The Pleiotropic Phenotypes Caused by an hfq Null Mutation in Vibrio harveyi
Abstract
:1. Introduction
2. Materials and Methods
2.1. Bacterial Strains and Media
2.2. Gene Disruption and Complementation
2.3. Bacterial Growth
2.4. Swimming Ability
2.5. Extracellular Protease (ECP) Activity Assay
2.6. Measurement of Biofilm Formation
2.7. Stress Response Assays
2.8. Antibiotic Resistance
2.9. Fish Infection Assay
2.10. Comparative Transcriptome Analysis
2.11. RT-qPCR Assay
2.12. Statistical Analysis
3. Results
3.1. Growth Repression of ∆hfq
3.2. Repressed Motility of ∆hfq
3.3. Increased Extracellular Protease Activity (ECP) of ∆hfq
3.4. Reduced Biofilm Formation of ∆hfq
3.5. The hfq Mutant Increased Susceptibility to ROS
3.6. Loss of hfq Increases Sensitivity to Amphenicol Antibiotics (Chloramphenicol and Florfenicol)
3.7. Virulence Attenuation of ∆hfq
3.8. Analysis of Differentially Expressed Genes
3.9. Prediction of Hfq-Dependent sRNAs
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Austin, B.; Zhang, X.-H. Vibrio harveyi: A significant pathogen of marine vertebrates and invertebrates. Lett. Appl. Microbiol. 2006, 43, 119–124. [Google Scholar] [CrossRef]
- Won, K.M.; Park, S.I. Pathogenicity of Vibrio harveyi to cultured marine fishes in Korea. Aquaculture 2008, 285, 8–13. [Google Scholar] [CrossRef]
- Zhang, X.-H.; He, X.; Austin, B. Vibrio harveyi: A serious pathogen of fish and invertebrates in mariculture. Mar. Life Sci. Technol. 2020, 2, 231–245. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.Z.; Cui, L.F.; Li, S.M.; Han, X.; Jiang, K.Y.; Yuan, X.C.; Yu, X.J.; Wang, D.; Wu, F.X.; Song, D.D.; et al. China Fishery Statistical Yearbook; China Agriculture Press: Beijing, China, 2021. [Google Scholar]
- Shen, G.M.; Shi, C.Y.; Fan, C.; Jia, D.; Wang, S.Q.; Xie, G.S.; Li, G.Y.; Mo, Z.L.; Huang, J. Isolation, identification and pathogenicity of Vibrio harveyi, the causal agent of skin ulcer disease in juvenile hybrid groupers Epinephelus fuscoguttatus × Epinephelus lanceolatus. J. Fish Dis. 2017, 40, 1351–1362. [Google Scholar] [CrossRef] [PubMed]
- Ansong, C.; Yoon, H.; Porwollik, S.; Mottaz-Brewer, H.; Petritis, B.O.; Jaitly, N.; Adkins, J.N.; McClelland, M.; Heffron, F.; Smith, R.D. Global Systems-level analysis of Hfq and SmpB deletion mutants in Salmonella: Implications for virulence and global protein translation. PLoS ONE 2009, 4, e4809. [Google Scholar] [CrossRef]
- Sonnleitner, E.; Schuster, M.; Sorger-Domenigg, T.; Greenberg, E.P.; Bläsi, U. Hfq-dependent alterations of the transcriptome profile and effects on quorum sensing in Pseudomonas aeruginosa. Mol. Microbiol. 2006, 59, 1542–1558. [Google Scholar] [CrossRef]
- Meibom, K.L.; Forslund, A.-L.; Kuoppa, K.; Alkhuder, K.; Dubail, I.; Dupuis, M.; Forsberg, A.; Charbit, A. Hfq, a novel pleiotropic regulator of virulence-associated genes in Francisella tularensis. Infect. Immun. 2009, 77, 1866–1880. [Google Scholar] [CrossRef] [PubMed]
- Ding, Y.; Davis, B.M.; Waldor, M.K. Hfq is essential for Vibrio cholerae virulence and downregulates σE expression. Mol. Microbiol. 2004, 53, 345–354. [Google Scholar] [CrossRef] [PubMed]
