Next Article in Journal
Pan-Genome Analyses of the Genus Cohnella and Proposal of the Novel Species Cohnella silvisoli sp. nov., Isolated from Forest Soil
Next Article in Special Issue
Dry Stamping Coral Powder: An Effective Method for Isolating Coral Symbiotic Actinobacteria
Previous Article in Journal
Research of Multicopper Oxidase and Its Degradation of Histamine in Lactiplantibacillus plantarum LPZN19
Previous Article in Special Issue
Chemically Mediated Interactions with Macroalgae Negatively Affect Coral Health but Induce Limited Changes in Coral Microbiomes
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genomic Island-Encoded Diguanylate Cyclase from Vibrio alginolyticus Regulates Biofilm Formation and Motility in Pseudoalteromonas

1
Key Laboratory of Tropical Marine Bio-Resources and Ecology, Guangdong Key Laboratory of Marine Materia Medica, Innovation Academy of South China Sea Ecology and Environmental Engineering, South China Sea Institute of Oceanology, Chinese Academy of Sciences, No.1119, Haibin Road, Nansha District, Guangzhou 511458, China
2
College of Life Sciences, Hebei Normal University, Shijiazhuang 050024, China
3
Southern Marine Science and Engineering Guangdong Laboratory (Guangzhou), No.1119, Haibin Road, Nansha District, Guangzhou 511458, China
4
University of Chinese Academy of Sciences, Beijing 100049, China
*
Authors to whom correspondence should be addressed.
Microorganisms 2023, 11(11), 2725; https://doi.org/10.3390/microorganisms11112725
Submission received: 5 October 2023 / Revised: 3 November 2023 / Accepted: 5 November 2023 / Published: 8 November 2023
(This article belongs to the Special Issue Marine Microbial Diversity: Focus on Corals)

Abstract

:
Many bacteria use the second messenger c-di-GMP to regulate exopolysaccharide production, biofilm formation, motility, virulence, and other phenotypes. The c-di-GMP level is controlled by the complex network of diguanylate cyclases (DGCs) and phosphodiesterases (PDEs) that synthesize and degrade c-di-GMP. In addition to chromosomally encoded DGCs, increasing numbers of DGCs were found to be located on mobile genetic elements. Whether these mobile genetic element-encoded DGCs can modulate the physiological phenotypes in recipient bacteria after horizontal gene transfer should be investigated. In our previous study, a genomic island encoding three DGC proteins (Dgc137, Dgc139, and Dgc140) was characterized in Vibrio alginolyticus isolated from the gastric cavity of the coral Galaxea fascicularis. Here, the effect of the three DGCs in four Pseudoalteromonas strains isolated from coral Galaxea fascicularis and other marine environments was explored. The results showed that when dgc137 is present rather than the three DGC genes, it obviously modulates biofilm formation and bacterial motility in these Pseudoalteromonas strains. Our findings implied that mobile genetic element-encoded DGC could regulate the physiological status of neighboring bacteria in a microbial community by modulating the c-di-GMP level after horizontal gene transfer.

