Next Article in Journal
Validating Interactions of Pathogenic Proteins of Staphylococcus aureus and E. coli with Phytochemicals of Ziziphus jujube and Acacia nilotica
Previous Article in Journal
Immunoinformatic Execution and Design of an Anti-Epstein–Barr Virus Vaccine with Multiple Epitopes Triggering Innate and Adaptive Immune Responses
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Microorganisms
Volume 11
Issue 10
10.3390/microorganisms11102449
microorganisms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Incidence and Virulence Factor Profiling of Vibrio Species: A Study on Hospital and Community Wastewater Effluents

by
Mashudu Mavhungu
1,2,
Tennison O. Digban
1,2 and
Uchechukwu U. Nwodo
1,2,*
1
Patho-Biocatalysis Group, Department of Biochemistry and Microbiology, University of Fort Hare, Private Bag X1314, Alice 5700, South Africa
2
Department of Biochemistry and Microbiology, University of Fort Hare, Alice 5700, South Africa
*
Author to whom correspondence should be addressed.
Microorganisms 2023, 11(10), 2449; https://doi.org/10.3390/microorganisms11102449
Submission received: 21 August 2023 / Revised: 15 September 2023 / Accepted: 26 September 2023 / Published: 29 September 2023
(This article belongs to the Section Environmental Microbiology)
Browse Figures
Versions Notes

Abstract

:
This study aimed to determine the incidence and virulence factor profiling of Vibrio species from hospital wastewater (HWW) and community wastewater effluents. Wastewater samples from selected sites were collected, processed, and analysed presumptively by the culture dependent methods and molecular techniques. A total of 270 isolates were confirmed as Vibrio genus delineating into V. cholerae (27%), V. parahaemolyticus (9.1%), V. vulnificus (4.1%), and V. fluvialis (3%). The remainder (>50%) may account for other Vibrio species not identified in the study. The four Vibrio species were isolated from secondary hospital wastewater effluent (SHWE), while V. cholerae was the sole specie isolated from Limbede community wastewater effluent (LCWE) and none of the four Vibrio species was recovered from tertiary hospital wastewater effluent (THWE). However, several virulence genes were identified among V. cholerae isolates from SHWE: ToxR (88%), hylA (81%), tcpA (64%), VPI (58%), ctx (44%), and ompU (34%). Virulence genes factors among V. cholerae isolates from LCWE were: ToxR (78%), ctx (67%), tcpA (44%), and hylA (44%). Two different genes (vfh and hupO) were identified in all confirmed V. fluvialis isolates. Among V. vulnificus, vcgA (50%) and vcgB (67%) were detected. In V. parahaemolyticus, tdh (56%) and tlh (100%) were also identified. This finding reveals that the studied aquatic niches pose serious potential health risk with Vibrio species harbouring virulence signatures. The distribution of virulence genes is valuable for ecological site quality, as well as epidemiological marker in the control and management of diseases caused by Vibrio species. Regular monitoring of HWW and communal wastewater effluent would allow relevant establishments to forecast, detect, and mitigate any public health threats in advance.

1. Introduction

The unceasing emergence and re-emergence of bacteria to pathogenic status remains a threat to public health with concomitant adverse effects on the economic prosperity of any society [1,2]. Threats to human health and the change in the ecosystems have surged as a result of climate change [3]. The downstream results of these changes affect broader environmental systems, which have an impact that is either actively or passively linked to health. [4]. The consequence of the change is transforming disease forms for some illnesses that are primarily subject to environmental fluctuations, and a pertinent class of anthropological pathogens currently undergoing rapid growth is Vibrio [5]. As a result of climate change, precipitation patterns and the temperature of sea surfaces are varied with the rising incidence of Vibrio-linked diseases in aquatic environments affecting both humans and aquatic animals [6]. Vibriosis (infection vibrios) in humans has been documented as cholera or non-cholera infection [7].
According to the World Health Organization (WHO), approximately 4 million cases of cholera are reported each year from endemic countries with more than 100,000 fatalities [8]. However, global Vibrio infection surveillance is limited, principally for developing countries, stemming from under-reporting or failure to report infections, variations in reporting methods, and absence of an international epidemiology structure [9]. Accessibility to potable water for drinking and domestic use remains a difficulty in rising nations such as South Africa, forcing some rural communities to utilize microbiologically polluted river water for personal and household functions, thereby posing a public health concern [10].
Vibrio species are inclusive in the category of emerging and re-emerging bacterial pathogen, while V. cholerae, V. parahaemolyticus, V. vulnificus, and V. fluvialis have been at the fore [11]. There are over a hundred species in the Vibrio genus that are common inhabitants of aquatic and marine environments thriving in low to moderate salinities. [12]. Of the many described Vibrio species, at least 12 species have been reported of having the propensity to cause infections in humans [13]. Evidently, it has been established that mobile genetic components in their genomes alter their phenotypic ability to adapt to the environment and results in pathogenicity within a host. [14,15]. Cholera remains a major public health problem, primarily in resource constrained nations where accessibility to portable drinking water and suitable sanitation cannot be rendered to all inhabitants [16]. Non-cholera causing vibrios, including V. parahaemolyticus, V. alginolyticus, V. vulnificus, and non-toxigenic (non-O1 or non-O139 serogroup of V. cholerae) cause vibriosis, giving rise to different medical cases. Clinical conditions linked to Vibrio infection range from minor gastroenteritis to life-threatening necrotizing fasciitis, putrid wound infections, blood disease, liver dysfunction, and acute gastroenteritis inclusive in the disease progression [17,18]. Virulence factors in Vibrio species required to initiate infection in susceptible host cells include siderophores desirable in foraging iron, haemolysin that lyse red blood cells including cellular membranes, capsular polysaccharide that assist in resisting opsonisation and escape complement fixation, pili and surface proteins to increase attachment, and flagella-mediated motility [19].
However, owing to Vibrio’s highly flexible genomic structure, the risk of horizontal gene transfer (virulence) between pathogenic and environmental Vibrio strains is high, increasing the number of pathogenic strains of Vibrio in aquatic environments [20]. The O1 and O139 serogroup of V. cholerae have been among the leading virulent groups and are known to harbour cholera toxin [21,22,23]. The pathogenicity of Vibrio depends on the combination of virulence factors such as cholera toxin (ctxA) and the aptitude of V. cholerae to colonize the colon with the colonization factor (tcpA) toxin co-regulated pilus along with zot (generally is involved in invasion) [24]. These three virulence factors (ctxA, tcpA, and zot) are responsible for the observed rice watery diarrhoea in humans [25]. The research on Vibrio continues to be on the rise and the reservoirs of these pathogens have been attributed, mostly, to the environment including municipal wastewaters and other surface waters. South Africa being a semi-arid region has a shortage of water distribution especially in the deep rural settings. There are also a number of factors that contribute to the decline of water quality in South Africa, like agricultural and industrial activities, poor functional state of treatment plants, and also impaired pipes that empty their contents into environment contaminating nearby aquatic niches [26]. Numerous occurrences of disease outbreaks like diarrhoea have been documented in various provinces of South Africa, with wastewater effluents as the key source [27]. Although hospital wastewater has lately been on the spotlights as a crucial point for the emergence of pathogens with varied characteristics [28], a paucity of information abounds on hospital wastewater effluent as a reservoir for pathogenic Vibrio species. Consequently, this study was premised to determine the incidence and virulence factor profiling of Vibrio species from both hospital and rural community wastewater within the rural Eastern Cape of South Africa.