- Geng, J.; Song, Y.; Yang, L.; Feng, Y.; Qiu, Y.; Li, G.; Guo, J.; Bi, Y.; Qu, Y.; Wang, W.; et al. Involvement of the post-transcriptional regulator Hfq in Yersinia pestis virulence. PLoS ONE 2009, 4, e6213. [Google Scholar] [CrossRef]
- Schu, D.J.; Zhang, A.; Gottesman, S.; Storz, G. Alternative Hfq-sRNA interaction modes dictate alternative mRNA recognition. EMBO J. 2015, 34, 2557–2573. [Google Scholar] [CrossRef] [PubMed]
- Chao, Y.; Vogel, J. The role of Hfq in bacterial pathogens. Curr. Opin. Microbiol. 2010, 13, 24–33. [Google Scholar] [CrossRef] [PubMed]
- Lenz, D.H.; Mok, K.C.; Lilley, B.N.; Kulkarni, R.V.; Wingreen, N.S.; Bassler, B.L. The small RNA chaperone Hfq and multiple small RNAs control quorum sensing in Vibrio harveyi and Vibrio cholerae. Cell 2004, 118, 69–82. [Google Scholar] [CrossRef]
- Deng, Y.; Xu, H.; Su, Y.; Liu, S.; Xu, L.; Guo, Z.; Wu, J.; Cheng, C.; Feng, J. Horizontal gene transfer contributes to virulence and antibiotic resistance of Vibrio harveyi 345 based on complete genome sequence analysis. BMC Genom. 2019, 20, 761. [Google Scholar] [CrossRef] [PubMed]
- Le Roux, F.; Binesse, J.; Saulnier, D.; Mazel, D. Construction of a Vibrio splendidus mutant lacking the metalloprotease gene vsm by use of a novel counterselectable suicide vector. Appl. Environ. Microbiol. 2007, 73, 777–784. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, A.N.; Disconzi, E.; Charrière, G.M.; Destoumieux-Garzón, D.; Bouloc, P.; Le Roux, F.; Jacq, A. csrB gene duplication drives the evolution of redundant regulatory pathways controlling expression of the major toxic secreted metalloproteases in Vibrio tasmaniensis lgp32. Msphere 2018, 3, e00582-18. [Google Scholar] [CrossRef] [PubMed]
- Val, M.-E.; Skovgaard, O.; Ducos-Galand, M.; Bland, M.J.; Mazel, D. Genome engineering in Vibrio cholerae: A feasible approach to address biological issues. PLoS Genet. 2012, 8, e1002472. [Google Scholar] [CrossRef]
- Liu, J.; Zhao, Z.; Deng, Y.; Shi, Y.; Liu, Y.; Wu, C.; Luo, P.; Hu, C. Complete genome sequence of Vibrio campbellii LMB 29 isolated from red drum with four native megaplasmids. Front. Microbiol. 2017, 8, 2035. [Google Scholar] [CrossRef]
- Zhang, Y.; Deng, Y.; Feng, J.; Guo, Z.; Mao, C.; Chen, H.; Lin, Z.; Hu, J.; Su, Y. CqsA inhibits the virulence of Vibrio harveyi to the pearl gentian grouper (♀ Epinephelus fuscoguttatus×♂ Epinephelus lanceolatus). Aquaculture 2021, 535, 736346. [Google Scholar] [CrossRef]
- Wayne, P.A. Performance Standards for Antimicrobial Susceptibility Testing; Clinical and Laboratory Standards Institute: Malvern, PA, USA, 2011. [Google Scholar]
- Chen, S.; Zhou, Y.; Chen, Y.; Gu, J. fastp: An ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 2018, 34, i884–i890. [Google Scholar] [CrossRef] [PubMed]
- Langmead, B.; Salzberg, S.L. Fast gapped-read alignment with Bowtie Nat. Methods 2012, 9, 357–359. [Google Scholar] [CrossRef]
- Li, B.; Dewey, C.N. RSEM: Accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinform. 2011, 12, 323. [Google Scholar] [CrossRef] [PubMed]
- Anders, S. Analysing rna-seq data with the deseq package. Mol. Biol. 2010, 43, 1–17. [Google Scholar]
