Transreplication Preference of the Tomato Leaf Curl Joydebpur Virus for a Noncognate Betasatellite through Iteron Resemblance on Nicotiana bethamiana
Abstract
:1. Introduction
2. Materials and Methods
2.1. Samples Collection and Viral Detection
2.2. Phylogenetic Tree and Sequence Demarcation Tool (SDT) Analysis
2.3. Infectious Clone Construction
2.4. Agroinoculation Assay
2.5. Combination of Inoculation and Satellites Mutant Construction
2.6. Viral DNA Detection and Southern Hybridization Blot
2.7. Quantitative PCR to Determine Viral Accumulation
3. Results
3.1. Virus Detection and Sequence Analysis via Phylogentic Tree and SDT
3.2. Infectivity of ToLCJoV with Different Betasatellite
3.3. Infectivity of Mutant Clones
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Maruthi, M.; Alam, S.; Kader, K.; Rekha, A.; Cork, A.; Colvin, J. Nucleotide sequencing, whitefly transmission, and screening tomato for resistance against two newly described begomoviruses in Bangladesh. Phytopathology 2005, 95, 1472–1481. [Google Scholar] [CrossRef]
- Paul, S.; Ghosh, R.; Das, S.; Palit, P.; Acharyya, S.; Das, A.; Mir, J.; Chaudhuri, S.; Ghosh, S.; Roy, A. First report of Tomato leaf curl Joydebpur virus and associated betasatellite in kenaf (Hibiscus cannabinus) plants showing leaf curl symptoms from southern India. Plant Pathol. 2009, 58, 403. [Google Scholar] [CrossRef]
- Shih, S.; Tsai, W.; Green, S.; Singh, D. First report of Tomato leaf curl Joydebpur virus infecting chilli in India. Plant Pathol. J. 2007, 56, 341. [Google Scholar] [CrossRef]
- Tiwari, N.; Singh, V.B.; Sharma, P.; Malathi, V. Tomato leaf curl Joydebpur virus: A monopartite begomovirus causing severe leaf curl in tomato in West Bengal. Arch. Virol. 2013, 158, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Fiallo-Olivé, E.; Navas-Castillo, J. Molecular and biological characterization of a New World mono-/bipartite begomovirus/deltasatellite complex infecting Corchorus siliquosus. Front. Microbiol. 2020, 11, 1755. [Google Scholar] [CrossRef] [PubMed]
- Hamim, I.; Borth, W.B.; Melzer, M.J.; Suzuki, J.Y.; Wall, M.M.; Hu, J.S. Occurrence of tomato leaf curl Bangladesh virus and associated subviral DNA molecules in papaya in Bangladesh: Molecular detection and characterization. Arch. Virol. 2019, 164, 1661–1665. [Google Scholar] [CrossRef] [PubMed]
- Rosario, K.; Marr, C.; Varsani, A.; Kraberger, S.; Stainton, D.; Moriones, E.; Polston, J.E.; Breitbart, M. Begomovirus-associated satellite DNA diversity captured through vector-enabled metagenomic (VEM) surveys using whiteflies (Aleyrodidae). Viruses 2016, 8, 36. [Google Scholar] [CrossRef] [PubMed]
- Briddon, R.W.; Bull, S.E.; Amin, I.; Idris, A.M.; Mansoor, S.; Bedford, I.D.; Dhawan, P.; Rishi, N.; Siwatch, S.S.; Abdel-Salam, A.M. Diversity of DNA β, a satellite molecule associated with some monopartite begomoviruses. Virology 2003, 312, 106–121. [Google Scholar] [CrossRef]
- Zhou, X. Advances in Understanding Begomovirus Satellites. Annu. Rev. Phytopathol. 2013, 51, 357–381. [Google Scholar] [CrossRef]
- Gnanasekaran, P.; KishoreKumar, R.; Bhattacharyya, D.; Vinoth Kumar, R.; Chakraborty, S. Multifaceted role of geminivirus associated betasatellite in pathogenesis. Mol. Plant Pathol. 2019, 20, 1019–1033. [Google Scholar] [CrossRef]
- Dry, I.B.; Krake, L.R.; Rigden, J.E.; Rezaian, M.A. A novel subviral agent associated with a geminivirus: The first report of a DNA satellite. Proc. Natl. Acad. Sci. USA 1997, 94, 7088–7093. [Google Scholar] [CrossRef] [PubMed]
- Qing, L.; Zhou, X. Trans-replication of, and competition between, DNA β satellites in plants inoculated with Tomato yellow leaf curl China virus and Tobacco curly shoot virus. Phytopathology 2009, 99, 716–720. [Google Scholar] [CrossRef]
- Xu, X.; Qian, Y.; Wang, Y.; Li, Z.; Zhou, X. Iterons Homologous to Helper Geminiviruses Are Essential for Efficient Replication of Betasatellites. J. Virol. 2019, 93, e01532-18. [Google Scholar] [CrossRef] [PubMed]
- Zhang, T.; Xu, X.; Huang, C.; Qian, Y.; Li, Z.; Zhou, X. A novel DNA motif contributes to selective replication of a geminivirus-associated betasatellite by a helper virus-encoded replication-related protein. J. Virol. 2016, 90, 2077–2089. [Google Scholar] [CrossRef]
- Shafiq, M.; Qurashi, F.; Mushtaq, S.; Hussain, M.; Hameed, A.; Haider, M.S. DNA plant viruses: Biochemistry, replication, and molecular genetics. In Applied Plant Virology; Elsevier: Amsterdam, The Netherlands, 2020; pp. 169–182. [Google Scholar]
- Shilpi, S.; Kumar, A.; Biswas, S.; Roy, A.; Mandal, B. A recombinant Tobacco curly shoot virus causes leaf curl disease in tomato in a north-eastern state of India and has potentiality to trans-replicate a non-cognate betasatellite. Virus Genes 2015, 50, 87–96. [Google Scholar] [CrossRef] [PubMed]
- Sangeeta; Kumar, R.V.; Yadav, B.K.; Bhatt, B.S.; Krishna, R.; Krishnan, N.; Karkute, S.G.; Kumar, S.; Singh, B.; Singh, A.K. Diverse begomovirus-betasatellite complexes cause tomato leaf curl disease in the western India. Virus Res. 2023, 328, 199079. [Google Scholar] [CrossRef]
- Iqbal, Z.; Shafiq, M.; Ali, I.; Mansoor, S.; Briddon, R.W. Maintenance of Cotton Leaf Curl Multan Betasatellite by Tomato Leaf Curl New Delhi Virus—Analysis by Mutation. Front. Plant Sci. 2017, 8, 2208. [Google Scholar] [CrossRef]
- Iqbal, Z.; Sattar, M.N.; Kvarnheden, A.; Mansoor, S.; Briddon, R.W. Effects of the mutation of selected genes of Cotton leaf curl Kokhran virus on infectivity, symptoms and the maintenance of Cotton leaf curl Multan betasatellite. Virus Res. 2012, 169, 107–116. [Google Scholar] [CrossRef]
- Hosseinpour, N.; Nematadeh, G. Introducing a new method of genomic DNA extractionin dicotyledonous plants. Plant Genetic Engineering, Sari University of Agriculture and Natural Resources, Sari, Iran. Sch. J. Agri. Sci. 2013, 2, 242–248. [Google Scholar]
- Rojas, M.R. Use of degenerate primers in the polymerase chain reaction to detect whitefly-transmitted geminiviruses. Plant Dis. 1993, 77, 340–347. [Google Scholar] [CrossRef]
- Lal, A.; Kil, E.-J.; Vo, T.T.B.; Fadhila, C.; Ho, P.T.; Shuja, M.N.; Ali, M.; Lee, S. First Report of Duranta leaf curl virus Infecting Ficus virens Showing Leaf Curl Symptoms in Pakistan. Plant Dis. 2020, 104, 2034. [Google Scholar] [CrossRef]
- Martin, D.P.; Murrell, B.; Golden, M.; Khoosal, A.; Muhire, B. RDP4: Detection and analysis of recombination patterns in virus genomes. Virus Evol. 2015, 1, vev003. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. 2018, 35, 1547. [Google Scholar] [CrossRef] [PubMed]
- Tang, Y.; He, Z.; Du, Z.; She, X.; Lan, G. Identification and Molecular Characterization of a New Geminivirus Betasatellite Infecting Malvastrum coromandelianum in China. J. Phytopathol. 2016, 164, 1105–1110. [Google Scholar] [CrossRef]
- Muhire, B.M.; Varsani, A.; Martin, D.P. SDT: A virus classification tool based on pairwise sequence alignment and identity calculation. PLoS ONE 2014, 9, e108277. [Google Scholar] [CrossRef] [PubMed]
- Urbino, C.; Thébaud, G.; Granier, M.; Blanc, S.; Peterschmitt, M. A novel cloning strategy for isolating, genotyping and phenotyping genetic variants of geminiviruses. Virol. J. 2008, 5, 135. [Google Scholar] [CrossRef] [PubMed]
- Froger, A.; Hall, J.E. Transformation of plasmid DNA into E. coli using the heat shock method. J. Vis. Exp. 2007, 6, e253. [Google Scholar]
- Kil, E.-J.; Byun, H.-S.; Kim, S.; Kim, J.; Park, J.; Cho, S.; Yang, D.-C.; Lee, K.-Y.; Choi, H.-S.; Kim, J.-K.; et al. Sweet pepper confirmed as a reservoir host for tomato yellow leaf curl virus by both agro-inoculation and whitefly-mediated inoculation. Arch. Virol. 2014, 159, 2387–2395. [Google Scholar] [CrossRef]
- Southern, E. Southern blotting. Nat. Protoc. 2006, 1, 518–525. [Google Scholar] [CrossRef]
- Vo, T.T.B.; Troiano, E.; Lal, A.; Hoang, P.T.; Kil, E.-J.; Lee, S.; Parrella, G. ToLCNDV-ES infection in tomato is enhanced by TYLCV: Evidence from field survey and agroinoculation. Front. Microbiol. 2022, 13, 954460. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Argüello-Astorga, G.; Herrera-Estrella, L.; Rivera-Bustamante, R. Experimental and theoretical definition of geminivirus origin of replication. Plant Mol. Biol. 1994, 26, 553–556. [Google Scholar] [CrossRef] [PubMed]
- Rodríguez-Negrete, E.A.; Sánchez-Campos, S.; Cañizares, M.C.; Navas-Castillo, J.; Moriones, E.; Bejarano, E.R.; Grande-Pérez, A. A sensitive method for the quantification of virion-sense and complementary-sense DNA strands of circular single-stranded DNA viruses. Sci. Rep. 2014, 4, 6438. [Google Scholar] [CrossRef] [PubMed]
- Fontes, E.; Eagle, P.A.; Sipe, P.S.; Luckow, V.A.; Hanley-Bowdoin, L. Interaction between a geminivirus replication protein and origin DNA is essential for viral replication. J. Biol. Chem. 1994, 269, 8459–8465. [Google Scholar] [CrossRef] [PubMed]
- Shafiq, M.; Asad, S.; Zafar, Y.; Briddon, R.W.; Mansoor, S. Pepper leaf curl Lahore virus requires the DNA B component of Tomato leaf curl New Delhi virus to cause leaf curl symptoms. Virol. J. 2010, 7, 367. [Google Scholar] [CrossRef]
- Lin, B.; Behjatnia, S.A.; Dry, I.B.; Randles, J.W.; Rezaian, M.A. High-affinity Rep-binding is not required for the replication of a geminivirus DNA and its satellite. Virology 2003, 305, 353–363. [Google Scholar] [CrossRef]
Purpose | Primer | Sequence (5′-3′) | Target Size |
---|---|---|---|
Detection | ToLCJoV-det-F | GAAGCCCAGATGTTCCTAGG | 554 bp |
ToLCJoV-det-R | GCATACACAGGGTTAGAGGC | ||
ToLCBDB-F | TGACCTTGTCGAGCACAATTC | 677 bp | |
ToLCBDB-R | GATACCGATATATCGGTGCC | ||
ToLCJoB-F | CTGGTGACCGTGTGGATAC | 489 bp | |
ToLCJoB-R | GTGTGTGCTTGTTGTTGTCAG | ||
Quantitative PCR | qJoV-F | ATTGGGTCCTGGATTGCAGA | 143 bp |
qJoV-R | ATGACGTCGATCCCCACTAC | ||
qJoB-F | GCCTCTACCATGTCCTCCTG | 116 bp | |
qJoB-R | GGGATCATACCACCGTTCGA |
Virus | Infectivity * | Days of Symptom Appearance | Symptom | |
---|---|---|---|---|
DNA A | Satellite | |||
ToLCJoV | 10/10 | - | 21 | Mild leaf crumpling |
ToLCJoV × ToLCBDB | 10/10 | 10/10 | 14 | Severe leaf curling, leaf crumpling |
ToLCJoV × ToLCJoB | 10/10 | 10/10 | 18 | Mild leaf curling |
ToLCJoV × ToLCBDB M1 | 10/10 | 0/10 | 21 | Mild leaf crumpling |
ToLCJoV × ToLCJoB M1 | 10/10 | 6/10 | 18 | Leaf crumpling |
ToLCJoV × ToLCJoB M2 | 10/10 | 0/10 | 21 | Mild leaf crumpling |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Vo, T.T.B.; Wira Sanjaya, I.G.N.P.; Kil, E.-J.; Lal, A.; Ho, P.T.; Nattanong, B.; Tabassum, M.; Qureshi, M.A.; Lee, T.-K.; Lee, S. Transreplication Preference of the Tomato Leaf Curl Joydebpur Virus for a Noncognate Betasatellite through Iteron Resemblance on Nicotiana bethamiana. Microorganisms 2023, 11, 2907. https://doi.org/10.3390/microorganisms11122907
Vo TTB, Wira Sanjaya IGNP, Kil E-J, Lal A, Ho PT, Nattanong B, Tabassum M, Qureshi MA, Lee T-K, Lee S. Transreplication Preference of the Tomato Leaf Curl Joydebpur Virus for a Noncognate Betasatellite through Iteron Resemblance on Nicotiana bethamiana. Microorganisms. 2023; 11(12):2907. https://doi.org/10.3390/microorganisms11122907
Chicago/Turabian StyleVo, Thuy T. B., I Gusti Ngurah Prabu Wira Sanjaya, Eui-Joon Kil, Aamir Lal, Phuong T. Ho, Bupi Nattanong, Marjia Tabassum, Muhammad Amir Qureshi, Taek-Kyun Lee, and Sukchan Lee. 2023. "Transreplication Preference of the Tomato Leaf Curl Joydebpur Virus for a Noncognate Betasatellite through Iteron Resemblance on Nicotiana bethamiana" Microorganisms 11, no. 12: 2907. https://doi.org/10.3390/microorganisms11122907