2. Materials and Methods

2.1. Area of Study

The study was conducted in two municipalities of the rural Eastern Cape: Buffalo City and Amathole. On the province’s eastern shore, there is a metropolitan municipality called Buffalo City. The municipality instituted as a local municipality in the year 2000 after South Africa’s restructuring of municipal regions was named as a result of the Buffalo River. Auto industry is important to the region, with a well-developed manufacturing base. Amathole District Municipality is situated in the mid-region of the Eastern Cape and stretches on the Fish River Mouth through the Eastern Seaboard to the South of Hole in the Wall along with the Wild Coast. It is also abutted to the north via the Amathole Mountain Range. Due to the significant amount of wastewater produced each day, the municipal wastewater treatment facility was chosen. The hospitals selected were referrals of secondary and tertiary health institutions with a significant number of wards and other facilities for numerous patients, resulting in large amount of wastewater production. Sites and geographical coordinates of the study area are presented in Table 1.

2.2. Sample Collection

A total of thirty-six wastewater samples were collected weekly, spanning a period of three months (February 2018 to April 2018). Twelve (12) samples were collected from each sampling site. The samples were conveyed in cooler ice package to Patho-Biocatalysis laboratory situated in University of Fort Hare. All the wastewater samples were analysed within 2 h of collection, while the remaining samples were aliquoted into smaller collection bottles and kept at 4 °C prior to the completion of all analyses.

2.3. Sample Processing, Cultivation and Identification of Vibrios

A standard membrane filtration technique was utilized in processing all the samples [29]. A ten-fold serial dilution of the samples was carried out by diluting 30 mL of the samples in 270 mL of autoclaved distilled water. Using a vacuum pump, wastewater (0.1 L) was filtered through 0.45μm white gridded cellulose ester membrane filters (Merck, Johannesburg South Africa). The membrane filter paper was placed into test tubes containing alkaline peptone water (for enrichment) and incubated aerobically at 37 °C overnight. A loopful of alkaline peptone culture was sub-cultured onto thiosulphate citrate bile salts sucrose (TCBS, Himedia, South Africa) and incubated for another 24 h at 37 °C. Random selections of four to five yellowish and greenish colonies from each culture plate were purified on fresh nutrient agar plates. The purified isolates were used for the molecular analyses and the extras were stored in glycerol cryotubes at −20 °C prior to other studies.

2.4. Molecular Identification

Deoxyribonucleic Acid (DNA) Extraction

DNA extraction was carried out according to a previously described method [30], but with minor adjustment. After incubation on overnight nutrient agar (Bio-lab), pure colonies were picked and emulsified in 200μL of sterile water. Cells were then lysed by boiling at 100 °C for 15 min on a digital Accu-Block, (Lasec, Capetown, South Africa). Separation of cell debris from DNA was performed by centrifugation at 13,400× g for 10 min in a microcentrifuge (Lasec, Capetown, South Africa). Thereafter, the lysate was dispensed into autoclaved Eppendorf tubes and stored at −20 °C chiller to avoidt DNA degradation.

2.5. Vibrio isolates Confirmation

Vibrio isolates were validated by PCR, utilizing the 16SrRNA variable fragment as a target. All Vibrio isolates were further categorized as V. cholerae, V. fluvialis, V. vulnificus, and V. parahaemolyticus. The cocktail comprised 9.5 μL of Master-mix (Biolabs, New England), 0.5 μL of primers (forward and reverse) (Inqaba Biotech, Pretoria, South Africa), 2.5 μL of PCR water, and 2.5 μL of DNA template, totalling 15 μL reaction. PCR was carried out in a T1000 Touch Thermal Cycler (Bio-Rad, Johannesburg, South Africa). Amplified products were resolved by electrophoresis at 90 V for 55 min and visualized in a UV transilluminator (Alliance 4.7 Uvitec, Cambridge, UK). The targeted genes, oligonucleotide sequences, amplicon sizes, and PCR-cycling conditions of the Vibrio species are shown in Table 2.

2.6. Virulence Genes Detection

The detection of genes coding for virulence among the Vibrio species was carried out using PCR. Toxin-coregulated pilus (TCP), zonula occludens toxin (zot), toxin regulon (toxR), El Tor haemolysin (hylA), Vibrio pathogenicity island (VPI), cholera toxin gene (ctx), and outer membrane proteins (ompU) were the targeted virulence signatures for V. cholerae. For V. vulnificus virulence genes, vcgA and vcgB were investigated. The haeme-utilization protein gene (hupO), heat stable enterotoxin (stn), extracellular haemolysin gene (vfh), and V. fluvialis protease gene (vfpA) were the targeted virulence genes for V. fluvialis. Finally, the thermostable direct haemolysin (tdh), thermostable related haemolysin (trh), and thermolabile haemolysin gene (tlh) were the targeted genes in V. parahaemolyticus. The PCR mixture comprised of a multiplex with conditions as follows: an initial denaturation of 94 °C for 4 min and 35 cycles of denaturation at 94 °C for 45 s, annealing (52 °C and 62 °C), elongation at 72 °C for 85 s, and final extension was achieved at 72 °C for 7 min. The oligonucleotide primers, various annealing conditions, and the justification for selecting these virulence genes was subject to their previous detection in earlier studies as referenced in Table 3.

3. Results

During the course of the three months of sampling, 378 probable Vibrio isolates were recovered. Of these, 270 (71%) were confirmed Vibrio (genus) isolates by targeting the 16SrRNA genes. However, further analyses revealed that SHWE, LCWE, and THWE sampling sites accounted for 67%, 19%, and 14% of the Vibrio isolates respectively. Delineation of the Vibrio genus into species is given as follows: V. cholerae 73 (27%), V. parahaemolyticus 25 (9.1%), V. vulnificus 12 (4.1%) and V. fluvialis 8 (3%). The agarose gel electrophoresis of the Vibrio genus and the distribution of the confirmed Vibrio isolates are shown in Figure 1a,b respectively.

3.1. Prevalence of Vibrio Species

Delineation of the Vibrio genus into species from SHWE sampling site is given as follows: V. cholerae (24%), V. parahaemolyticus (9%), V. vulnificus (4%) and V. fluvialis (3%). All four delineated Vibrio species were not detected in THWE, while 3% of V. cholerae was detected in LCWE. The gel representative of the delineated four amplified Vibrio species is shown in Figure 2.

3.2. Distribution of Virulence Genes among the Vibrio Species

Among the confirmed Vibrio species, thirteen of the sixteen virulence genes were identified. V. cholerae harboured the following amplified genes; ctx (44%), tcpA (64%), hylA (81%), ompU (34%), toxR (88%), and VPI (58%) recovered from SHWE, while ctx, tcpA, hylA, and toxR were detected in 67%, 44%, 44%, and 78% of V. cholerae isolates recovered from LCWE. Two different genes (vfh and hupO) were identified in all V. fluvialis isolates while the vfpA gene was absent. Virulence genes (tdh and tlh) were detected in the proportion of 56% and 100% among V. parahaemolyticus from the study. Two virulence genes vcgA (50%) and vcgB (67%) were found in V. vulnificus isolates. The frequency of virulence genes among the isolates is presented in Figure 3a–d, while the gel representatives for the detection of the virulence genes are presented in Figure 4a–d and Figure 5a–d respectively.