1. Introduction

Horizontal gene transfer is an important driving factor for the adaptation and evolution of bacterial communities, because it accelerates the exchange of genetic material between different strains or species [1]. Mobile genetic elements, such as prophages, plasmids, integrative and conjugative elements (ICEs), and genomic islands, are the main vectors that mediate horizontal gene transfer by delivering adaptive genes [2,3]. Horizontal gene transfer is thought to be pervasive in the coral microbiome, and offers significant and greatly unrecognized potential for the adaptive capacity of the coral microbiome to a rapidly changing environment [4].
Vibrio, Pseudoalteromonas, Alteromonas, and Shewanella are widely distributed in various marine environments, and these species often contain similar mobile genetic elements in their genomes [5,6,7,8]. These genera cohabit in the same ecological niches, e.g., the gastric cavity of coral [8], seawater, marine sediments, and hydrothermal vents [9], which provides the prerequisites for horizontal gene transfer among these species. ICEs of the SXT/R391 family are a large class of mobile genetic elements that play important roles in horizontal gene transfer among these species. SXT/R391 ICEs have been defined based on site-specific integration into prfC, a gene encoding peptide chain release factor 3. In recent years, atypical SXT/R391 ICEs have also been found to be integrated at a serine tRNA gene in Vibrio alginolyticus [10] or integrated at the pabB gene encoding para-aminobenzoate synthase component II in Pseudoalteromonas [8]. SXT/R391 ICEs are not only self-transmissible elements like conjugative plasmids, but can also integrate into and excise from the host chromosome [11]. Moreover, they can also drive the mobilization of a class of genomic islands integrated in the yicC gene [12], or transfer a tandem genomic island in cis among these species [7]. In addition to SXT/R391 ICEs, prophages or genomic islands integrated into the tRNA modification enzyme-encoding gene trmE, tRNA (uridine(54)-C5)-methyltransferase-encoding gene trmA, ssrA (small stable RNA A), or other tRNA-related genes were also characterized in these species [8,13,14]. The most attention to the cargo genes in these mobile genetic elements has been paid to the dissemination of antimicrobial resistance genes and heavy metal resistance across bacterial genomes [15,16]. The diversity of the functions of cargo genes remains seriously neglected.
Diguanylate cyclases (DGCs) are responsible for the synthesis of the second messenger cyclic di-guanosine monophosphate (c-di-GMP), which is a global bacterial second messenger that can regulate diverse physiological phenotypes [17]. DGCs have a conserved catalytic GGDEF domain that plays a key role in their activity. With an opposite function, bacteria also encode phosphodiesterases (PDEs), which are responsible for the degradation of c-di-GMP via an EAD or HD-GYP domain [18]. More than 60 chromosomally encoded genes in Vibrio cholerae related to c-di-GMP [19] and 45 putative GGDEF domain-containing proteins were found in Vibrio alginolyticus SCSIO 43097 (abbreviated Va43097) [8]. The redundancy of DGCs and PDEs in controlling cellular processes indicated the complexity of c-di-GMP regulation.
In addition to chromosomally encoded DGC genes, some DGCs were also found to be located on mobile genetic elements as cargo genes. Genes dgcK and dgcL were characterized in ICEVchMex1 belonging to SXT/R391 ICEs in V. cholerae 1-010118-075 and are frequently found in other SXT/R391 ICEs, including ICEVflInd1 in Vibrio fluvialis H-08942 and ICEVchMoz3 in V. cholerae 7AMOZ. Overexpression of DgcK or DgcL could modulate gene expression, biofilm formation, and bacterial motility [19]. Our previous study showed tight cooperation of SXT/R391 ICEs and mobilizable genomic islands integrated in yicC from Pseudoalteromonas spp. mediated the excision of the genomic island VPII integrated in trmA of Vibrio alginolyticus after horizontal gene transfer. The loss of VPII significantly reduced biofilm formation and phage resistance, but increased bacterial motility. VPII encoded three DGCs: Dgc137, Dgc139, and Dgc140, and Dgc137 was proven to be the main factor responsible for these phenotypic changes in its original host bacteria. Genes dgc137, dgc139, and dgc140-bearing genomic islands were also distributed in Vibrio diabolicus FDAARGOS_96 and V. alginolyticus ANC4-19 [8]. These reports demonstrated that the DGCs carried by mobile genetic elements can modulate the physiological phenotypes of their original host, similar to chromosomally encoded DGCs. As cargo genes, these DGC genes can be spread as antibiotic resistance genes by horizontal gene transfer. It is still unclear whether these DGCs can modulate the physiological phenotypes of recipient bacteria after horizontal gene transfer.
Here, to explore the effect of mobile genetic element-encoded DGCs in recipient strains after horizontal gene transfer, VPII-encoded DGCs were expressed in four Pseudoalteromonas species, which always cohabit in the same ecological niches as Vibrio. Two plasmids expressing a single Dgc137 or expressing three DGCs (Dgc137, Dgc139, and Dgc140) under their native promoters were constructed and transferred into four different Pseudoalteromonas strains. The results showed that the expression of Dgc137 modulates biofilm formation and bacterial motility in these Pseudoalteromonas strains. Our findings reveal that DGC proteins delivered by genomic islands could control the physiological phenotype of host bacteria after horizontal gene transfer.

2. Materials and Methods

2.1. Bacterial Strains

The bacterial strains and plasmids used in this study are listed in Table 1. Vibrio and Pseudoalteromonas strains were grown in 2216E medium (Difco) or SWLB (10 g peptone, 5 g yeast extract, and 1000 mL seawater) at 30 °C. Escherichia coli WM3064 was grown in LB medium containing 0.3 mM DAP (2,6-diamino-pimelic acid) at 37 °C. Modified LB medium (10 g peptone, 5 g yeast extract, 500 mL seawater, and 500 mL distilled water) with 0.3 mM DAP was used in conjugation assays. Cm (chloramphenicol, 30 μg mL−1) was used in E. coli, while 15 μg mL−1 Cm was used in Pseudoalteromonas.

2.2. Plasmid Construction

In plasmid pDgc137, a 1.4-kb fragment that contained the dgc137 gene and its promoter was amplified from Va43097 and inserted into the EcoRI/KpnI sites of plasmid pBBR1Cm [8]. Similarly, a 5.3-kb fragment containing dgc137, dgc139, and dgc140 was amplified from Va43097 using primers p3DGC-F (GTGACCGTGTGCTTCGAATTCGTGTTACTCTTTATCTGAGCG) and p3DGC-R (GGGAACAAAAGCTGGGTACCCTTGAAATCAGGTATTAGGAAG) and inserted into the same sites of plasmid pBBR1Cm using the ClonExpress II One Step Cloning Kit (Vazyme Biotech Co., Ltd.). The correct constructs were confirmed by PCR amplification and sequencing.

2.3. Conjugation Assays

The plasmids pDgc137 and p3DGC and the empty vector pBBR1Cm were transferred to Pseudoalteromonas using conjugation assays, as described previously [23]. Briefly, plasmids pDgc137, p3DGC, and pBBR1Cm were transformed into E. coli WM3064 to generate the donor strain, and Pseudoalteromonas was used as the recipient strain. Then, equal amounts of donor and recipient strains were harvested and dropped on modified LB agar medium after mixing. The plates were incubated for 8–12 h until a bacterial lawn was formed at 30 °C. Cells were collected from the lawn and streaked on 2216E plates with Cm to select the transconjugants.

2.4. Observation of Colony Morphology

The tested bacteria were inoculated overnight, and then 10 μL of overnight culture was spotted onto 2216E agar plates and incubated for 3–6 days at 30 °C. Colony morphology was imaged using stereoscopic microscopy.

2.5. Motility and Biofilm Assays

Swimming motility was measured using semisolid agar plates containing 0.3% agar (w/v) in 2216E medium after culturing for 15–52 h at 25 °C. Crystal violet staining was used to evaluate the amount of attached biofilm in 96-well polystyrene plates by measuring OD540 and OD620 [24]. The tested bacteria were stationary cultured in test tubes containing 2216E medium to form pellicles. Pellicle morphology was observed on the air–liquid interface of the medium and photographed at 36 h.