- Love, M.I.; Huber, W.; Anders, S. Differential analysis of count data–the deseq2 package. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef]
- Robinson, M.D.; McCarthy, D.J.; Smyth, G.K. EdgeR: A Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 2010, 26, 139–140. [Google Scholar] [CrossRef] [PubMed]
- Xie, C.; Mao, X.; Huang, J.; Ding, Y.; Wu, J.; Dong, S.; Kong, L.; Gao, G.; Li, C.-Y.; Wei, L. KOBAS 2.0: A web server for annotation and identification of enriched pathways and diseases. Nucleic Acids Res. 2011, 39, W316–W322. [Google Scholar] [CrossRef] [PubMed]
- McClure, R.; Balasubramanian, D.; Sun, Y.; Bobrovskyy, M.; Sumby, P.; Genco, C.A.; Vanderpool, C.K.; Tjaden, B. Computational analysis of bacterial RNA-Seq data. Nucleic Acids Res. 2013, 41, e140. [Google Scholar] [CrossRef] [PubMed]
- Huang, H.-Y.; Chang, H.-Y.; Chou, C.-H.; Tseng, C.-P.; Ho, S.-Y.; Yang, C.-D.; Ju, Y.-W.; Huang, H.-D. sRNAMap: Genomic maps for small non-coding RNAs, their regulators and their targets in microbial genomes. Nucleic Acids Res. 2008, 37, D150–D154. [Google Scholar] [CrossRef] [PubMed]
- Cao, Y.; Wu, J.; Liu, Q.; Zhao, Y.; Ying, X.; Cha, L.; Wang, L.; Li, W. sRNATarBase: A comprehensive database of bacterial sRNA targets verified by experiments. RNA 2010, 16, 2051–2057. [Google Scholar] [CrossRef]
- Zhang, M.; Wong, T.C. Solution conformation study of substance P methyl ester and [Nle10]-neurokinin A (4-10) by nmr spectroscopy. Biopolymers 1993, 33, 1901–1908. [Google Scholar] [CrossRef]
- Krüger, J.; Rehmsmeier, M. RNAhybrid: microRNA target prediction easy, fast and flexible. Nucleic Acids Res. 2006, 34, W451–W454. [Google Scholar] [CrossRef] [PubMed]
- Tafer, H.; Hofacker, I.L. RNAplex: A fast tool for RNA–RNA interaction search. Bioinformatics 2008, 24, 2657–2663. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Kirkpatrick, L.A. A Simple Guide to IBM SPSS Statistics-Version 23; Cengage Learning: Boston, MA, USA, 2015. [Google Scholar]
- Vogel, J.; Luisi, B.F. Hfq and its constellation of RNA. Nat. Rev. Microbiol. 2011, 9, 578–589. [Google Scholar] [CrossRef] [PubMed]
- Davis, B.M.; Waldor, M.K. RNase E-dependent processing stabilizes MicX, a Vibrio cholerae sRNA. Mol. Microbiol. 2007, 65, 373–385. [Google Scholar] [CrossRef] [PubMed]
- Papenfort, K.; Förstner, K.U.; Cong, J.-P.; Sharma, C.M.; Bassler, B.L. Differential RNA-seq of Vibrio cholerae identifies the VqmR small RNA as a regulator of biofilm formation. Proc. Natl. Acad. Sci. USA 2015, 112, E766–E775. [Google Scholar] [CrossRef]
- Sharma, C.M.; Papenfort, K.; Pernitzsch, S.R.; Mollenkopf, H.; Hinton, J.C.D.; Vogel, J. Pervasive post-transcriptional control of genes involved in amino acid metabolism by the Hfq-dependent GcvB small RNA. Mol. Microbiol. 2011, 81, 1144–1165. [Google Scholar] [CrossRef] [PubMed]
- Janda, J.M. Current perspectives on the epidemiology and pathogenesis of clinically significant Vibrio spp. Khirurgiia 1988, 1, 114. [Google Scholar] [CrossRef] [PubMed]
- Church, S.R. Investigating Pathogenesis and Virulence of the Human Pathogen, Vibrio Vulnificus. 2015. Available online: http://hdl.handle.net/10871/17600 (accessed on 1 April 2015).
