLjevaković-Musladin, Ivana, Lidija Kozačinski, Marija Krilanović, Marina Vodnica Martucci, Mato Lakić, Luca Grispoldi, and Beniamino T. Cenci-Goga. 2023. "Enterotoxigenic and Antimicrobic Susceptibility Profile of Staphylococcus aureus Isolates from Fresh Cheese in Croatia" Microorganisms 11, no. 12: 2993. https://doi.org/10.3390/microorganisms11122993
APA StyleLjevaković-Musladin, I., Kozačinski, L., Krilanović, M., Vodnica Martucci, M., Lakić, M., Grispoldi, L., & Cenci-Goga, B. T. (2023). Enterotoxigenic and Antimicrobic Susceptibility Profile of Staphylococcus aureus Isolates from Fresh Cheese in Croatia. Microorganisms, 11(12), 2993. https://doi.org/10.3390/microorganisms11122993