2.6. Prediction of GGDEF Domain-Containing Proteins

PFAM domain annotation of Pseudoalteromonas strains was performed using eggNOG-mapper v2 [25] (http://eggnog-mapper.embl.de, accessed on 27 September 2023) by uploading annotated genomes. GGDEF domain-containing proteins can be obtained from the generated files.

2.7. Statistics and Reproducibility

Data analyses were performed using GraphPad Prism 9 XML Project. The quantitative data were analyzed using unpaired t tests for two-sample comparisons. Asterisks represent statistically significant differences (ns, (not significant); * p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001). Individual data points are plotted with lines at the mean, and error bars represent the standard deviation in each figure. Biological replicates are shown in the figure legends.

3. Results

3.1. Dgc137 Regulates the Colony Biofilm of Pseudoalteromonas

Three DGC enzymes, Dgc137, Dgc139, and Dgc140 are encoded by VPII, and Dgc137 was proven to be the main factor regulating swimming and biofilm formation in Va43097 [8]. Thus, two plasmids, pDgc137 and p3DGC, were constructed. In plasmid pDgc137, a fragment containing the dgc137 gene with its native promoter was cloned in pBBR1Cm [8], and in p3DGC, a fragment containing all three DGC genes dgc137, dgc139, and dgc140 with their native promoters was cloned in the same sites of pBBR1Cm (Figure 1a). Then, four Pseudoalteromonas strains, including Pseudoalteromonas peptidolytica SCSIO 43201 (abbreviated Pp43201), Pseudoalteromonas flavipulchra SCSIO 43202 (abbreviated Pf43202), Pseudoalteromonas lipolytica SCSIO 04301 (abbreviated Pl04301), and Pseudoalteromonas rubra SCSIO 6842 (abbreviated Pr6842), representing different species, were selected as the recipient strains for DGC expression. These four strains were isolated from different ecological habitats in the neritic region; for example, Pp43201 and Pf43202 were isolated from the gastric cavity of the coral Galaxea fascicularis on Hainan Island, which is the same coral species as Va43097. Pl04301 was isolated from sediment at a depth of 63 m in the South China Sea, and Pr6842 was isolated from 150 m below the surface in the Bay of Bengal (Table 1). All four Pseudoalteromonas strains contain two chromosomes, and Pp43201 and Pr6842 also contain a plasmid. Pp43201, Pf43202, and Pr6842 are pigmented, and Pl04301 is nonpigmented. By searching the conserved domain at the eggNOG-mapper web, more than 50 putative GGDEF domain-containing proteins were found in the four Pseudoalteromonas strains. Among them, the Pl04301 genome encodes the most, with 68 GGDEF domain-containing proteins (Table 2 and Supplementary Materials Datasets 1–4).
Conjugation assays were performed to transfer the plasmids pDgc137 and p3DGC into the Pseudoalteromonas strains, and the empty vector pBBR1Cm was used as a control, generating four groups of Pseudoalteromonas strains bearing pDgc137, p3DGC, and pBBR1Cm. Then, these Pseudoalteromonas strains were grown on 2216E agar plates at 25 °C, and the formation of colony biofilms was observed. After culturing the strains for 4–6 days, the colonies were smooth in all pBBR1Cm-bearing Pseudoalteromonas strains, but the colonies were wrinkled in Pp43201, Pf43202, and Pl04301 and were striped in Pr6842 when pDgc137 was present. However, there were no significant changes in colony morphology when p3DGC was present in these Pseudoalteromonas compared with the empty vector (Figure 1b). These results suggested that the expression of Dgc137 alone can regulate the colony biofilms of P. peptidolytica, P. flavipulchra, P. lipolytica, and P. rubra, but simultaneous expression of the three DGC proteins cannot.

3.2. Dgc137 Increases the Attached Biofilm of Pseudoalteromonas

In addition to colony biofilms, Pseudoalteromonas strains commonly form attached biofilms at liquid‒solid interfaces and pellicles at air‒liquid interfaces. The changes in the attached biofilms of these Pseudoalteromonas strains were then analyzed using a 96-well microplate assay. As shown in Figure 2, expressing pDgc137 increased biofilm formation of all four Pseudoalteromonas strains to different degrees. When pDgc137 was present, biofilm formation increased by 2.7 ± 0.4-fold at 4 h in Pp43201, 6.4 ± 1.8-fold at 4 h in Pf43202, 4.4 ± 0.8-fold at 6 h in Pl04301, and 25.4 ± 7.8-fold at 6 h in Pr6842. When p3DGC was present, biofilm formation increased by 2.3 ± 1.7-fold at 4 h in Pf43202, 2.6 ± 0.7-fold at 6 h in Pl04301, and 10.4 ± 2.3-fold at 6 h in Pr6842, but had no significant effect on biofilm formation in Pp43201 at 2 h and 4 h.
By tracking the OD620 of these Pseudoalteromonas strains cultured in 96-well microplates at 0–8 h, we found that expressing pDgc137 and p3GDC had no significant effect on the growth of Pl04301. Notably, containing pDgc137 and p3GDC decreased the growth of Pp43201 but increased the growth of SCSIO 43202. Meanwhile, pDgc137 sharply decreased the growth of Pr6842, but p3DGC did not affect the growth of Pr6842.