4. Discussion

The unabated rise in the demand for water in industries, agriculture, and sustenance of urban and rural population has culminated in considerable water scarcities impacting developing countries [45]. However, an age long approach for water scarcity amelioration includes the recycling and treatment of wastewater for domestic and other uses. Wastewater contains diverse pathogens that have detrimental consequences on human health [46]. The presence of organic materials, by products from chemicals and pharmaceuticals, as well as biological infectious organisms in hospital wastewater poses a threat to both humans and animals. [47]. South Africa’s microbial pollution of water sources is mainly caused by poor management of wastewater treatment plants and uncontrolled sewage discharge. In this study, V. vulnificus, V. cholerae, V. fluvialis, and V. parahaemolyticus were isolated using a culture-dependent technique and molecular approach. This is similar to earlier reports that detected these Vibrio species from the aquatic environment [48,49,50,51]. However, the residual isolates of > 50% not detected in this study were anticipated to belong to other species not part of the research design. However, a previous study [52] has documented twelve known Vibrio species known to cause infection in humans, of which the Vibrio species detected in our study are inclusive and also considered most significant. The four Vibrio species were, however, detected in the SHWE while only V. cholerae isolates were recovered from LCWE. Hospital wastewater contains a pool of microbes that are considered major contributors to emerging microbial contamination. In the rural area of this study, more serious cases like surgeries and other life-threatening conditions are usually carted for in the tertiary health centres which also serve as referrals from both primary and secondary health centres. Nonetheless, the Vibrio species identified in this study were not detected in the THWE. The first point of call for patients in the rural communities is usually the primary or secondary health centres. It is also feasible that a lesser number of patients harbouring the organisms were admitted into the tertiary health centre during the period of study; hence the lower number of Vibrio isolates recovery from the THWE.
Virulence is defined as the ability of any bacteria to invade a host cell in order to initiate a disease condition. Most organisms need an assortment of virulence factors or genes to induce infection. These virulence factors can either be secretory, membrane associated, or cytolytic in nature [53]. The majority of microorganisms’ pathogenicity and infection severity are known to rise through the acquisition of virulence genes, exacerbating their impact on their susceptible host [54]. Both virulence factors and bacterial toxins contribute to pathogenicity by increasing both the infectiousness of pathogenic bacteria and antimicrobial resistance, which in turn limits the effectiveness of available treatments. The Vibrio species that have been linked with diseases in animals and humans harbour a collection of virulence genes.
Although, environmental isolates are typically devoid of virulence-linked genes present in the clinical isolates, studies have shown the frequency of such genes or their homologues are acquired via horizontal transfer actions, owing to the flexibility of their genomes [55,56]. In this study, V. cholerae was found to harbour a variety of genes. Ctx gene is an important virulence factor of V. cholerae and is responsible for the production of cholera toxin, accountable for diarrhoea among people with cholera [57]. The toxin regulated pilus (tcpA) is a type IV pilus encoded in VPI enabling V. cholerae to establish colonization in the gut and cause disease diarrhoea, while the hylA gene is linked with red blood cell lysis in the infected host cells [58,59]. The ompU gene is an important outer membrane protein that allows V. cholerae to adhere to the host intestinal epithelium during the course of inducing disease [60]. ToxR is a transcriptional activating factor that controls the expression of other essential virulence genes such as toxin-coregulated pilus and accessory colonization factor as well as the ctx gene [61,62]. Vibrio pathogenicity island (VPI) is a large chromosomal region responsible for virulence genes acquired through horizontal gene transfer, which functions pertinently in the production of cholera toxin and intestinal colonization in V. cholerae within the host intestine during the course of disease development [63]. In the absence of the cholera toxin, zot is one of the most important toxins in V. cholerae [64]. Zot is a conserved protein in filamentous vibriophage and has been observed as a putative toxin in V. cholerae [65]. In this study, V. cholerae harboured all aforementioned six virulence genes (ctx, tcpA, hylA, ompU, toxR, and VPI) and was recovered from SHWE, while the same genes, with the exceptions of VPI and ompU, were observed in LCWE. The presence of V. cholerae with virulence markers in SHWE and LCWE can be detrimental to humans when the wastewater is discharged through faulty treatment plants or leaked sewages into adjourning aquatic environments, thereby increasing the risk of contamination. Previous studies have detected V. cholerae isolates with virulence traits isolated from environmental and clinical sources [66,67].
V. vulnificus has a global dissemination and has been reported as an emerging food-borne pathogen, causing diarrheal illnesses and extraintestinal infections [68]. Also in this study, virulence correlated gene (vcg) was detected among the V. vulnificus isolates. The vcg gene has been reported to be useful in differentiating potentially virulent and avirulent strains [69]. The clinical isolates harbouring the vcgA were less detected in our study as compared to the environmental strains possessing the vcgB gene. This finding is comparable with a previous study that also detected more of the vcgB genotype denoting the less virulence strains [70]. Virulence factors that have been documented in the pathogenicity of V. fluvialis include haem-utilization protein (hupO), which is linked with virulence expression via stimulation of haemolysin production and resistance to oxidative stress [71,72]. Our study revealed the presence of hupO and vfh genes in every V. fluvialis isolate detected in SHWE. Additionally, V. fluvialis infection has increased public health risks globally and occurs in areas where people typically eat raw or undercooked seafood [73]. Vfh has a broad spectrum of cytocidal activity and a virulence trait harboured by V. fluvialis, inducing inflammatory diarrhoea in susceptible human hosts as well as eliciting the lysis of erythrocytes [74]. A similar trend was observed in a previous finding [36] of the detection vfh and hupO genes among V. fluvialis isolates. V. parahaemolyticus infection in humans has been frequently documented in coastal areas, attributed to the high consumption of sea products and frequent contact with Vibrio infected estuarine water bodies [75]. V. parahaemolyticus strains are detected by multiple virulence genes, comprising tih species specific virulence factors which codes for thermolabile haemolysin [76]. Furthermore, this species of Vibrio is also known to possess thermostable direct haemolysin (tdh), as well as thermolysin related haemolysin, which are important in lysing erythrocytes [77]. From our study, all V. parahaemolyticus isolates from SHWE sites harboured the tlh gene, while 56% of the isolates had thermolabile related haemolysin gene. This infers the clinical significance of aquatic V. parahaemolyticus pathogenicity towards humans. This finding is at variance with a previous report that detected approximately 15.6% of tdh gene in the aquatic environment [78].
The detection of virulence genes among Vibrio species in our study further reaffirms their potential pathogenic status and risk tendencies in the aquatic environment.

5. Limitation of the Study

The few sampling sites in this study may not infer a total representation of the isolates recovered from the province. Subsequent studies should cover additional areas as well as the application of other molecular techniques in the analyses of more virulence signatures among these isolates.

6. Conclusions

This study revealed the successful isolation of V. cholerae, V. fluvialis, V. vulnificus, and V. parahaemolyticus from SHWE and LCWE, respectively. The molecular analysis revealed that Vibrio isolates are an important reservoir of virulence genes critically significant in assessing their pathogenic status. The distribution of virulence genes is valuable for ecological site quality, as well as for epidemiological markers in the control and management of diseases caused by Vibrio species. Regular monitoring of HWW and communal wastewater effluent would assist the concerned authorities and policy makers to anticipate, detect, and mitigate any public health threats in advance.