- Chen, Q.; Yan, Q.; Wang, K.; Zhuang, Z.; Wang, X. Portal of entry for pathogenic Vibrio alginolyticus into large yellow croaker Pseudosciaena crocea, and characteristics of bacterial adhesion to mucus. Dis. Aquat. Org. 2008, 80, 181–188. [Google Scholar] [CrossRef] [PubMed]
- Rendueles, O.; Kaplan, J.B.; Ghigo, J.M. Antibiofilm Polysaccharides. Environ. Microbiol. 2012, 15, 334–346. [Google Scholar] [CrossRef]
- Wang, B.; Yu, L.P.; Yuan, T.; Jiang, Z.Q. Pathogenicity of extracellular products of Vibrio harveyi to Fugu obscurus. J. Fish. Sci. China 2010, 17, 88–95. (in Chinese). [Google Scholar]
- Ransy, C.; Vaz, C.; Lombès, A.; Bouillaud, F. Use of H2O2 to cause oxidative stress, the catalase issue. Int. J. Mol. Sci. 2020, 21, 9149. [Google Scholar] [CrossRef]
- Salminen, S.; Isolauri, E. Intestinal colonization, microbiota, and probiotics. J. Pediatr. 2006, 149, S115–S120. [Google Scholar] [CrossRef]
- Bi, S.; Sourjik, V. Stimulus sensing and signal processing in bacterial chemotaxis. Curr. Opin. Microbiol. 2018, 45, 22–29. [Google Scholar] [CrossRef] [PubMed]
- Berg, P.; Singer, M.F. The recombinant DNA controversy: Twenty years later. Proc. Natl. Acad. Sci. USA 1995, 92, 9011–9013. [Google Scholar] [CrossRef] [PubMed]
- Liang, W.; Pascual-Montano, A.; Silva, A.J.; Benitez, J.A. The cyclic AMP receptor protein modulates quorum sensing, motility and multiple genes that affect intestinal colonization in Vibrio cholerae. Microbiology 2007, 153, 2964–2975. [Google Scholar] [CrossRef]
- Liu, H.; Wang, Q.; Liu, Q.; Cao, X.; Shi, C.; Zhang, Y. Roles of hfq in the stress adaptation and virulence in fish pathogen Vibrio alginolyticus and its potential application as a target for live attenuated vaccine. Appl. Microbiol. Biotechnol. 2011, 91, 353–364. [Google Scholar] [CrossRef]
- Markova, J.A.; Anganova, E.V.; Turskaya, A.L.; Bybin, V.A.; Savilov, E.D. Regulation of Escherichia coli biofilm formation. Appl. Biochem. Microbiol. 2018, 54, 1–11. [Google Scholar] [CrossRef]
- Bore, E.; Langsrud, S.; Langsrud, Ø.; Rode, T.M.; Holck, A. Acid-shock responses in Staphylococcus aureus investigated by global gene expression analysis. Microbiology 2007, 153, 2289–2303. [Google Scholar] [CrossRef] [PubMed]
- Mey, A.R.; Wyckoff, E.E.; Kanukurthy, V.; Fisher, C.R.; Payne, S.M. Iron and fur regulation in Vibrio cholerae and the role of fur in virulence. Infect. Immun. 2005, 73, 8167–8178. [Google Scholar] [CrossRef] [PubMed]
- Jukes, T.H. The present status and background of antibiotics in the feeding of domestic animals. Ann. N. Y. Acad. Sci. 1971, 182, 362–379. [Google Scholar] [CrossRef] [PubMed]
- Defoirdt, T. Virulence mechanisms of bacterial aquaculture pathogens and antivirulence therapy for aquaculture. Rev. Aquac. 2013, 6, 100–114. [Google Scholar] [CrossRef]
- Osei-Adjei, G.; Huang, X.; Zhang, Y. The extracellular proteases produced by Vibrio parahaemolyticus. World J. Microbiol. Biotechnol. 2018, 34, 68. [Google Scholar] [CrossRef] [PubMed]
- Liu, P.; Lee, K. Cysteine protease is a major exotoxin of pathogenic luminous Vibrio harveyi in the tiger prawn, Penaeus monodon. Lett. Appl. Microbiol. 1999, 28, 428–430. [Google Scholar] [CrossRef] [PubMed]
- Kwon, Y.T.; Kim, J.O.; Moon, S.Y.; Yoo, Y.D.; Rho, H.M. Cloning and characterization of the gene encoding an extracellular alkaline serine protease from Vibrio metschnikovii strain RH530. Gene 1995, 152, 59–63. [Google Scholar] [CrossRef] [PubMed]
Strains or Plasmids | Relevant Characteristics | Sources |
---|---|---|
V. harveyi | ||
345 | The wild-type strain V. haveyi 345 | [14] |
345∆hfq | hfq null mutant strain | This study |
345:pMMB207 (WT) | Chloramphenicol resistance (Cmr); the wild-type strain V. haveyi 345 with the control plasmid pMMB207 | This study |
345∆hfq:pMMB207 (∆hfq) | Cmr; the hfq null mutant strain V. haveyi 345∆hfq with the control plasmid pMMB207 | This study |
345∆hfq:pMMB207_hfq (Chfq) | Cmr; hfq null mutant strain V. haveyi 345hfq with the complemented plasmid pMMB207_hfq | This study |
E. coli | ||
Π3813 | Emrr, Tcr, lacIQ, thi1, supE44, endA1, recA1, hsdR17, gyrA462, zei298::tn10[Tc], ΔthyA:: (erm-pir116); the intermediate host of suicide vector pSW7848 | [15] |
GEB883 | Eryr, Tetr, WT E.coli K12 ΔdapA::erm pir RP4-2 ΔrecA gyrA462, zei298::Tn10; donor strain for conjugation | [16] |
Plasmids | ||
pSW7848 | Cmr; suicide vector with an R6K origin, requiring the Pir protein for its replication, and the ccdB toxin gene | [17] |
pSW7848_∆hfq | Cmr; pSW848 containing the UP-DWON fragment of ∆hfq | This study |
pMMB207 | Cmr; expression vector | [18] |
pMMB207_hfq | Cmr; pMMB207 containing intact hfq gene | This study |
Name | Sequence (5′-3′) | Purpose | Sources |
---|---|---|---|
pSW7848-F | GTCTGATTCGTTACCAATTATGACAAC | Linearization of pSW7848 | [18] |
pSW7848-R | GAATTCGATATCAAGCTTATCGATAC | ||
hfq-UP-F | aagcttgatatcgaattcCGGCGTTGATCTACAAAG | Amplification of hfq-UP | This study |
hfq-UP-R | tcaataggaTTTATTTTCCTTATTTAATTTGTAGTTG | ||
hfq-DOWN-F | ggaaaataaaTCCTATTGAAGAACACTGTTAACC | Amplification of hfq-DOWN | This study |
hfq-DOWN-R | ttggtaacgaatcagacGCATCAACAACATGTAACAAAATG | ||
Del-check-pSW7848-F | TCACTGTCCCTTATTCGCACC | Check the assembly of recombinant plasmid pSW7848_∆hfq | This study |
Del-check-pSW7848-R | CTGCTTTTGAGCACTACCCG | ||
△hfq-check-F | CAGGCACTTGAAACCATGTCAG | Check the detection of hfq | This study |
△hfq-check-R | CTCGCTCACCGGATTCATAAC | ||
pMMB207-F | AGAAGCGGTCTGATAAAACAGAATTTGC | Linearization of pMMB207 | [18] |
pMMB207-R | GCGCAACGCAATTAATGTAAGTTAG | ||
com-hfq-F | GCGATAACATTGAACAGGCAC | Amplification of hfq | This study |
com-hfq-R | GCAATTTCTTGTGCCTTACCC | ||
com-PMMB207-check-F | CTACTGAGCGCTGCCGCACA | Check the complementation of hfq | This study |
com-PMMB207-check-R | TCGTTTTATTTGATGCCTGGCAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Deng, Y.; Zang, S.; Lin, Z.; Xu, L.; Cheng, C.; Feng, J. The Pleiotropic Phenotypes Caused by an hfq Null Mutation in Vibrio harveyi. Microorganisms 2023, 11, 2741. https://doi.org/10.3390/microorganisms11112741
Deng Y, Zang S, Lin Z, Xu L, Cheng C, Feng J. The Pleiotropic Phenotypes Caused by an hfq Null Mutation in Vibrio harveyi. Microorganisms. 2023; 11(11):2741. https://doi.org/10.3390/microorganisms11112741
Chicago/Turabian StyleDeng, Yiqin, Shujun Zang, Ziyang Lin, Liwen Xu, Changhong Cheng, and Juan Feng. 2023. "The Pleiotropic Phenotypes Caused by an hfq Null Mutation in Vibrio harveyi" Microorganisms 11, no. 11: 2741. https://doi.org/10.3390/microorganisms11112741
APA StyleDeng, Y., Zang, S., Lin, Z., Xu, L., Cheng, C., & Feng, J. (2023). The Pleiotropic Phenotypes Caused by an hfq Null Mutation in Vibrio harveyi. Microorganisms, 11(11), 2741. https://doi.org/10.3390/microorganisms11112741