3.3. Dgc137 Increases the Pellicle of Pseudoalteromonas

To assess the changes in pellicle formation, the strains were cultured statically in test tubes with 2216E liquid medium for 2–4 days. The four Pseudoalteromonas strains formed more floating pellicles when containing pDgc137 than when containing the empty vector pBBR1Cm. However, containing p3DGC did not show an obvious effect on the pellicle formation of the four Pseudoalteromonas strains (Figure 3). Collectively, DGC137 increases biofilm and pellicle formation in P. peptidolytica, P. flavipulchra, P. lipolytica, and P. rubra to different degrees.

3.4. Dgc137 Decreases the Motility of Pseudoalteromonas

Our previous study showed that Dgc137 and Dgc139 regulate swimming ability in Va43097 [8]. Therefore, a motility assay was also performed using semisolid agar plates. As shown in Figure 4, the four Pseudoalteromonas strains exhibited different motility abilities, and SCSIO 6842 exhibited the slowest swimming ability on semisolid agar. Therefore, these strains were incubated for different incubation times before imaging. Expressing pDgc137 significantly decreased the swimming ability of all four Pseudoalteromonas strains. Pp43201 containing pDgc137 (halo diameter of 1.3 ± 0.1 cm) had a significantly smaller swimming ability than that without the dgc137 gene (3.0 ± 0.1 cm), decreasing 2.4 ± 0.1-fold. Similarly, the halo diameter decreased by 1.9 ± 0.1-fold in Pf43202, 3.1 ± 1.1-fold in Pl04301, and 1.4 ± 0.1-fold in Pr6842 when pDgc137 was present compared with the control.
In contrast, the presence of p3DGC results in a different effect on the swimming ability of the four Pseudoalteromonas strains. With p3DGC, the halo diameter had the greatest change (3.2 ± 0.1 cm) in Pl04301, which decreased by 2.1 ± 0.4-fold compared to the empty vector (1.6 ± 0.3 cm), and decreased by 1.2 ± 0.1-fold in Pp43201 and Pr6842 when p3DGC was present. No significant difference was observed in the swimming ability of Pf43202 when p3DGC was present compared with pBBR1Cm (Figure 4b). These results suggested that DGC137 decreased swimming motility in the strains P. peptidolytica, P. flavipulchra, P. lipolytica, and P. rubra, whereas when the plasmid containing the three DGCs was conjugated, the effects depended on the strain.

4. Discussion

Pseudoalteromonas and Vibrio are widely distributed genera in coral and other marine environments [8,9,29], and commonly form biofilms to resist environmental stresses. Switching between biofilm and motile lifestyles is an important decision for them to adapt to changing environments and could be regulated by the c-di-GMP level [30,31]. This study provides evidence to show that a genomic island-encoded DGC protein from a coral-associated Vibrio alginolyticus could promote the transition of the motile style to the sessile style of Pseudoalteromonas strains. We propose that horizontal gene transfer might not only contribute to the dissemination of antimicrobial resistance genes and virulence genes as cargos, but also arbitrarily determine the physiological status of neighboring bacteria in a microbial community.
DGCs and PDEs are c-di-GMP metabolism proteins that modulate c-di-GMP levels [31]. A puzzling question in the study of c-di-GMP is why the bacterial cell possesses so many DGC and PDE proteins and how the bacteria integrate their contributions. In addition to SXT/R391 ICEs and VPII, DGC-encoding genes have been identified in other ICEs, bacteriophages, and plasmids [8,19]. This brings greater challenges in understanding the complexity of c-di-GMP regulation with the discovery of DGCs in increasing mobile genetic elements. DGC activity for the biosynthesis of c-di-GMP is catalyzed by a GGDEF domain. All the DGC proteins used in this study, Dgc137, Dgc139, and Dgc140, bear a GGDEF domain. Similar to its original Vibrio host, expressing Dgc137 had a more obvious effect than expressing the three DGCs on biofilm formation and motility in Pseudoalteromonas. Notably, the swimming ability decreased in all four Pseudoalteromonas strains, and the formation of colony biofilms, attached biofilms, and pellicles increased when Dgc137 was expressed. Dgc137 also affected the growth of Pp43201, Pf43202, and Pr6842 but had no influence on the growth of Pl04301, indicating that Dgc137 is involved in the varied physiological metabolism of Pseudoalteromonas. For Pr6842, expressing Dgc137 also affected the production of pigment. All these results indicated that the function of a DGC protein varies in different bacteria. This phenomenon is also found in the VieA protein, which enhances motility and represses biofilm formation in the classical biotype, but not in E1 Tor [32].
In addition to containing a GGDEF domain, many DGC proteins contain putative EAL domains or sensory domains, such as the Per/Arnt/Sim (PAS), GAF, CHASE, REC, and HK_sensor domains, adjacent to their GGDEF domain [18,33,34]. Dgc137 contains a PAS domain coupled with a GGDEF domain. Dgc139 contains both a GGDEF domain and an EAL domain, and Dgc140 contains a GGDEF domain coupled with two HK_sensor domains at the amino terminus [8]. In this study, more than 50 putative GGDEF domain-containing proteins were predicted in Pp43201, Pf43202, Pl04301, and Pr6842. How these proteins regulate biofilm formation and motility is unclear. To fully understand the function of Dgc137, Dgc139, and Dgc140 in these Pseudoalteromonas, their contributions to cellular c-di-GMP metabolism, the integrated pathways, and the environmental signals they sense should be further determined.
In our previous study, deletion of dgc137 resulted in similar phenotypic changes in biofilm formation and bacterial motility as deletion of VPII harboring dgc137, dgc139, and dgc140, suggesting that dgc137 plays a critical role in the regulation of biofilm formation and motility in V. alginolyticus. Transcriptome sequencing showed that the expression of dgc137, dgc139, and dgc140 is differentially expressed in V. alginolyticus, and the mRNA level of dgc137 is 3–5-fold higher than that of dgc139 and dgc140 [8]. In this study, simultaneous expression of Dgc137, Dgc139, and Dgc140 did not affect pellicle formation in any of the four Pseudoalteromonas strains but affected the colony biofilm, attached biofilm formation, and motility in some of them. These results indicated that the introduction of Dgc137 and Dgc140 might partly cancel out the activity of Dgc137 in these Pseudoalteromonas. Here, dgc137, dgc139, and dgc140 are also driven by their native promoters, whereas the expression of these genes in these Pseudoalteromonas should be further examined. Furthermore, bacterial activity in biofilms can organize complex cellular differentiation in space and time [35]. Manner et al. discovered that Pseudomonas aeruginosa drives the heterogeneity of c-di-GMP signaling in biofilms so that they can undertake division of labour strategies to control surface colonization [36,37]. Whether the three DGCs are involved in cellular differentiation during biofilm formation of Pseudoalteromonas should be further investigated.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/microorganisms11112725/s1, and PFAMs of GGDEF domain-containing proteins in Pp43201, Pf43202, Pl04301, and Pr6842 were included.

Author Contributions

X.W., D.L. and P.W. designed the study. T.C., H.T., W.W., X.D. and K.T. performed the experiments. T.C. and P.W. analyzed the study. X.W., D.L. and P.W. wrote the paper. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Science Foundation of China (42188102, 91951203, and 32070175), the National Key R&D Program of China (2022YFC3103600), the Foundation Incubation Fund of Chinese Academy of Sciences (JCPYJJ-22025), the Local Innovative and Research Teams Project of Guangdong Pearl River Talents Program (2019BT02Y262), the K. C. Wong Education Foundation (GJTD-2020-12), the Science and Technology Planning Project of Guangdong Province of China (2021B1212050023), and the Youth Innovation Promotion Association CAS (2021345 to PW).

Data Availability Statement

The authors declare that the data supporting the findings of this study are available within the article.

Acknowledgments

The authors thank Yan Wang, Ocean College, Hainan University, for the generous gifts of coral samples.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Brito, I.L. Examining horizontal gene transfer in microbial communities. Nat. Rev. Microbiol. 2021, 19, 442–453. [Google Scholar] [CrossRef]
  2. Horne, T.; Orr, V.T.; Hall, J.P.J. How do interactions between mobile genetic elements affect horizontal gene transfer? Curr. Opin. Microbiol. 2023, 73, 102282. [Google Scholar] [CrossRef]
  3. Arnold, B.J.; Huang, I.T.; Hanage, W.P. Horizontal gene transfer and adaptive evolution in bacteria. Nat. Rev. Microbiol. 2022, 20, 206–218. [Google Scholar] [CrossRef]
  4. Webster, N.S.; Reusch, T.B.H. Microbial contributions to the persistence of coral reefs. ISME J. 2017, 11, 2167–2174. [Google Scholar] [CrossRef]
  5. Bioteau, A.; Durand, R.; Burrus, V. Redefinition and Unification of the SXT/R391 Family of Integrative and Conjugative Elements. Appl. Environ. Microbiol. 2018, 84, e00485-18. [Google Scholar] [CrossRef]
  6. Daccord, A.; Ceccarelli, D.; Rodrigue, S.; Burrus, V. Comparative analysis of mobilizable genomic islands. J. Bacteriol. 2013, 195, 606–614. [Google Scholar] [CrossRef]
  7. Wang, P.; Zeng, Z.; Wang, W.; Wen, Z.; Li, J.; Wang, X. Dissemination and loss of a biofilm-related genomic island in marine Pseudoalteromonas mediated by integrative and conjugative elements. Environ. Microbiol. 2017, 19, 4620–4637. [Google Scholar] [CrossRef]
  8. Wang, P.; Zhao, Y.; Wang, W.; Lin, S.; Tang, K.; Liu, T.; Wood, T.K.; Wang, X. Mobile genetic elements used by competing coral microbial populations increase genomic plasticity. ISME J. 2022, 16, 2220–2229. [Google Scholar] [CrossRef]
  9. Tang, B.L.; Yang, J.; Chen, X.L.; Wang, P.; Zhao, H.L.; Su, H.N.; Li, C.Y.; Yu, Y.; Zhong, S.; Wang, L.; et al. A predator-prey interaction between a marine Pseudoalteromonas sp. and Gram-positive bacteria. Nat. Commun. 2020, 11, 285. [Google Scholar] [CrossRef]
  10. Luo, P.; He, X.; Wang, Y.; Liu, Q.; Hu, C. Comparative genomic analysis of six new-found integrative conjugative elements (ICEs) in Vibrio alginolyticus. BMC Microbiol. 2016, 16, 79. [Google Scholar] [CrossRef]
  11. Wozniak, R.A.; Waldor, M.K. Integrative and conjugative elements: Mosaic mobile genetic elements enabling dynamic lateral gene flow. Nat. Rev. Microbiol. 2010, 8, 552–563. [Google Scholar] [CrossRef] [PubMed]
  12. Daccord, A.; Ceccarelli, D.; Burrus, V. Integrating conjugative elements of the SXT/R391 family trigger the excision and drive the mobilization of a new class of Vibrio genomic islands. Mol. Microbiol. 2010, 78, 576–588. [Google Scholar] [CrossRef] [PubMed]
  13. Liu, X.; Tang, K.; Zhang, D.; Li, Y.; Liu, Z.; Yao, J.; Wood, T.K.; Wang, X. Symbiosis of a P2-family phage and deep-sea Shewanella putrefaciens. Environ. Microbiol. 2019, 21, 4212–4232. [Google Scholar] [CrossRef] [PubMed]
  14. Chibani, C.M.; Roth, O.; Liesegang, H.; Wendling, C.C. Genomic variation among closely related Vibrio alginolyticus strains is located on mobile genetic elements. BMC Genom. 2020, 21, 354. [Google Scholar] [CrossRef]
  15. Partridge, S.R.; Kwong, S.M.; Firth, N.; Jensen, S.O. Mobile genetic elements associated with antimicrobial resistance. Clin. Microbiol. Rev. 2018, 31, e00088-17. [Google Scholar] [CrossRef]
  16. Ellabaan, M.M.H.; Munck, C.; Porse, A.; Imamovic, L.; Sommer, M.O.A. Forecasting the dissemination of antibiotic resistance genes across bacterial genomes. Nat. Commun. 2021, 12, 2435. [Google Scholar] [CrossRef]
  17. Camilli, A.; Bassler, B.L. Bacterial small-molecule signaling pathways. Science 2006, 311, 1113–1116. [Google Scholar] [CrossRef]
  18. Simm, R.; Morr, M.; Kader, A.; Nimtz, M.; Romling, U. GGDEF and EAL domains inversely regulate cyclic di-GMP levels and transition from sessility to motility. Mol. Microbiol. 2004, 53, 1123–1134. [Google Scholar] [CrossRef]
  19. Bordeleau, E.; Brouillette, E.; Robichaud, N.; Burrus, V. Beyond antibiotic resistance: Integrating conjugative elements of the SXT/R391 family that encode novel diguanylate cyclases participate to c-di-GMP signalling in Vibrio cholerae. Environ. Microbiol. 2010, 12, 510–523. [Google Scholar] [CrossRef]
  20. Wang, W.; Tang, K.; Wang, P.; Zeng, Z.; Xu, T.; Zhan, W.; Liu, T.; Wang, Y.; Wang, X. The coral pathogen Vibrio coralliilyticus kills non-pathogenic holobiont competitors by triggering prophage induction. Nat. Ecol. Evol. 2022, 6, 1132–1144. [Google Scholar] [CrossRef]
  21. Zeng, Z.; Guo, X.P.; Li, B.; Wang, P.; Cai, X.; Tian, X.; Zhang, S.; Yang, J.L.; Wang, X. Characterization of self-generated variants in Pseudoalteromonas lipolytica biofilm with increased antifouling activities. Appl. Microbiol. Biotechnol. 2015, 99, 10127–10139. [Google Scholar] [CrossRef] [PubMed]
  22. Li, B.; Wang, P.; Zeng, Z.; Cai, X.; Wang, G.; Wang, X. Complete genome sequence of Pseudoalteromonas rubra SCSIO 6842, harboring a putative conjugative plasmid pMBL6842. J. Biotechnol. 2016, 224, 66–67. [Google Scholar] [CrossRef]
  23. Wang, P.; Yu, Z.; Li, B.; Cai, X.; Zeng, Z.; Chen, X.; Wang, X. Development of an efficient conjugation-based genetic manipulation system for Pseudoalteromonas. Microb. Cell Factories 2015, 14, 11. [Google Scholar] [CrossRef] [PubMed]
  24. Zeng, Z.; Liu, X.; Yao, J.; Guo, Y.; Li, B.; Li, Y.; Jiao, N.; Wang, X. Cold adaptation regulated by cryptic prophage excision in Shewanella oneidensis. ISME J. 2016, 10, 2787–2800. [Google Scholar] [CrossRef] [PubMed]
  25. Cantalapiedra, C.P.; Hernandez-Plaza, A.; Letunic, I.; Bork, P.; Huerta-Cepas, J. eggNOG-mapper v2: Functional annotation, orthology assignments, and domain prediction at the metagenomic scale. Mol. Biol. Evol. 2021, 38, 5825–5829. [Google Scholar] [CrossRef]
  26. Tang, K.; Zhan, W.; Zhou, Y.; Xu, T.; Chen, X.; Wang, W.; Zeng, Z.; Wang, Y.; Wang, X. Antagonism between coral pathogen Vibrio coralliilyticus and other bacteria in the gastric cavity of scleractinian coral Galaxea fascicularis. Sci. China Earth Sci. 2020, 63, 157–166. [Google Scholar] [CrossRef]
  27. Zeng, Z.; Dai, S.; Xie, Y.; Tian, X.; Li, J.; Wang, X. Genome sequences of two Pseudoalteromonas strains isolated from the South china sea. Genome Announc. 2014, 2, e00305-14. [Google Scholar] [CrossRef]
  28. Ni, S.; Li, B.; Tang, K.; Yao, J.; Wood, T.K.; Wang, P.; Wang, X. Conjugative plasmid-encoded toxin-antitoxin system PrpT/PrpA directly controls plasmid copy number. Proc. Natl. Acad. Sci. USA 2021, 118, e2011577118. [Google Scholar] [CrossRef]
  29. Jiang, W.-X.; Li, P.-Y.; Chen, X.-L.; Zhang, Y.-S.; Wang, J.-P.; Wang, Y.-J.; Sheng, Q.; Sun, Z.-Z.; Qin, Q.-L.; Ren, X.-B.; et al. A pathway for chitin oxidation in marine bacteria. Nat. Commun. 2022, 13, 5899. [Google Scholar] [CrossRef]
  30. Flemming, H.C.; Wingender, J.; Szewzyk, U.; Steinberg, P.; Rice, S.A.; Kjelleberg, S. Biofilms: An emergent form of bacterial life. Nat. Rev. Microbiol. 2016, 14, 563–575. [Google Scholar] [CrossRef]
  31. Hengge, R. Principles of c-di-GMP signalling in bacteria. Nat. Rev. Microbiol. 2009, 7, 263–273. [Google Scholar] [CrossRef] [PubMed]
  32. Beyhan, S.; Tischler, A.D.; Camilli, A.; Yildiz, F.H. Differences in gene expression between the classical and El tor biotypes of Vibrio cholerae O1. Infect. Immun. 2006, 74, 3633–3642. [Google Scholar] [CrossRef]
  33. Bridges, A.A.; Prentice, J.A.; Wingreen, N.S.; Bassler, B.L. Signal transduction network principles underlying Bacterial collective behaviors. Annu. Rev. Microbiol. 2022, 76, 235–257. [Google Scholar] [CrossRef] [PubMed]
  34. Conner, J.G.; Zamorano-Sanchez, D.; Park, J.H.; Sondermann, H.; Yildiz, F.H. The ins and outs of cyclic di-GMP signaling in Vibrio cholerae. Curr. Opin. Microbiol. 2017, 36, 20–29. [Google Scholar] [CrossRef]
  35. Chou, K.T.; Lee, D.D.; Chiou, J.G.; Galera-Laporta, L.; Ly, S.; Garcia-Ojalvo, J.; Suel, G.M. A segmentation clock patterns cellular differentiation in a bacterial biofilm. Cell 2022, 185, 145–157. [Google Scholar] [CrossRef] [PubMed]
  36. Manner, C.; Dias Teixeira, R.; Saha, D.; Kaczmarczyk, A.; Zemp, R.; Wyss, F.; Jaeger, T.; Laventie, B.J.; Boyer, S.; Malone, J.G.; et al. A genetic switch controls Pseudomonas aeruginosa surface colonization. Nat. Microbiol. 2023, 8, 1520–1533. [Google Scholar] [CrossRef] [PubMed]
  37. Gomez, J.B.; Waters, C.M. Switching on cyclic di-GMP heterogeneity in Pseudomonas aeruginosa biofilms. Nat. Microbiol. 2023, 8, 1380–1381. [Google Scholar] [CrossRef]
Figure 1. The change in colony biofilm formation when DGC137 and three DGC proteins were expressed in Pseudoalteromonas strians. (a) Construction of pDgc137 and p3DGC. The DNA regions contained in pDgc137 and p3DGC are indicated as solid lines with the ORFs, and the end of the DNA region is indicated as dashed lines. (b) The change in colony biofilm in the indicated Pseudoalteromonas strains containing pDgc137 and p3DGC compared with the empty vector. “p” indicates the empty vector pBBR1Cm. At least three independent cultures were used, and only representative images are shown. The incubation days of the colony biofilm imaged are indicated under the strain name.
Figure 1. The change in colony biofilm formation when DGC137 and three DGC proteins were expressed in Pseudoalteromonas strians. (a) Construction of pDgc137 and p3DGC. The DNA regions contained in pDgc137 and p3DGC are indicated as solid lines with the ORFs, and the end of the DNA region is indicated as dashed lines. (b) The change in colony biofilm in the indicated Pseudoalteromonas strains containing pDgc137 and p3DGC compared with the empty vector. “p” indicates the empty vector pBBR1Cm. At least three independent cultures were used, and only representative images are shown. The incubation days of the colony biofilm imaged are indicated under the strain name.
Microorganisms 11 02725 g001
Figure 2. The change in biofilm formation and growth when the indicated Pseudoalteromonas strains contained pDgc137 and p3DGC compared with the empty vector pBBR1Cm. Biofilm formation and growth of Pp43201 (a), Pf43202 (b), Pl04301 (c), and Pr6842 (d) when pDgc137, p3DGC, and pBBR1Cm were expressed. “p” indicates pBBR1Cm. The host bacteria are indicated at the top of each panel. All the tested bacteria were cultured in 2216E medium for 0–8 h, and only the data from representative time points are shown. Individual data points are plotted with lines at the mean, and error bars represent the standard deviation. Statistical analysis: Unpaired t-test, asterisks represent statistically significant differences (ns, (not significant); * p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001).
Figure 2. The change in biofilm formation and growth when the indicated Pseudoalteromonas strains contained pDgc137 and p3DGC compared with the empty vector pBBR1Cm. Biofilm formation and growth of Pp43201 (a), Pf43202 (b), Pl04301 (c), and Pr6842 (d) when pDgc137, p3DGC, and pBBR1Cm were expressed. “p” indicates pBBR1Cm. The host bacteria are indicated at the top of each panel. All the tested bacteria were cultured in 2216E medium for 0–8 h, and only the data from representative time points are shown. Individual data points are plotted with lines at the mean, and error bars represent the standard deviation. Statistical analysis: Unpaired t-test, asterisks represent statistically significant differences (ns, (not significant); * p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001).
Microorganisms 11 02725 g002
Figure 3. The change in pellicle formation when the indicated Pseudoalteromonas strains containing pDgc137 and p3DGC were compared with the empty vector. “p” indicates the empty vector pBBR1Cm. The white arrows indicate floating pellicles. The incubation days of the pellicle imaged are also shown on the left of the image. At least three independent cultures were used, and only representative images are shown.
Figure 3. The change in pellicle formation when the indicated Pseudoalteromonas strains containing pDgc137 and p3DGC were compared with the empty vector. “p” indicates the empty vector pBBR1Cm. The white arrows indicate floating pellicles. The incubation days of the pellicle imaged are also shown on the left of the image. At least three independent cultures were used, and only representative images are shown.
Microorganisms 11 02725 g003
Figure 4. The change in swimming ability when the indicated Pseudoalteromonas strians contained pDgc137 and p3DGC compared with the empty vector. Swimming diameter when the indicated Pseudoalteromonas strains containing pDgc137 (a), and p3DGC (b) were compared with the empty vector. “p” indicates the empty vector pBBR1Cm. The plates were imaged after culturing the strains in semisolid agar plates for 22 h (Pp43201), 43202 15 h (Pf43020), 22 h (Pl04301), and 52 h (Pr6842). At least three independent cultures were used, and only representative images are shown. Quantitative statistical data are shown under the representative images. Statistical analysis: Unpaired t-test, asterisks represent statistically significant differences (ns, (not significant); - *** p < 0.001; **** p < 0.0001).
Figure 4. The change in swimming ability when the indicated Pseudoalteromonas strians contained pDgc137 and p3DGC compared with the empty vector. Swimming diameter when the indicated Pseudoalteromonas strains containing pDgc137 (a), and p3DGC (b) were compared with the empty vector. “p” indicates the empty vector pBBR1Cm. The plates were imaged after culturing the strains in semisolid agar plates for 22 h (Pp43201), 43202 15 h (Pf43020), 22 h (Pl04301), and 52 h (Pr6842). At least three independent cultures were used, and only representative images are shown. Quantitative statistical data are shown under the representative images. Statistical analysis: Unpaired t-test, asterisks represent statistically significant differences (ns, (not significant); - *** p < 0.001; **** p < 0.0001).
Microorganisms 11 02725 g004
Table 1. Strains and plasmids used in this study.
Table 1. Strains and plasmids used in this study.
Strains/PlasmidsDescription Reference
Va43097Vibrio alginolyticus SCSIO 43097, isolated from the gastric cavity of coral Galaxea fascicularis in China: Hainan Island[8]
Pp43201Pseudoalteromonas peptidolylytica SCSIO 43201, isolated from the gastric cavity of coral Galaxea fascicularis in China: Hainan Island[20]
Pf43202Pseudoalteromonas flavipulchra SCSIO 43202, isolated from the gastric cavity of coral Galaxea fascicularis in China: Hainan Island[20]
Pl04301Pseudoalteromonas lipolytica SCSIO 04301, isolated from sediment at 63 m deep in the South China Sea (18°0′ = N, 109°42′ = E)[21]
Pr6842Pseudoalteromona rubra SCSIO 6842, isolated from 150 m below surface at Bay of Bengal[22]
VPIIGenomic island integrated in trmA of Va43097[8]
pBBR1CmpBBR1MCS-Cm, broad host range cloning vector containing chloramphenicol resistance gene[21]
pDgc137DNA fragment containing gene dgc137 with its promoter cloned and inserted into pBBR1Cm[8]
p3DGCDNA fragment containing genes dgc137 to dgc140 of VPII cloned and inserted into pBBR1CmThis study
Table 2. Genetic information of the four Pseudoalteromonas strains used in this study.
Table 2. Genetic information of the four Pseudoalteromonas strains used in this study.
StrainsGenome ContentSize (Mb)Predicted GenesGGDEF Domain-Containing Proteins aAccession NumbersReference
Pp432012 chromosomes and 1 plasmid5.2437451CP072683.1, CP072684.1, CP072685.1[20,26]
Pf432022 chromosomes5.4470555CP024625.1, CP024626.1[20,26]
Pl043012 chromosomes4.7422068GCA_000576675.1[27]
Pr68422 chromosomes and 1 plasmid5.9499851CP013611.1, CP013612.1, CP013613.1,[22,28]
a, The GGDEF domain-containing proteins in Pp43201, Pf43202, Pl04301, and Pr6842 are listed in Supplementary Materials Datasets 1–4.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Cai, T.; Tang, H.; Du, X.; Wang, W.; Tang, K.; Wang, X.; Liu, D.; Wang, P. Genomic Island-Encoded Diguanylate Cyclase from Vibrio alginolyticus Regulates Biofilm Formation and Motility in Pseudoalteromonas. Microorganisms 2023, 11, 2725. https://doi.org/10.3390/microorganisms11112725

AMA Style

Cai T, Tang H, Du X, Wang W, Tang K, Wang X, Liu D, Wang P. Genomic Island-Encoded Diguanylate Cyclase from Vibrio alginolyticus Regulates Biofilm Formation and Motility in Pseudoalteromonas. Microorganisms. 2023; 11(11):2725. https://doi.org/10.3390/microorganisms11112725

Chicago/Turabian Style

Cai, Tongxuan, Huan Tang, Xiaofei Du, Weiquan Wang, Kaihao Tang, Xiaoxue Wang, Dong Liu, and Pengxia Wang. 2023. "Genomic Island-Encoded Diguanylate Cyclase from Vibrio alginolyticus Regulates Biofilm Formation and Motility in Pseudoalteromonas" Microorganisms 11, no. 11: 2725. https://doi.org/10.3390/microorganisms11112725

APA Style

Cai, T., Tang, H., Du, X., Wang, W., Tang, K., Wang, X., Liu, D., & Wang, P. (2023). Genomic Island-Encoded Diguanylate Cyclase from Vibrio alginolyticus Regulates Biofilm Formation and Motility in Pseudoalteromonas. Microorganisms, 11(11), 2725. https://doi.org/10.3390/microorganisms11112725

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop