Relating Antimicrobial Resistance and Virulence in Surface-Water E. coli
Abstract
1. Introduction
2. Materials and Methods
3. Results
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- O’Neill, J. Antimicrobial Resistance: Tackling a Crisis for the Health and Wealth of Nations. Review on Antimicrobial Resistance. 2014. Available online: https://wellcomecollection.org/works/rdpck35v (accessed on 24 October 2023).
- Baquero, F.; Martínez, J.L.; Cantón, R. Antibiotics and Antibiotic Resistance in Water Environments. Curr. Opin. Biotechnol. 2008, 19, 260–265. [Google Scholar] [CrossRef] [Scilit]
- Finley, R.L.; Collignon, P.; Larsson, D.G.J.; Mcewen, S.A.; Li, X.Z.; Gaze, W.H.; Reid-Smith, R.; Timinouni, M.; Graham, D.W.; Topp, E. The Scourge of Antibiotic Resistance: The Important Role of the Environment. Clin. Infect. Dis. 2013, 57, 704–710. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Viegas, C.; Viegas, S.; Gomes, A.Q.; Täubel, M.; Sabino, R. Bacterial Resistances. In Exposure to Microbiological Agents in Indoor and Occupational Environments; Springer International: Berlin/Heidelberg, Germany, 2017; pp. 1–415. ISBN 9783319616889. [Google Scholar]
- Overbey, K.N.; Hatcher, S.M.; Stewart, J.R. Water Quality and Antibiotic Resistance at Beaches of the Galápagos Islands. Front. Environ. Sci. 2015, 3, 64. [Google Scholar] [CrossRef] [Scilit]
- Kay, P.; Blackwell, P.A.; Boxall, A.B.A. Transport of Veterinary Antibiotics in Overland Flow Following the Application of Slurry to Arable Land. Chemosphere 2005, 59, 951–959. [Google Scholar] [CrossRef] [Scilit]
- Huijbers, P.M.C.; Blaak, H.; De Jong, M.C.M.; Graat, E.A.M.; Vandenbroucke-Grauls, C.M.J.E.; De Roda Husman, A.M. Role of the Environment in the Transmission of Antimicrobial Resistance to Humans: A Review. Environ. Sci. Technol. 2015, 49, 11993–12004. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ashbolt, N.J.; Amézquita, A.; Backhaus, T.; Borriello, P.; Brandt, K.K.; Collignon, P.; Coors, A.; Finley, R.; Gaze, W.H.; Heberer, T.; et al. Human Health Risk Assessment (HHRA) for Environmental Development and Transfer of Antibiotic Resistance. Environ. Health Perspect. 2013, 121, 993–1001. [Google Scholar] [CrossRef] [Scilit]
- Zhang, L.; Levy, K.; Trueba, G.; Cevallos, W.; Trostle, J.; Eisenberg, J.N.S.; Foxman, B.; Marrs, C.F. Effects of Selection Pressure and Genetic Association on the Relationship between Antibiotic Resistance and Virulence in Escherichia coli. Antimicrob. Agents Chemother. 2015, 59, 6733–6740. [Google Scholar] [CrossRef] [Scilit]
- Shah, C.; Baral, R.; Bartaula, B.; Shrestha, L.B. Virulence Factors of Uropathogenic Escherichia coli (UPEC) and Correlation with Antimicrobial Resistance. BMC Microbiol. 2019, 19, 204. [Google Scholar] [CrossRef] [Scilit]
- Travis, R.M.; Gyles, C.L.; Reid-Smith, R.; Poppe, C.; McEwen, S.A.; Friendship, R.; Janecko, N.; Boerlin, P. Chloramphenicol and Kanamycin Resistance among Porcine Escherichia coli in Ontario. J. Antimicrob. Chemother. 2006, 58, 173–177. [Google Scholar] [CrossRef] [Scilit]
- Johnson, J.R.; Kuskowski, M.A.; Owens, K.; Gajewski, A.; Winokur, P.L. Phylogenetic Origin and Virulence Genotype in Relation to Resistance to Fluoroquinolones and/or Extended-Spectrum Cephalosporins and Cephamycins among Escherichia coli Isolates from Animals and Humans. J. Infect. Dis. 2003, 188, 759–768. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Orden, J.A.; Ruiz-Santa-Quiteria, J.A.; García, S.; Cid, D.; De La Fuente, R. In Vitro Susceptibility of Escherichia coli Strains Isolated from Diarrhoeic Dairy Calves to 15 Antimicrobial Agents. J. Vet. Med. Ser. B 2000, 47, 329–335. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- San Millan, A.; MacLean, R.C. Fitness Costs of Plasmids: A Limit to Plasmid Transmission. Microbiol. Spectr. 2017, 5, 1–12. [Google Scholar] [CrossRef] [Scilit]
- Koczura, R.; Mokracka, J.; Barczak, A.; Krysiak, N.; Kaznowski, A. Association between the Presence of Class 1 Integrons, Virulence Genes, and Phylogenetic Groups of Escherichia coli Isolates from River Water. Microb. Ecol. 2013, 65, 84–90. [Google Scholar] [CrossRef] [Scilit]
- Sidhu, J.P.S.; Jagals, P.; Smith, A.; Toze, S. Comparative Prevalence of Escherichia coli Carrying Virulence Genes and Class 1 and 2 Integrons in Sub-Tropical and Cool Temperate Freshwater. Environ. Sci. Pollut. Res. 2017, 24, 18263–18272. [Google Scholar] [CrossRef] [Scilit]
- Stange, C.; Sidhu, J.P.S.; Tiehm, A.; Toze, S. Antibiotic Resistance and Virulence Genes in Coliform Water Isolates. Int. J. Hyg. Environ. Health 2016, 219, 823–831. [Google Scholar] [CrossRef] [Scilit]
- Jeamsripong, S.; Kuldee, M.; Thaotumpitak, V.; Chuanchuen, R. Antimicrobial Resistance, Extended-Spectrum β-Lactamase Production and Virulence Genes in Salmonella enterica and Escherichia coli Isolates from Estuarine Environment. PLoS ONE 2023, 18, e0283359. [Google Scholar] [CrossRef] [Scilit]
- Singh, A.K.; Das, S.; Kumar, S.; Gajamer, V.R.; Najar, I.N.; Lepcha, Y.D.; Tiwari, H.K.; Singh, S. Distribution of Antibiotic-Resistant Enterobacteriaceae Pathogens in Potable Spring Water of Eastern Indian Himalayas: Emphasis on Virulence Gene and Antibiotic Resistance Genes in Escherichia coli. Front. Microbiol. 2020, 11, 581072. [Google Scholar] [CrossRef] [Scilit]
- Chen, B.; Zheng, W.; Yu, Y.; Huang, W.; Zheng, S.; Zhang, Y.; Guan, X.; Zhuang, Y.; Chen, N.; Topp, E. Class 1 Integrons, Selected Virulence Genes, and Antibiotic Resistance in Escherichia coli Isolates from the Minjiang River, Fujian Province, China. Appl. Environ. Microbiol. 2011, 77, 148–155. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Christenson, E.; Wickersham, L.; Jacob, M.; Stewart, J. A Watershed Study Assessing Effects of Commercial Hog Operations on Microbial Water Quality in North Carolina, USA. Sci. Total Environ. 2022, 838, 11. [Google Scholar] [CrossRef] [Scilit]
- Harden, S.L. Surface-Water Quality in Agricultural Watersheds of the North Carolina Coastal Plain Associated with Concentrated Animal Feeding Operations; US Geological Survey: Reston, VA, USA, 2015. [Google Scholar]
- CLSI M100; Performance Standards for Antimicrobial Disk Susceptibility Testing. Clinical & Laboratory Standards Institute: Wayne, NJ, USA, 2017.
- Gunzburg, S.T.; Tornieporth, N.G.; Riley, L.W. Identification of Enteropathogenic Escherichia coli by PCR-Based Detection of the Bundle-Forming Pilus Gene. J. Clin. Microbiol. 1995, 33, 1375–1377. [Google Scholar]
- Arné, A.P.; Marc, D.; Brée, A.; Schouler, C.; Arne, P.; Marc, A.D.; Br, B.A.; Schouler, C. Increased Tracheal Colonization in Chickens without Impairing Pathogenic Properties of Avian Pathogenic Escherichia coli MT78 with a FimH Deletion. Avian Dis. 2000, 44, 343–355. [Google Scholar] [CrossRef] [Scilit]
- DebRoy, C.; Maddox, C.W. Identification of Virulence Attributes of Gastrointestinal Escherichia coli Isolates of Veterinary Significance. Anim. Health Res. Rev. 2001, 2, 129–140. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zajacova, Z.S.; Konstantinova, L.; Alexa, P. Detection of Virulence Factors of Escherichia coli Focused on Prevalence of EAST1 Toxin in Stool of Diarrheic and Non-Diarrheic Piglets and Presence of Adhesion Involving Virulence Factors in AstA Positive Strains. Vet. Microbiol. 2012, 154, 369–375. [Google Scholar] [CrossRef] [Scilit]
- Bai, J.; Shi, X.; Nagaraja, T.G. A Multiplex PCR Procedure for the Detection of Six Major Virulence Genes in Escherichia coli O157:H7. J. Microbiol. Methods 2010, 82, 85–89. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moulin-Schouleur, M.; Schouler, C.; Tailliez, P.; Kao, M.R.; Brée, A.; Germon, P.; Oswald, E.; Mainil, J.; Blanco, M.; Blanco, J. Common Virulence Factors and Genetic Relationships between O18:K1:H7 Escherichia coli Isolates of Human and Avian Origin. J. Clin. Microbiol. 2006, 44, 3484–3492. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Blanco, M.; Blanco, J.E.; Blanco, J.; Alonso, M.P.; Balsalobre, C.; Mouriño, M.; Madrid, C.; Juárez, A. Polymerase Chain Reaction for Detection in Escherichia coli Strains Producing Cytotoxic Necrotizing Factor Type 1 and Type 2 (CNF1 and CNF2). J. Microbiol. Methods 1996, 26, 95–101. [Google Scholar]
- Ojeniyi, B.; Ahrens, P.; Meyling, A. Detection of Fimbrial and Toxin Genes in Escherichia coli and Their Prevalence in Piglets with Diarrhoea. The Application of Colony Hybridization Assay, Polymerase Chain Reaction and Phenotypic Assays. J. Vet. Med. B 1994, 41, 49–59. [Google Scholar] [CrossRef] [Scilit]
- Yamamoto, T.; Nakazawa, M. Detection and Sequences of the Enteroaggregative Escherichia coli Heat-Stable Enterotoxin 1 Gene in Enterotoxigenic E. Coli Strains Isolated from Piglets and Calves with Diarrhea. J. Clin. Microbiol. 1997, 35, 223–227. [Google Scholar] [CrossRef] [Scilit]
- Bradford, S.A.; Morales, V.L.; Zhang, W.; Harvey, R.W.; Packman, A.I.; Mohanram, A.; Welty, C. Transport and Fate of Microbial Pathogens in Agricultural Settings. Crit. Rev. Environ. Sci. Technol. 2013, 43, 775–893. [Google Scholar] [CrossRef] [Scilit]
- Fekete, P.Z.; Brzuszkiewicz, E.; Blum-Oehler, G.; Olasz, F.; Szabó, M.; Gottschalk, G.; Hacker, J.; Nagy, B. DNA Sequence Analysis of the Composite Plasmid PTC Conferring Virulence and Antimicrobial Resistance for Porcine Enterotoxigenic Escherichia coli. Int. J. Med. Microbiol. 2012, 302, 4–9. [Google Scholar] [CrossRef] [Scilit]
- Ahmed, W.; Tucker, J.; Bettelheim, K.A.; Neller, R.; Katouli, M. Detection of Virulence Genes in Escherichia coli of an Existing Metabolic Fingerprint Database to Predict the Sources of Pathogenic E. coli in Surface Waters. Water Res. 2007, 41, 3785–3791. [Google Scholar] [CrossRef] [Scilit]
- Masters, N.; Wiegand, A.; Ahmed, W.; Katouli, M. Escherichia coli Virulence Genes Profile of Surface Waters as an Indicator of Water Quality. Water Res. 2011, 45, 6321–6333. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sokurenko, E.V.; Chesnokova, V.; Dykhuizen, D.E.; Ofek, I.; Wu, X.R.; Krogfelt, K.A.; Struve, G.; Schembri, M.A.; Hasty, D.L. Pathogenic Adaptation of Escherichia coli by Natural Variation of the FimH Adhesin. Proc. Natl. Acad. Sci. USA 1998, 95, 8922–8926. [Google Scholar] [CrossRef] [Scilit]
- Connell, H.; Agace, W.; Klemm, P.; Schembri, M.; Mårild, S.; Svanborg, C. Type 1 Fimbrial Expression Enhances Escherichia coli Virulence for the Urinary Tract. Proc. Natl. Acad. Sci. USA 1996, 93, 9827–9832. [Google Scholar] [CrossRef] [Scilit]
- Nordstrom, L.; Liu, C.M.; Price, L.B. Foodborne Urinary Tract Infections: A New Paradigm for Antimicrobial-Resistant Foodborne Illness. Front. Microbiol. 2013, 4, 29. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, C.M.; Stegger, M.; Aziz, M.; Johnson, T.J.; Waits, K.; Nordstrom, L.; Gauld, L.; Weaver, B.; Rolland, D.; Statham, S.; et al. Escherichia coli ST131-H22 as a Foodborne Uropathogen. MBio 2018, 9, 1–11. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, L.; Klein, E.Y.; Laxminarayan, R. Seasonality and Temporal Correlation between Community Antibiotic Use and Resistance in the United States. Clin. Infect. Dis. 2012, 55, 687–694. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Campos, C.J.A.; Cachola, R.A. Faecal Coliforms in Bivalve Harvesting Areas of the Alvor Lagoon (Southern Portugal): Influence of Seasonal Variability and Urban Development. Environ. Monit. Assess. 2007, 133, 31–41. [Google Scholar] [CrossRef] [Scilit]
- Davis, B.C.; Brown, C.; Gupta, S.; Calarco, J.; Liguori, K.; Milligan, E.; Harwood, V.J.; Pruden, A.; Keenum, I. Recommendations for the Use of Metagenomics for Routine Monitoring of Antibiotic Resistance in Wastewater and Impacted Aquatic Environments. Crit. Rev. Environ. Sci. Technol. 2023, 53, 1731–1756. [Google Scholar] [CrossRef] [Scilit]
- Andersson, D.I.; Levinn, B.R. The Biological Cost of Antimicrobial Resistance. Trends Microbiol. 1999, 5, 337–339. [Google Scholar] [CrossRef] [Scilit]
- Young, S.; Rohr, J.R.; Harwood, V.J. Vancomycin Resistance Plasmids Affect Persistence of Enterococcus faecium in Water. Water Res. 2019, 166, 115069. [Google Scholar] [PubMed]
- Gonzalez, E.A.; Blanco, J. Relation between Antibiotic Resistance and Number of Plasmids in Enterotoxigenic and Non-enterotoxigenic Escherichia coli Strains. Med. Microbiol. Immunol. 1985, 174, 257–265. [Google Scholar] [PubMed]
- DeBoy, J.M.; Wachsmuth, I.K.; Davis, B.R. Antibiotic Resistance in Enterotoxigenic and Non-Enterotoxigenic Escherichia coli. J. Clin. Microbiol. 1980, 12, 264–270. [Google Scholar] [PubMed]
- Boerlin, P.; Travis, R.; Gyles, C.L.; Reid-Smith, R.; Janecko, N.; Lim, H.; Nicholson, V.; McEwen, S.A.; Friendship, R.; Archambault, M. Antimicrobial Resistance and Virulence Genes of Escherichia coli Isolates from Swine in Ontario. Appl. Environ. Microbiol. 2005, 71, 6753–6761. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vereecke, N.; Van Hoorde, S.; Sperling, D.; Theuns, S.; Devriendt, B.; Cox, E. Virotyping and Genetic Antimicrobial Susceptibility Testing of Porcine ETEC/STEC Strains and Associated Plasmid Types. Front. Microbiol. 2023, 14, 1139312. [Google Scholar] [CrossRef] [Scilit]
- Zhang, X.X.; Zhang, T.; Fang, H.H.P. Antibiotic Resistance Genes in Water Environment. Appl. Microbiol. Biotechnol. 2009, 82, 397–414. [Google Scholar] [CrossRef] [Scilit]
- Stine, O.C.; Johnson, J.A.; Keefer-Norris, A.; Perry, K.L.; Tigno, J.; Qaiyumi, S.; Stine, M.S.; Morris, J.G. Widespread Distribution of Tetracycline Resistance Genes in a Confined Animal Feeding Facility. Int. J. Antimicrob. Agents 2007, 29, 348–352. [Google Scholar] [CrossRef] [Scilit]
- Bengtsson-Palme, J.; Abramova, A.; Berendonk, T.U.; Coelho, L.P.; Forslund, S.K.; Gschwind, R.; Heikinheimo, A.; Jarquín-Díaz, V.H.; Khan, A.A.; Klümper, U.; et al. Towards Monitoring of Antimicrobial Resistance in the Environment: For What Reasons, How to Implement It, and What Are the Data Needs? Environ. Int. 2023, 178, 108089. [Google Scholar] [CrossRef] [Scilit]
- Forsberg, K.J.; Reyes, A.; Wang, B.; Selleck, E.M.; Morten, O.A. The Shared Antibiotic Resistome of Soil Bacteria and Human Pathogens. Science 2012, 337, 1107–1111. [Google Scholar] [CrossRef] [Scilit]
- Beceiro, A.; Tomás, M.; Bou, G. Antimicrobial Resistance and Virulence: A Successful or Deleterious Association in the Bacterial World? Clin. Microbiol. Rev. 2013, 26, 185–230. [Google Scholar] [CrossRef] [Scilit]
- LaMontagne, C. Relating Antimicrobial Resistance and Virulence in Surface Water E. coli (Data and Code). Mendeley Data 2022. [Google Scholar] [CrossRef]




| Target | Initial Denaturing | Denaturing | Annealing | Extension | # of Cycles | Final Extension | Reference |
|---|---|---|---|---|---|---|---|
| bfp | 94 °C, 3 min | 94 °C, 30 s | 60 °C, 30 s | 72 °C, 30 s | 30 | 72 °C, 5 min | [24] |
| fimH | 98 °C, 30 s | 98 °C, 30 s | 52 °C, 30 s | 72 °C, 30 s | 30 | 72 °C, 5 min | [25] |
| cnf-1 | 94 °C, 2 min | 94 °C, 30 s | 45 °C, 30 s | 72 °C, 40 s | 38 | 72 °C, 5 min | [26] |
| STa (estA) | 94 °C, 2 min | 94 °C, 30 s | 48 °C, 30 s | 72 °C, 20 s | 35 | 72 °C, 5 min | [26] |
| EAST-1 (astA) | 95 °C, 2 min | 95 °C, 30 s | 55 °C, 30 s | 72 °C, 30 s | 30 | 72 °C, 5 min | [27] |
| eae | 94 °C, 5 min | 94 °C, 30 s | 65 °C, 30 s | 68 °C, 75 s | 40 | 68 °C, 7 min | [28] |
| hlyA | 94 °C, 5 min | 94 °C, 30 s | 65 °C, 30 s | 68 °C, 75 s | 40 | 68 °C, 7 min | [28] |
| Target | Primer Sequence (5′-3′) | Size (bp) | Reference | |
|---|---|---|---|---|
| bfp | Forward Reverse | AATGGTGCTTGCGCTTGCTGC GCCGCTTTATCCAACCTGGTA | 326 | [24] |
| fimH | Forward Reverse | GATCTTTCGACGCAAATC CGAGCAGAAACATCGCAG | 389 | [29] |
| cnf-1 | Forward Reverse | GAACTTATTAAGGATAGT CATTATTTATAACGCTG | 543 | [30] |
| STa (estA) | Forward Reverse | TCCGTGAAACAACATGACGG ATAACATCCAGCACAGGCAG | 244 | [31] |
| EAST-1 (astA) | Forward Reverse | CCATCAACACAGTATATCCGA GGTCGCGAGTGACGGCTTTGT | 111 | [32] |
| eae | Forward Reverse | CATTATGGAACGGCAGAGGT ACGGATATCGAAGCCATTTG | 375 | [28] |
| hlyA | Forward Reverse | GCGAGCTAAGCAGCTTGAAT CTGGAGGCTGCACTAACTCC | 199 | [28] |
| N | bfp+ | fimH+ | cnf-1+ | STa+ | EAST-1+ | eae+ | hlyA+ | At Least 1+ (Excluding fimH) | |
|---|---|---|---|---|---|---|---|---|---|
| CHO sites | |||||||||
| Resistant | 70 | 1 (1.4%) | 63 (90.0%) | 2 (2.9%) | 2 (2.9%) | 7 (10.0%) | 0 (0.0%) | 2 (2.9%) | 13 (18.6%) |
| Susceptible | 64 | 0 (0.0%) | 61 (95.3%) | 3 (4.7%) | 8 (12.5%) | 10 (15.6%) | 1 (1.6%) | 0 (0.0%) | 20 (31.3%) |
| Total | 134 | 1 (0.7%) | 124 (92.5%) | 5 (3.7%) | 10 (7.5%) | 17 (12.7%) | 1 (0.7%) | 2 (1.5%) | 33 (24.6%) |
| Background sites | |||||||||
| Resistant | 17 | 0 (0.0%) | 17 (100.0%) | 1 (5.9%) | 0 (0.0%) | 1 (5.9%) | 0 (0.0%) | 0 (0.0%) | 2 (11.8%) |
| Susceptible | 23 | 0 (0.0%) | 21 (91.3%) | 2 (8.7%) | 1 (4.3%) | 6 (26.1%) | 1 (4.3%) | 0 (0.0%) | 8 (34.8%) |
| Total | 40 | 0 (0.0%) | 38 (95.0%) | 3 (7.5%) | 1 (2.5%) | 7 (17.5%) | 1 (2.5%) | 0 (0.0%) | 10 (25.0%) |
| Total (CHO + Background) | |||||||||
| Resistant | 87 | 1 (1.1%) | 80 (92.0%) | 3 (3.4%) | 2 (2.3%) | 8 (9.2%) | 0 (0.0%) | 2 (2.3%) | 15 (17.2%) |
| Susceptible | 87 | 0 (0.0%) | 82 (94.3%) | 5 (5.7%) | 9 (10.3%) | 16 (18.4%) | 2 (2.3%) | 0 (0.0%) | 28 (32.2%) |
| Total | 174 | 1 (0.6%) | 162 (93.1%) | 8 (4.6%) | 11 (6.3%) | 24 (13.8%) | 2 (1.1%) | 2 (1.1%) | 43 (24.7%) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
LaMontagne, C.D.; Christenson, E.C.; Rogers, A.T.; Jacob, M.E.; Stewart, J.R. Relating Antimicrobial Resistance and Virulence in Surface-Water E. coli. Microorganisms 2023, 11, 2647. https://doi.org/10.3390/microorganisms11112647
LaMontagne CD, Christenson EC, Rogers AT, Jacob ME, Stewart JR. Relating Antimicrobial Resistance and Virulence in Surface-Water E. coli. Microorganisms. 2023; 11(11):2647. https://doi.org/10.3390/microorganisms11112647
Chicago/Turabian StyleLaMontagne, Connor D., Elizabeth C. Christenson, Anna T. Rogers, Megan E. Jacob, and Jill R. Stewart. 2023. "Relating Antimicrobial Resistance and Virulence in Surface-Water E. coli" Microorganisms 11, no. 11: 2647. https://doi.org/10.3390/microorganisms11112647
APA StyleLaMontagne, C. D., Christenson, E. C., Rogers, A. T., Jacob, M. E., & Stewart, J. R. (2023). Relating Antimicrobial Resistance and Virulence in Surface-Water E. coli. Microorganisms, 11(11), 2647. https://doi.org/10.3390/microorganisms11112647