Author Contributions

U.U.N. Conceptualization, M.M.; methodology, M.M. and T.O.D.; formal analyses, U.U.N.; resources, T.O.D.; writing—original draft preparation, M.M., T.O.D. and U.U.N.; writing—review and editing, U.U.N.; supervision. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Data Availability Statement

The data and materials used during the current study are available upon request to the corresponding author.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. World Health Organization. National Systems to Support Drinking-Water: Sanitation and Hygiene: Global Status Report 2019: UN-Water Global Analysis and Assessment of Sanitation and Drinking-Water: GLAAS 2019 Report; World Health Organization: Geneva, Switzerland, 2019.
  2. Bloom, D.E.; Cadarette, D. Infectious disease threats in the twenty-first century: Strengthening the global response. Front. Immunol. 2019, 10, 549. [Google Scholar] [CrossRef]
  3. Weiskopf, S.R.; Rubenstein, M.A.; Crozier, L.G.; Gaichas, S.; Griffis, R.; Halofsky, J.E.; Hyde, K.J.; Morelli, T.L.; Morisette, J.T.; Muñoz, R.C.; et al. Climate change effects on biodiversity, ecosystems, ecosystem services, and natural resource management in the United States. Sci. Total Environ. 2020, 733, 137782. [Google Scholar] [CrossRef]
  4. Watts, N.; Amann, M.; Arnell, N.; Ayeb-Karlsson, S.; Beagley, J.; Belesova, K.; Boykoff, M.; Byass, P.; Cai, W.; Campbell-Lendrum, D.; et al. The 2020 report of the Lancet Countdown on health and climate change: Responding to converging crises. Lancet 2021, 397, 129–170. [Google Scholar] [CrossRef]
  5. Economopoulos, A.; Chochlakis, D.; Almpan, M.A.; Sandalakis, V.; Maraki, S.; Tselentis, Y.; Psaroulaki, A. Environmental investigation for the presence of Vibrio species following a case of severe gastroenteritis in a touristic island. Environ. Sci. Pollut. Res. 2017, 24, 4835–4840. [Google Scholar] [CrossRef]
  6. Trinanes, J.; Martinez-Urtaza, J. Future scenarios of risk of Vibrio infections in a warming planet: A global mapping study. Lancet Planet Health 2021, 5, e426–e435. [Google Scholar] [CrossRef]
  7. Hoefler, F.; Pouget-Abadie, X.; Roncato-Saberan, M.; Lemarié, R.; Takoudju, E.M.; Raffi, F.; Corvec, S.; Le Bras, M.; Cazanave, C.; Lehours, P.; et al. Clinical and Epidemiologic Characteristics and Therapeutic Management of Patients with Vibrio Infections, Bay of Biscay, France, 2001–2019. Emerg. Infec. Dis. 2022, 28, 2367. [Google Scholar] [CrossRef]
  8. Ali, M.; Nelson, A.R.; Lopez, A.L.; Sack, D.A. Updated global burden of cholera in endemic countries. PLoS Negl. Trop. Dis. 2015, 9, e0003832. [Google Scholar] [CrossRef]
  9. Brumfield, K.D.; Cotruvo, J.A.; Shanks, O.C.; Sivaganesan, M.; Hey, J.; Hasan, N.A.; Huq, A.; Colwell, R.R.; Leddy, M.B. Metagenomic sequencing and quantitative real-time PCR for faecal pollution assessment in an urban watershed. Front. Water 2021, 3, 626849. [Google Scholar] [CrossRef]
  10. Mbanga, J.; Abia, A.L.K.; Amoako, D.G.; Essack, S. Quantitative microbial risk assessment for waterborne pathogens in a wastewater treatment plant and its receiving surface water body. BMC Microbiol. 2020, 20, 346. [Google Scholar] [CrossRef]
  11. Bonnin-Jusserand, M.; Copin, S.; Le Bris, C.; Brauge, T.; Gay, M.; Brisabois, A.; Grard, T.; Midelet-Bourdin, G. Vibrio species involved in seafood-borne outbreaks (Vibrio cholerae, V. parahaemolyticus and V. vulnificus): Review of microbiological versus recent molecular detection methods in seafood products. Crit. Rev. Food Sci. Nutr. 2019, 59, 597–610. [Google Scholar] [CrossRef]
  12. Baker-Austin, C.; Oliver, J.D.; Alam, M.; Ali, A.; Waldor, M.K.; Qadri, F.; Martinez-Urtaza, J. Vibrio spp. infections. Nat. Rev. Dis. Primers 2018, 4, 8. [Google Scholar]
  13. Brehm, T.T.; Berneking, L.; Rohde, H.; Chistner, M.; Schlickewei, C.; Martins, M.S.; Schmiedel, S. Wound infection with Vibrio harveyi following a traumatic leg amputation after a motorboat propeller injury in Mallorca, Spain: A case report and review of literature. BMC Infect. Dis. 2020, 20, 104. [Google Scholar] [CrossRef]
  14. Costa, W.F.; Giambiagi-deMarval, M.; Laport, M.S. Antibiotic and Heavy Metal Susceptibility of Non-Cholera Vibrio Isolated from Marine Sponges and Sea Urchins: Could They Pose a Potential Risk to Public Health? Antibiotics 2021, 10, 1561. [Google Scholar] [CrossRef]
  15. Zeaiter, Z.; Mapelli, F.; Crotti, E.; Borin, S. Methods for the genetic manipulation of marine bacteria. Electron. J. Biotechnol. 2018, 33, 17–28. [Google Scholar] [CrossRef]
  16. Lessler, J.; Moore, S.M.; Luquero, F.J.; McKay, H.S.; Grais, R.; Henkens, M.; Mengel, M.; Dunoyer, J.; M’bangombe, M.; Lee, E.C.; et al. Mapping the burden of cholera in sub-Saharan Africa and implications for control: An analysis of data across geographical scales. Lancet 2018, 391, 1908–1915. [Google Scholar] [CrossRef]
  17. Tsai, Y.H.; Hsu, R.W.W.; Huang, K.C.; Chen, C.H.; Cheng, C.C.; Peng, K.T.; Huang, T.J. Systemic Vibrio infection presenting as necrotizing fasciitis and sepsis: A series of thirteen cases. JBJS 2004, 86, 2497–2502. [Google Scholar] [CrossRef]
  18. Yamazaki, K.; Kashimoto, T.; Morita, M.; Kado, T.; Matsuda, K.; Yamasaki, M.; Ueno, S. Identification of in vivo essential genes of Vibrio vulnificus for establishment of wound infection by signature-tagged mutagenesis. Front. Microbiol. 2019, 10, 123. [Google Scholar] [CrossRef]
  19. Froelich, B.A.; Daines, D.A. In hot water: Effects of climate change on Vibrio–human interactions. Environ. Microbiol. 2020, 22, 4101–4111. [Google Scholar] [CrossRef]
  20. Xu, Y.; Wang, C.; Zhang, G.; Tian, J.; Liu, Y.; Shen, X.; Feng, J. IS CR 2 is associated with the dissemination of multiple resistance genes among Vibrio spp. and Pseudoalteromonas spp. isolated from farmed fish. Arch. Microbiol. 2017, 199, 891–896. [Google Scholar] [CrossRef]
  21. Schwartz, K.; Hammerl, J.A.; Göllner, C.; Strauch, E. Environmental and clinical strains of Vibrio cholerae Non-O1, Non-O139 from Germany possess similar virulence gene profiles. Front. Microbiol. 2019, 10, 733. [Google Scholar] [CrossRef]
  22. Okada, K.; Wongboot, W.; Chantaroj, S.; Natakuathung, W.; Roobthaisong, A.; Kamjumphol, W.; Maruyama, F.; Takemura, T.; Nakagawa, I.; Ohnishi, M.; et al. Vibrio cholerae embraces two major evolutionary traits as revealed by targeted gene sequencing. Sci. Rep. 2018, 8, 1631. [Google Scholar] [CrossRef]
  23. Feglo, P.K.; Sewurah, M. Characterization of highly virulent multidrug resistant Vibrio cholerae isolated from a large cholera outbreak in Ghana. BMC Res. Notes 2018, 11, 45. [Google Scholar] [CrossRef]
  24. Gxalo, O.; Digban, T.O.; Igere, B.E.; Olapade, O.A.; Okoh, A.I.; Nwodo, U.U. Virulence and Antibiotic Resistance Characteristics of Vibrio Isolates from Rustic Environmental Freshwaters. Front. Cell. Infect. Microbiol. 2021, 765, 732001. [Google Scholar] [CrossRef]
  25. Akoachere, J.F.T.K.; Masalla, T.N.; Njom, H.A. Multi-drug resistant toxigenic Vibrio cholerae O1 is persistent in water sources in New Bell-Douala, Cameroon. BMC Infec. Dis. 2013, 13, 366. [Google Scholar] [CrossRef]
  26. Kalule, J.B.; Smith, A.M.; Vulindhlu, M.; Tau, N.P.; Nicol, M.P.; Keddy, K.H.; Robberts, L. Prevalence and antibiotic susceptibility patterns of enteric bacterial pathogens in human and non-human sources in an urban informal settlement in Cape Town, South Africa. BMC Microbiol. 2019, 19, 244. [Google Scholar] [CrossRef]
  27. Edokpayi, J.N.; Odiyo, J.O.; Durowoju, O.S. Impact of wastewater on surface water quality in developing countries: A case study of South Africa. Water Qual. 2017, 10, 10–5772. [Google Scholar]
  28. Lépesová, K.; Olejníková, P.; Mackuľak, T.; Cverenkárová, K.; Krahulcová, M.; Bírošová, L. Hospital Wastewater—Important Source of Multidrug Resistant Coliform Bacteria with ESBL-Production. Int. J. Environ. Res. Public Health 2020, 17, 7827. [Google Scholar] [CrossRef]
  29. American Public Health Association. Standard Methods for the Examination of Water and Wastewater Analysis; American Public Health Association: Washington, DC, USA, 1998. [Google Scholar]
  30. Mapipa, Q.; Digban, T.O.; Nnolim, N.E.; Nwodo, U.U. Antibiogram profile and virulence signatures of Pseudomonas aeruginosa isolates recovered from selected agrestic hospital effluents. Sci. Rep. 2021, 11, 11800. [Google Scholar] [CrossRef]
  31. Kwok, A.Y.; Wilson, J.T.; Coulthart, M.; Ng, L.K.; Mutharia, L.; Chow, A.W. Phylogenetic study and identification of human pathogenic Vibrio species based on partial hsp 60 gene sequences. Can. J. Microbiol. 2002, 48, 903–910. [Google Scholar] [CrossRef]
  32. Alam, M.; Sultana, M.; Nair, G.B.; Sack, R.B.; Sack, D.A.; Siddique, A.K.; Ali, A.; Huq, A.; Colwell, R.R. Toxigenic Vibrio cholerae in the aquatic environment of Mathbaria, Bangladesh. Appl. Environ. Microbiol. 2006, 72, 2849–2855. [Google Scholar] [CrossRef]
  33. Tarr, C.L.; Patel, J.S.; Puhr, N.D.; Sowers, E.G.; Bopp, C.A.; Strockbine, N.A. Identification of Vibrio isolates by a multiplex PCR assay and rpoB sequence determination. J. Clin. Microbiol. 2007, 45, 134–140. [Google Scholar] [CrossRef] [PubMed]
  34. Chakraborty, R.; Sinha, S.; Mukhopadhyay, A.K.; Asakura, M.; Yamasaki, S.; Bhattacharya, S.K.; Nair, G.B.; Ramamurthy, T. Species-specific identification of Vibrio fluvialis by PCR targeted to the conserved transcriptional activation and variable membrane tether regions of the toxR gene. J. Med. Microbiol. 2006, 55, 805–808. [Google Scholar] [CrossRef] [PubMed]
  35. Shinoda, S.; Nakagawa, T.; Shi, L.; Bi, K.; Kanoh, Y.; Tomochika, K.I.; Miyoshi, S.I.; Shimada, T. Distribution of virulence-associated genes in Vibrio mimicus isolates from clinical and environmental origins. Microbiol. Immunol. 2004, 48, 547–551. [Google Scholar] [CrossRef] [PubMed]
  36. Mantri, C.K.; Mohapatra, S.S.; Ramamurthy, T.; Ghosh, R.; Colwell, R.R.; Singh, D.V. Septaplex PCR assay for rapid identification of Vibrio cholerae including detection of virulence and int SXT genes. FEMS Microbiol. Lett. 2006, 265, 208–214. [Google Scholar] [CrossRef]
  37. Singh, D.V.; Isac, S.R.; Colwell, R.R. Development of a hexaplex PCR assay for rapid detection of virulence and regulatory genes in Vibrio cholerae and Vibrio mimicus. J. Clin. Microbiol. 2002, 40, 4321–4324. [Google Scholar] [CrossRef]
  38. Bi, K.; Miyoshi, S.I.; Tomochika, K.I.; Shinoda, S. Detection of virulence associated genes in clinical strains of Vibrio mimicus. Microbiol. Immunol. 2001, 45, 613–616. [Google Scholar] [CrossRef]
  39. Xie, Z.Y.; Hu, C.Q.; Chen, C.; Zhang, L.P.; Ren, C.H. Investigation of seven Vibrio virulence genes among Vibrio alginolyticus and Vibrio parahaemolyticus strains from the coastal mariculture systems in Guangdong, China. Lett. Appl. Microbiol. 2005, 41, 202–207. [Google Scholar] [CrossRef]
  40. Rivera, I.N.; Chun, J.; Huq, A.; Sack, R.B.; Colwell, R.R. Genotypes associated with virulence in environmental isolates of Vibrio cholerae. Appl. Environ. Microbiol. 2001, 67, 2421–2429. [Google Scholar] [CrossRef]
  41. Rosche, T.M.; Yano, Y.; Oliver, J.D. A rapid and simple PCR analysis indicates there are two subgroups of Vibrio vulnificus which correlate with clinical or environmental isolation. Microbiol. Immunol. 2005, 49, 381–389. [Google Scholar] [CrossRef]
  42. Liang, P.; Cui, X.; Du, X.; Kan, B.; Liang, W. The virulence phenotypes and molecular epidemiological characteristics of Vibrio fluvialis in China. Gut Pathog. 2013, 5, 6. [Google Scholar] [CrossRef]
  43. Rojas, M.V.R.; Matté, M.H.; Dropa, M.; Silva, M.L.D.; Matté, G.R. Characterization of Vibrio parahaemolyticus isolated from oysters and mussels in São Paulo, Brazil. Rev. Inst. Med. Trop. Sao 2011, 53, 201–205. [Google Scholar] [CrossRef] [PubMed]
  44. Mohamad, N.; Amal, M.N.A.; Saad, M.Z.; Yasin, I.S.M.; Zulkiply, N.A.; Mustafa, M.; Nasruddin, N.S. Virulence-associated genes and antibiotic resistance patterns of Vibrio spp. isolated from cultured marine fishes in Malaysia. BMC Vet. Res. 2019, 15, 176. [Google Scholar] [CrossRef] [PubMed]
  45. Hoekstra, A.Y.; Mekonnen, M.M.; Chapagain, A.K.; Mathews, R.E.; Richter, B.D. Global monthly water scarcity: Blue water footprints versus blue water availability. PLoS ONE 2012, 7, e32688. [Google Scholar] [CrossRef] [PubMed]
  46. Chahal, C.; Van Den Akker, B.; Young, F.; Franco, C.; Blackbeard, J.; Monis, P. Pathogen and particle associations in wastewater: Significance and implications for treatment and disinfection processes. Adv. Appl. Microbiol. 2016, 97, 63–119. [Google Scholar] [PubMed]
  47. Zagui, G.S.; Tonani, K.A.A.; Fregonesi, B.M.; Machado, G.P.; Silva, T.V.; Andrade, L.N.; Andrade, D.; Segura-Muñoz, S.I. Tertiary hospital sewage as reservoir of bacteria expressing MDR phenotype in Brazil. Braz. J. Biol. 2021, 82, e234471. [Google Scholar] [CrossRef]
  48. Maje, M.D.; Kaptchouang Tchatchouang, C.D.; Manganyi, M.C.; Fri, J.; Ateba, C.N. Characterisation of Vibrio species from surface and drinking water sources and assessment of biocontrol potentials of their bacteriophages. Int. J. Microbiol. 2020, 2020, 8863370. [Google Scholar] [CrossRef]
  49. Bakhshi, B.; Barzelighi, H.M.; Adabi, M.; Lari, A.R.; Pourshafie, M.R. A molecular survey on virulence associated genotypes of non-O1 non-O139 Vibrio cholerae in aquatic environment of Tehran, Iran. Water Res. 2009, 43, 1441–1447. [Google Scholar] [CrossRef]
  50. Canigral, I.; Moreno, Y.; Alonso, J.L.; González, A.; Ferrús, M.A. Detection of Vibrio vulnificus in seafood, seawater and wastewater samples from a Mediterranean coastal area. Microbiol. Res. 2010, 165, 657–664. [Google Scholar] [CrossRef]
  51. Kokashvili, T.; Whitehouse, C.A.; Tskhvediani, A.; Grim, C.J.; Elbakidze, T.; Mitaishvili, N.; Janelidze, N.; Jaiani, E.; Haley, B.J.; Lashkhi, N.; et al. Occurrence and diversity of clinically important Vibrio species in the aquatic environment of Georgia. Front. Public Health 2015, 3, 232. [Google Scholar] [CrossRef]
  52. CDC. Vibrio Species Causing Vibriosis—Symptoms. 2019. Available online: https://www.cdc.gov/vibrio/symptoms.html (accessed on 2 September 2023).
  53. Sharma, A.K.; Dhasmana, N.; Dubey, N.; Kumar, N.; Gangwal, A.; Gupta, M.; Singh, Y. Bacterial virulence factors: Secreted for survival. Indian J. Microbiol. 2017, 57, 1–10. [Google Scholar] [CrossRef]
  54. Abd El-Baky, R.M.; Ibrahim, R.A.; Mohamed, D.S.; Ahmed, E.F.; Hashem, Z.S. Prevalence of virulence genes and their association with antimicrobial resistance among pathogenic E. coli isolated from Egyptian patients with different clinical infections. Infec. Drug Resist. 2020, 13, 1221. [Google Scholar] [CrossRef] [PubMed]
  55. Kirkup, B.C.; Chang, L.; Chang, S.; Gevers, D.; Polz, M.F. Vibrio chromosomes share common history. BMC Microbiol. 2010, 10, 137. [Google Scholar] [CrossRef] [PubMed]
  56. Gennari, M.; Ghidini, V.; Caburlotto, G.; Lleo, M.M. Virulence genes and pathogenicity islands in environmental Vibrio strains non-pathogenic to humans. FEMS Microbiol. Ecol. 2012, 82, 563–573. [Google Scholar] [CrossRef] [PubMed]
  57. Takahashi, E.; Ochi, S.; Mizuno, T.; Morita, D.; Morita, M.; Ohnishi, M.; Koley, H.; Dutta, M.; Chowdhury, G.; Mukhopadhyay, A.K.; et al. Virulence of Cholera Toxin Gene-Positive Vibrio cholerae Non-O1/non-O139 Strains Isolated From Environmental Water in Kolkata, India. Front. Microbiol. 2021, 12, 2439. [Google Scholar] [CrossRef] [PubMed]
  58. Hounmanou, Y.M.; Mdegela, R.H.; Dougnon, T.V.; Mhongole, O.J.; Mayila, E.S.; Malakalinga, J.; Makingi, G.; Dalsgaard, A. Toxigenic Vibrio cholerae O1 in vegetables and fish raised in wastewater irrigated fields and stabilization ponds during a non-cholera outbreak period in Morogoro, Tanzania: An environmental health study. BMC Res. Notes 2016, 9, 466. [Google Scholar] [CrossRef] [PubMed]
  59. Gao, H.; Zhang, J.; Lou, J.; Li, J.; Qin, Q.; Shi, Q.; Zhang, Y.; Kan, B. Direct Binding and Regulation by Fur and HapR of the Intermediate Regulator and Virulence Factor Genes within the ToxR Virulence Regulon in Vibrio cholerae. Front. Microbiol. 2020, 11, 709. [Google Scholar] [CrossRef]
  60. Alishahi, A.; Fooladi, A.I.; Mehrabadi, J.F.; Hosseini, H.M. Facile and rapid detection of Vibrio cholerae by Multiplex PCR based on ompU, ctxA, and toxR Genes. Jundishapur J. Microbiol. 2013, 6, 5. [Google Scholar] [CrossRef]
  61. Matson, J.S.; Withey, J.H.; DiRita, V.J. Regulatory networks controlling Vibrio cholerae virulence gene expression. Infect. Immun. 2007, 75, 5542–5549. [Google Scholar] [CrossRef]
  62. Marashi, S.M.A.; Bakhshi, B.; Fooladi, A.A.I.; Tavakoli, A.; Sharifnia, A.; Pourshafie, M.R. Quantitative expression of cholera toxin mRNA in Vibrio cholerae isolates with different CTX cassette arrangements. J. Med. Microbiol. 2012, 61, 1071–1073. [Google Scholar] [CrossRef]
  63. Kumar, A.; Das, B.; Kumar, N. Vibrio pathogenicity island-1: The master determinant of cholera pathogenesis. Front. Cell. Infect. Microbiol. 2020, 10, 561296. [Google Scholar] [CrossRef]
  64. Castillo, D.; Kauffman, K.; Hussain, F.; Kalatzis, P.; Rørbo, N.; Polz, M.F.; Middelboe, M. Widespread distribution of prophage-encoded virulence factors in marine Vibrio communities. Sci. Rep. 2018, 8, 9973. [Google Scholar] [CrossRef] [PubMed]
  65. Mauritzen, J.J.; Castillo, D.; Tan, D.; Svenningsen, S.L.; Middelboe, M. Beyond cholera: Characterization of zot-encoding filamentous phages in the marine fish pathogen Vibrio anguillarum. Viruses 2020, 12, 730. [Google Scholar] [CrossRef] [PubMed]
  66. Chomvarin, C.; Jumroenjit, W.; Tangkanakul, W.; Hasan, N.A.; Chaicumpar, K.; Faksri, K.; Huq, A. Genotype and drug resistance of clinical and environmental Vibrio cholerae non-O1/non-O139 in Northeastern Thailand. Southeast Asian J. Trop. Med. Public Health 2014, 45, 1354–1364. [Google Scholar] [PubMed]
  67. Danso, E.K.; Asare, P.; Otchere, I.D.; Akyeh, L.M.; Asante-Poku, A.; Aboagye, S.Y.; Osei-Wusu, S.; Opare, D.; Ntoumi, F.; Zumla, A.; et al. A molecular and epidemiological study of Vibrio cholerae isolates from cholera outbreaks in southern Ghana. PLoS ONE 2020, 15, e0236016. [Google Scholar] [CrossRef]
  68. Ramamurthy, T.; Chowdhury, G.; Pazhani, G.P.; Shinoda, S. Vibrio fluvialis: An emerging human pathogen. Front. Microbiol. 2014, 5, 91. [Google Scholar] [CrossRef]
  69. D’Souza, C.; Prithvisagar, K.S.; Deekshit, V.K.; Karunasagar, I.; Karunasagar, I.; Kumar, B.K. Exploring the Pathogenic Potential of Vibrio vulnificus isolated from Seafood Harvested along the Mangaluru Coast, India. Microorganisms 2020, 8, 999. [Google Scholar] [CrossRef]
  70. Fri, J.; Ndip, R.N.; Njom, H.A.; Clarke, A.M. Occurrence of virulence genes associated with human pathogenic vibrios isolated from two commercial dusky kob (Argyrosmus japonicus) farms and Kareiga estuary in the Eastern Cape Province, South Africa. Int. J. Environ. Res. Public Health 2017, 14, 1111. [Google Scholar] [CrossRef]
  71. Nagarajan, U.M.; Prantner, D.; Sikes, J.D.; Andrews Jr, C.W.; Goodwin, A.M.; Nagarajan, S.; Darville, T. Type I interferon signalling exacerbates Chlamydia muridarum genital infection in a murine model. Infec. Immun. 2008, 76, 4642–4648. [Google Scholar] [CrossRef]
  72. Lu, X.; Liang, W.; Wang, Y.; Xu, J.; Zhu, J.; Kan, B. Identification of genetic bases of Vibrio fluvialis species-specific biochemical pathways and potential virulence factors by comparative genomic analysis. Appl. Environ. Microbiol. 2014, 80, 2029–2037. [Google Scholar] [CrossRef]
  73. Song, L.; Huang, Y.; Zhao, M.; Wang, Z.; Sun, H.; Wang, S.; Kan, B.; Meng, G.; Liang, W.; Ren, Z. A critical role for haemolysin in Vibrio fluvialis-induced IL-1β secretion mediated by the NLRP3 inflammasome in macrophages. Front. Microbiol. 2015, 6, 510. [Google Scholar] [CrossRef]
  74. Chowdhury, G.; Pazhani, G.P.; Dutta, D.; Guin, S.; Dutta, S.; Ghosh, S.; Izumiya, H.; Asakura, M.; Yamasaki, S.; Takeda, Y.; et al. Vibrio fluvialis in patients with diarrhea, Kolkata, India. Emerg. Infect. Dis. 2012, 18, 1868. [Google Scholar] [CrossRef] [PubMed]
  75. Ralston, E.P.; Kite-Powell, H.; Beet, A. An estimate of the cost of acute health effects from food-and water-borne marine pathogens and toxins in the USA. J. Water Health 2011, 9, 680–694. [Google Scholar] [CrossRef] [PubMed]
  76. Luan, X.Y.; Chen, J.X.; Zhang, X.H.; Jia, J.T.; Sun, F.R.; Li, Y. Comparison of different primers for rapid detection of Vibrio parahaemolyticus using the polymerase chain reaction. Lett. Appl. Microbiol. 2007, 44, 242–247. [Google Scholar] [CrossRef] [PubMed]
  77. Almuhaideb, E.; Chintapenta, L.K.; Abbott, A.; Parveen, S.; Ozbay, G. Assessment of Vibrio parahaemolyticus levels in oysters (Crassostrea virginica) and seawater in Delaware Bay in relation to environmental conditions and the prevalence of molecular markers to identify pathogenic Vibrio parahaemolyticus strains. PLoS ONE 2020, 15, 0242229. [Google Scholar] [CrossRef] [PubMed]
  78. Guin, S.; Saravanan, M.; Chowdhury, G.; Pazhani, G.P.; Ramamurthy, T.; Das, S.C. Pathogenic Vibrio parahaemolyticus in diarrhoeal patients, fish and aquatic environments and their potential for inter-source transmission. Heliyon 2019, 5, e01743. [Google Scholar] [CrossRef]
Microorganisms 11 02449 g001
Figure 1. (a) PCR gel representatives of Vibrio genus. Lane D: DNA Ladder (100 bp), lane 1:. negative control, lane 2: Positive control (663bp), lane 3–12: isolates positive to 16SrRNA gene (663 bp). (b) Distribution of the Vibrio genus isolates among the three sampling sites.
Figure 1. (a) PCR gel representatives of Vibrio genus. Lane D: DNA Ladder (100 bp), lane 1:. negative control, lane 2: Positive control (663bp), lane 3–12: isolates positive to 16SrRNA gene (663 bp). (b) Distribution of the Vibrio genus isolates among the three sampling sites.
Microorganisms 11 02449 g001
Microorganisms 11 02449 g002
Figure 2. PCR multiplex gel representatives of the Vibrio species. Lane D: DNA ladder, lane 1: negative control. Lanes 2,6,7: positive isolates for V. fluvialis (217 bp). Lanes 3,8,9: positive V. cholerae isolates (304 bp). Lanes 4,10,11: positive V. vulnificus isolates (410 bp). Lanes 12, 13: positive V. parahaemolyticus isolates (897 bp).
Figure 2. PCR multiplex gel representatives of the Vibrio species. Lane D: DNA ladder, lane 1: negative control. Lanes 2,6,7: positive isolates for V. fluvialis (217 bp). Lanes 3,8,9: positive V. cholerae isolates (304 bp). Lanes 4,10,11: positive V. vulnificus isolates (410 bp). Lanes 12, 13: positive V. parahaemolyticus isolates (897 bp).
Microorganisms 11 02449 g002
Microorganisms 11 02449 g003
Figure 3. (a) shows the frequency of virulence genes detected among V. cholerae isolates in the sampling sites, (b) shows the frequency of the dual virulence genes among isolates of V. vulnificus at the three sites, (c) shows the frequency of virulence genes (hupO and vfh) among V. fluvialis isolates in the sampling sites and (d) shows the frequency of the tdh and tlh among V. parahaemolyticus isolates in the three sites.
Figure 3. (a) shows the frequency of virulence genes detected among V. cholerae isolates in the sampling sites, (b) shows the frequency of the dual virulence genes among isolates of V. vulnificus at the three sites, (c) shows the frequency of virulence genes (hupO and vfh) among V. fluvialis isolates in the sampling sites and (d) shows the frequency of the tdh and tlh among V. parahaemolyticus isolates in the three sites.
Microorganisms 11 02449 g003
Microorganisms 11 02449 g004
Figure 4. Gel multiplex representatives among V. cholerae isolates (a) lane 1: DNA molecular ladder (100 bp), lane 2: negative control; lane 3–14: positive ctx gene (301 bp) and tcpA genes (451), (b), lane 1: DNA molecular ladder (100 bp), lane 2: negative control; lane 3–14: positive isolates for toxR gene (779 bp) and hylA gene (481 bp), (c), lane 1: molecular DNA ladder (100 bp), lane 2: negative control, lane 3–8: positive isolates for ompU gene (869 bp), lane 9–12: positive isolates for VPI genes (680 bp).
Figure 4. Gel multiplex representatives among V. cholerae isolates (a) lane 1: DNA molecular ladder (100 bp), lane 2: negative control; lane 3–14: positive ctx gene (301 bp) and tcpA genes (451), (b), lane 1: DNA molecular ladder (100 bp), lane 2: negative control; lane 3–14: positive isolates for toxR gene (779 bp) and hylA gene (481 bp), (c), lane 1: molecular DNA ladder (100 bp), lane 2: negative control, lane 3–8: positive isolates for ompU gene (869 bp), lane 9–12: positive isolates for VPI genes (680 bp).
Microorganisms 11 02449 g004
Microorganisms 11 02449 g005
Figure 5. (a) Gel multiplex representative isolates of V. fluvialis. Lanes 3,8,9 and 10 showing hupO gene (800 bp) and lanes 2 and 5 showing vfh gene (600 bp). However, lanes 4, 6 and 7 are negative controls. (b) gel multiplex electrophoresis of V. vulnificus isolates showing vcgA gene and vcgB gene with 278 bp respectively, (c) gel multiplex electrophoresis of V. parahaemolyticus isolates. Lane 1: DNA ladder (100 bp), lane 3: negative control, lane 2, 4–14: positive isolates for 16srRNA gene (663 bp), Tdh gene (269 bp) and TIh gene (450 bp).
Figure 5. (a) Gel multiplex representative isolates of V. fluvialis. Lanes 3,8,9 and 10 showing hupO gene (800 bp) and lanes 2 and 5 showing vfh gene (600 bp). However, lanes 4, 6 and 7 are negative controls. (b) gel multiplex electrophoresis of V. vulnificus isolates showing vcgA gene and vcgB gene with 278 bp respectively, (c) gel multiplex electrophoresis of V. parahaemolyticus isolates. Lane 1: DNA ladder (100 bp), lane 3: negative control, lane 2, 4–14: positive isolates for 16srRNA gene (663 bp), Tdh gene (269 bp) and TIh gene (450 bp).
Microorganisms 11 02449 g005
Table 1. Sites and the geographical coordinates.
Table 1. Sites and the geographical coordinates.
MunicipalitySampling SiteCoordinates
Buffalo CityTertiary hospital wastewater effluent (THWE)32°55′37″ S
27°44′42″ E
Amathole DistrictSecondary hospital wastewater effluent (SHWE)32°77′53″ S
26°84′64″ E
Limbede community wastewater (LCWE)32°77′53″ S
26°84′64″ E
Table 2. Oligonucleotide primers for the confirmation of Vibrio genus and species.
Table 2. Oligonucleotide primers for the confirmation of Vibrio genus and species.
Target OrganismGene TargetOligonucleotide Sequence (5′-3′)Length (bp)PCR Cycling
Conditions		References
Vibrio genus16S rRNA FP:CGG TGAAATGCGTAGAGAT
RP:TACTAGCGATTCCGAGTTC		663Firstly, denaturation at 93 °C for 15 min accompanied by 35 cycles of denaturation at 92 °C for 40 s, annealing at 57 °C for 1 min, elongation at 72 °C for 1.5 min and lastly, elongation at 72 °C for 7 min[31]
V. choleraeOmpWFP:CACCAAGAAGGTGACTTTATTGTG
RP:GGTTTGTCGAATTAGCTTCACC		304Firstly, denaturation at 93 °C for 15 min accompanied by 35 cycles of denaturation: 92 °C for 40 s, annealing: 57 °C for 1 min, elongation 72 °C for 1.5 min, and lastly, elongation at 72 °C for 7 min[32]
V. parahaemolyticusflaE FP:GCAGCTGATCAAAACGTTGAGT
RP:ATTATCGATCGTGCCACTCAC 		897Firstly, denaturation at 94 °C for 5 min, accompanied by 30 cycles of 94 °C for 40 s, 64 °C for 40 s, 72 °C for 90 s, and lastly, elongation at 72 °C for 7 min[33]
V. vulnificusHsp0 FP: GTCTTAAAGCGGTTGCTGC
RP: CGCTTCAAGTGCTGGTAGAAG		410Firstly, denaturation at 94 °C for 5 min, accompanied by 35 cycles of 94 °C for 30 s, 55 °C for 30 s, 72 °C for 30 s, and lastly, elongation at 72 °C for 10 min[33]
V. fluvialistoxR FP:GACCAG GGCTTTGAGGTGGAC
RP:GGATACGGCACTTGAGTAAGACTC		217Firstly, denaturation at 94 °C for 5 min, accompanied by 30 cycles of 94 °C for 40 s, 65 °C for 40 s, 72 °C for 1 min, and lastly elongation at 72 °C for 7 min[34]
Table 3. Primer sequences for virulence genes detection among the Vibrio species.
Table 3. Primer sequences for virulence genes detection among the Vibrio species.
SpeciesGeneOligonucleotide Sequence (5′-3′)Amplicon Size (bp)Annealing Temp (°C)References
V. choleraetcpA F:GAAGAAGTTTRTAAAAGAAGAACA
R:GAAAGGACCTTCTTTCACGTTG		45155 [35]
toxR F:ATGTTCGGATTAGGACAC
R:TACTCACACACTTTGATGGC		77960 [36]
ompU F:ACGCTGACGGAATCAACCAAAG
R:GCGGAAGTTTGGCTTGAAGTAG		86962 [37]
zot F:TCGCTTAACGATGGCGCGTTTT
R:AACCCCGTTTCACTTCTACCCA		94762 [37]
ctx F:CTCAGACGGGATTTGTTAGGCACG
R:TCTATCTCTGTAGCCCCTATTACG		30155 [38]
VPI F:GCAATTTAGGGGCGCGACGT
R:CCGCTCTTTCTTGATCTGGTAG		68052 [39]
hylA F:GAGCCGGCATTCATC TGAAT
R:CTCAGCGGGCTAATACGGTTTA		48160[40]
V. vulnificusvcgA F:AGCTGCCGATAGCGATCT
R:CGCTTAGGATGATCGGTG		27856 [41]
vcgB F:CTCAATTGACAATGATCT
R:CGCTTAGGATGATCGGTG		27856 [41]
V. fluvialisvfh F:GCGCGTCAGTGGTGGTGAAG
R:TCGGTCGAACCGCTCTCGCTT		80061 [42]
hupO F:ATTACGCACAACGAGTCGAAC
R:ATTGAGATGGTAAACAGCGCC		60056 [42]
vfpA F:TACAACGTCAAGTTAAAGGC
R:GTAGGCGCTGTAGCCTTTCA		179055 [42]
V. parahaemolyticusStn F:GGTGCAACATAATAAACAGTCAACAA
R:TAGTGGTATGCGTTGCCAGC		37553[42]
Tdh F-GTAAAGGTCTCTGACTTT TGGAC
R-TGGAATAGAACCTTCATCTTCACC		26958[43]
Tlh F:AAAGCGGATTATGCAGAAGCACTG
R:GCTACTTTCTAGCATTTTCTCTGC		45058 [44]
TrhF:TTGGCTTCGATATTTTCAGTATCT
R:CATAACAAACATATGCCCATTTCCG		50058[43]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Mavhungu, M.; Digban, T.O.; Nwodo, U.U. Incidence and Virulence Factor Profiling of Vibrio Species: A Study on Hospital and Community Wastewater Effluents. Microorganisms 2023, 11, 2449. https://doi.org/10.3390/microorganisms11102449

AMA Style

Mavhungu M, Digban TO, Nwodo UU. Incidence and Virulence Factor Profiling of Vibrio Species: A Study on Hospital and Community Wastewater Effluents. Microorganisms. 2023; 11(10):2449. https://doi.org/10.3390/microorganisms11102449

Chicago/Turabian Style

Mavhungu, Mashudu, Tennison O. Digban, and Uchechukwu U. Nwodo. 2023. "Incidence and Virulence Factor Profiling of Vibrio Species: A Study on Hospital and Community Wastewater Effluents" Microorganisms 11, no. 10: 2449. https://doi.org/10.3390/microorganisms11102449

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop