Abstract
Anaplasma (A.) ovis is the most important cause of anaplasmosis in small ruminants. The current study was planned to estimate the molecular prevalence, risk factors, and phylogenetic analysis of A. ovis infection in sheep and goats from different agro-climatic regions of Central and Southern Punjab, Pakistan. A total of 400 jugular blood samples were collected from asymptomatic goats (n = 200) and sheep (n = 200) from the Jhang and Dera Ghazi Khan districts from January 2021 to February, 2023. Two hundred blood samples were collected from each district. Ten union councils (UC) were randomly chosen from each district, and 20 samples were collected from each UC based on the multistage cluster sampling technique. The samples were analyzed with PCR targeting the major surface protein (msp4) gene of A. ovis. The overall molecular prevalence of anaplasmosis was 57.5%. The disease occurrence was higher in Dera Ghazi Khan (61.5%) than in the Jhang district (53.5%). Infection positivity was greater in goats (65.5%) than in sheep (49.5%). Multivariate logistic regression analysis indicated that host species [sheep; Odds Ratio (OR) = 3.212; p = 0.000, Confidence Interval (CI) = 1.968–5.242], age (adult; OR = 2.606; p = 0.003, CI = 1.398–4.858), and acaricide use (never; OR = 13.671; p = 0.000, CI = 6.414–26.283) were significantly higher risk for A. ovis in small ruminants (p < 0.05; OR > 1). The sequencing and phylogenetic analysis of four representative isolates in the current study (Genbank numbers; Goats: OQ302202, OQ302203; Sheep: OQ319592, OQ319593) revealed novel strains of A. ovis with 97–100% similarity from different countries. The msp4-based goat isolates showed greater genetic diversity, while sheep genotypes showed homology with isolates from Italy, Spain, Hungary, Cyprus, Spain, Iran, and China. The current surveillance study will help in devising prevention and control strategies regarding anaplasmosis in small ruminants. However, there is a need for further study on the clinicopathological and vector competence aspects of these genotypes.
1. Introduction
Livestock is the principal subsector of agriculture, contributing 62.68% to agriculture and 14.36% to the national gross domestic product (GDP) of Pakistan in 2022–2023. Over eight million village families are associated with livestock production, deriving 35–40 percent of their income from livestock [1]. Pakistan is the third largest goat-producing country in the world, with a goat population of 84.7 million. Based on sheep production, Pakistan is the 12th largest country, with 32.3 million heads [1,2]. Livestock production is hampered by ticks and tick-borne diseases (TBD), which cause substantial economic losses associated with treatment, prevention, and control. Anaplasmosis is one of the major tick-transmitted diseases, and it has a remarkable impact on productivity, the health of small ruminants, and the livelihood of resource-limited farmers [3,4]. Anaplasma species that mainly infect small ruminants are Anaplasma (A.) ovis, A. phagocytophilum, and A. marginale [1,5]. A. ovis is an obligate intracellular intraerythrocytic Gram-negative bacterium that was first discovered in 1912 by Bevan [6]. It is the major cause of caprine/ovine anaplasmosis, and among other small ruminants worldwide, including in Pakistan, it is responsible for significant economic losses [3,7,8,9,10,11]. In Pakistan, recent studies have depicted the prevalence of A. ovis in small ruminants ranging from 12.5 to 59% [11,12,13,14,15,16].
The disease is usually subclinical in sheep and goats, but in acute cases, fever, severe anemia, decreased body weight, debility, decrease in milk production, pale mucous membranes, jaundice, abortion, and death may occur [5,17,18]. In addition, infection with A. ovis may predispose animals to contract additional infectious or parasitic diseases that worsen their health condition. After recovery from acute anaplasmosis, animals remain persistently infected and serve as reservoirs of infection, as well as a source for further spread [19,20]. A recent Spanish study demonstrated that untreated sheep remained permanently infected and served as carriers for their entire productive lives (4–6 years) after natural/experimentally infected cases [10].
Various biotic and abiotic factors, such as host (age, sex, breed, gestation, tick infestation, history of disease, body condition score, health status, carriers, and drug resistance), environment (climate, habitat, competent vector population, mechanical insect vectors, area, temperature, season, humidity, altitude, vegetation cover, rainfall, and reservoirs), and managemental determinants (animal movement, flock size, housing, floor, use of acaricide, grazing system, hygiene, stall feeding, agricultural and animal husbandry practices, and contaminated fomites), are associated with the occurrence of anaplasmosis [3,11,14,21,22]. The most important tick species known to transmit A. ovis are Rhipicephalus (R.) sanguineus (sensu lato), R. bursa, R. pumilio, R. turanicus, Dermacentor (D.) marginatus, D. andersoni, D. nuttalli, Ixodes ricinus, and Hyalomma asiaticum [23,24,25,26,27,28,29,30,31]. However, the vector competence for A. ovis is not known in Pakistan. The pathogen is transmitted by bites from hematophagous insects, transplacentally, and by blood-contaminated needles [8,32,33]. A. ovis also has zoonotic potential, and recent research has identified some variants among human patients from Iran, China, and Cyprus [32,34,35].
Anaplasmosis is usually diagnosed on the basis of a stained blood smear examination. This is quick to perform in clinical cases but unsuitable for detecting asymptomatic carriers with lower parasitemia. PCR based on nucleic acid detection provides much greater specificity and sensitivity than conventional blood smear microscopy [19]. Based on earlier reports, the 16S rRNA, msp4, and msp1a genes have been used for the determination of the genetic diversity of A. ovis isolates [8,36,37]. The major surface proteins (MSPs) interact with the host and evolve more rapidly compared to other genes because they are subjected to selective pressure by the host immune system [25].
In Pakistan, limited epidemiological information on caprine and ovine anaplasmosis is available. There are only two reports from Pakistan that targeted the msp4 gene for diagnosis. Among these, one study was performed in Northern Pakistan, and the second study depicted the prevalence of anaplasmosis only in sheep from one district with a small sample size [11,14]. The current study presents novel isolates during molecular detection, seasonality, and phylogenetic studies of A. ovis based on the msp4 gene in both sheep and goats from two agro-ecologically diverse regions of Punjab, Pakistan.
2. Materials and Methods
2.1. Study Area and Sample Collection
A total of 400 jugular blood samples were collected from asymptomatic sheep (n = 200) and goats (n = 200) from the Jhang and Dera Ghazi Khan districts of Punjab, Pakistan, from January 2021 to February, 2023. Two hundred blood samples were collected from each district. Ten union councils (UC) were selected from each district, and 20 samples were collected from each UC based on the multistage cluster sampling technique. These districts have diverse agro-climatic conditions, and the majority of people are greatly dependent on livestock, especially small ruminants. Jhang is located in the central part of the Punjab province between the Jehlum and Chenab rivers, situated at 31.27 latitude, 72.33 longitude, and 158 m elevation above sea level. Jhang has a warm (March, April, October, and November), sweltering (April to September), and humid climate, with extended summers. The average annual temperature during summer ranges from 55 to 70 °F (12.8–21.1 °C), while winter is cool, dry, and short, with an average temperature range from 42 to 55 °F (5.6–12.8 °C). Annual rainfall in the Jhang district is 0.89 inches (22.54 mm). The Dera Ghazi Khan district has a hot (February, March, April, October, and November), sweltering (April to September), and long humid summer, with an average high temperature range from 93 to 107 °F (33.9–41.7 °C), while winter is cool, dry, and short, with an average low temperature ranging from 47 to 59 °F (8.3–15 °C). Due to the barren mountains of Koh-e-Sulaiman and sandy soil, windstorms are common in summer. The average annual rainfall in the district was 0.04 inches (1.016 mm). It is located at 70.64 longitude and 30.04 latitude, with an elevation of 124 m above sea level [38,39] (Figure 1).
Figure 1.
Map showing the two study districts. D.G.K.: Dera Ghazi Khan.
Jugular blood was collected aseptically and transferred to vacutainers containing EDTA. The samples were stored immediately in an icebox. All the samples collected from the sheep and goats were analyzed at the Post-Graduate Laboratory of Medicine, College of Veterinary and Animal Sciences, Jhang, Pakistan.
2.2. DNA Extraction
DNA was extracted from the blood samples using a Gene JET Whole Blood Genomic DNA Purification Mini Kit (Thermofisher Scientific, Waltham, MA, USA) following the guidelines of the manufacturer. Briefly, using a micropipette, a 200 μL blood sample was added to an Eppendorf tube, and then Proteinase K solution (20 μL) was added for protein destruction and release of nucleic acid. Later on, a lysis solution (400 μL) was added, and the product was subjected to vortexing. The sample was then incubated at 56 °C in a water bath for 10 min. Afterward, 200 μL of ethanol was added, and the mixture was shifted to a spin column and subjected to centrifugation at 6000× g for 1 min. The spin column was twice washed with 500 μL of wash buffer and centrifuged (8000× g for 1 min and 12,000× g for 3 min). In the last step, elution buffer (200 μL) was added, and the genomic DNA was collected after centrifugation (8000× g for 1 min). The purified DNA was stored at −20 °C in a microcentrifuge tube until used for further processing.
2.3. PCR
A set of primers was used to amplify the msp4 gene sequence of A. ovis utilizing species-specific forward 5′TGAAGGGAGCGGGGTCATGGG3′ and reverse primers 5′GGTAATTGCAGCCAGGGACTCT3′ to yield a 347 base pair product, as described by Yousefi et al. [40]. A positive control in the form of a blood sample (2 mL) was obtained from Dr. Furhan Iqbal, Institute of Pure and Applied Biology, Bahauddin Zakariya University, Multan, Pakistan. The sample was collected from a PCR-positive goat from the Dera Ghazi Khan district, Pakistan. Distilled water was used as a negative control. PCR was conducted in a 20 µL reaction mixture containing 10 mm Tris-HCl (PH 9.0), 30 mM KCl, 1.5 mM MgCl2, 250 mm each dNTP, 0.5 mm each forward and reverse primer, 1 IU Taq DNA polymerase, and 2 µL of the DNA, and processed in an automated thermal cycler (T-100TM, BioRad, Hercules, CA, USA). Afterward, there was an initial denaturation step at 95 °C for 5 min. Each cycle consisted of denaturation at 94 °C for 30 s, annealing at 58 °C for 30 s, and extension at 60 °C for 30 s, followed by a final extension for 5 min. The PCR yields were examined on agarose gel 1.5% w/v with ethidium bromide (0.5 µg/µL of gel in 1× TAE buffer) using a DNA ladder of 50 bp (Thermofisher Scientific, Waltham, MA, USA; 00834919) connected to a power supply of 120 V for 30 min. To capture the gel image, the product was visualized using a UV illuminator (Biotech Fischer, Reiskirchen, Germany).
2.4. Estimation of Risk Factors
For the estimation of epidemiological risk factors, a pretested questionnaire was designed to collect information after consent regarding the biotic and abiotic risk factors of the area (Jhang, Dera Ghazi Khan), age (<6 months, 6–12 months, and >12 months), sex (male and female), breed (Kajli, Lohi, Buchi, Sipli, Beetal, Desi, Taddy, and Nachi), species (goat and sheep), tick infestation load (heavy > 50, moderate 10–50, and low 0–10 ticks), grazing system (free-grazing, semi-grazing, and zero/stall feeding), and acaricide use (regular, irregular, and never) associated with caprine and ovine anaplasmosis. The questionnaire, with close-ended questions, was completed on the spot at the time of blood sampling.
2.5. Sequencing and Phylogenetic Analysis
The positive representative samples (n = 4) were sent for nucleotide sequencing isolated from sheep and goats to Celemics Inc. using Barcode Tagged sequencing (BTSeqTM). The selected msp4 sequences of A. ovis isolated from sheep, goat, sheep milk, roe deer, European red deer, humans, and ticks (Rhipicephalus sanguineus and Dermacentor marginatus) were utilized for the construction of a phylogenetic tree and compared with isolates from different countries (Iran LC430940, LC430942, MH017205, MH017206, MH411146, JQ621902, JQ621903, JQ663993, MH790273, MH790274, MK252270, KY091899, MK828060, MK828061; India MW561186; Kenya MF360026, MF360027, MF360028; Tunisia KY659323, KY659324, KC432643; Turkey KT251211, KY283958, MT344080, MT344081, MT344082, OM127900; China KU525114, KU525115, KU525120, KU525123, MZ502497, MZ502499, KU525117, KU525119, MZ502498, KU525113, KU525118; Spain HQ014384, EF067341; Italy AY702924, GQ130275; Cyprus FJ460455, FJ460443; Pakistan MT311200, MT311201, MT311202, MT311203; Hungary EF190509, EF190510, EF190511; Egypt MN882167, MN882168, OL859532, OL859533, P244843, OP244845, OP244846; and Mongolia LC141086). The evolutionary history was gathered using the maximum likelihood method and the Tamura 3-parameter model [41]. Evolutionary analyses were conducted in MEGA11 [42]. Statistical backing for the internal braces was set for bootstrap analysis with 500 replications. A Rickettsia rickettsii (U11021) sequence isolated from Dermacentor andersoni ticks was used as outgroup for phylogenetic analysis.
2.6. Statistical Analysis
Descriptive information related to risk factors was compared using the chi-square test. Univariable analysis was utilized to estimate the relationship between the molecular positivity of A. ovis and categorical variables. Variables with p < 0.20 were retained for the final multivariable logistic regression analysis for the estimation of linked risk factors using the Statistical Package for the Social Sciences software version 26.0 (IBM Corp., Armonk, NY, USA). A p-value less than or equal to 0.05 was considered statistically significant.
2.7. Ethical Approval
All procedures, including the handling and care of the animals, were performed as per the guidelines of the Institutional Review Committee for Biomedical Research, University of Veterinary and Animal Sciences, Lahore, Pakistan; approved vide letter No. DAS-623, dated 17 March 2022.
3. Results
3.1. Molecular Prevalence
For molecular prevalence, PCR was performed targeting the msp4 gene using A. ovis species-specific primers. We noticed an overall prevalence of 57.5% (230/400). The PCR product of 347 bp was observed on the agarose gel using the UV gel illuminator (Figure 2). A higher prevalence was recorded in Dera Ghazi Khan (61.5%; 123/200) compared to Jhang (53.5%; 107/200). An equal number of blood samples were collected from sheep and goats. The results revealed a higher prevalence of anaplasmosis in goats (65.5%; 131/200) compared to sheep (49.5%; 99/200). Chi-square analysis indicated a statistically significant association between species-wise prevalence (X2 = 10.476, df = 1, p = 0.001). The results revealed that A. ovis was more common in adults than in young animals. On the basis of age, small ruminants were categorized into three groups (<6 months, 6–12 months, and >12 months). The prevalence was higher in the >12 months of age (64.9%; 133/205) than in the <6 months (40.5%; 30/74) and 6–12 months (55.4%; 67/121) age cohorts. A significant association was found among different age groups (X2 = 13.500, df = 2, p = 0.001). Sex-wise prevalence showed a significant association (X2 = 3.980, df = 1, p = 0.046), indicating a higher prevalence in females (61.7%) than in males (51.8%), irrespective of area and host type. For evaluating the role of tick infestation concerning pathogens, the animals were screened for tick infestation. Based on tick infestation load, the animals were categorized into three groups: low (0–10 ticks), moderate (10–50 ticks), and heavy (>50 ticks) tick infestations. In the region, the predominant tick species infesting small ruminants noticed were Rhipicephalus sanguineus, Hyalomma anatolicum, and Hy. marginatum. The animals infested with a higher number of ticks had higher infection rates than the tick-free animals, with a significant association (X2 = 9.514, df = 2, p = 0.009). To evaluate the prevalence based on grazing pattern, the animals were categorized into three groups: free-grazing, semi-grazing, and zero-grazing/stall-fed animals. The highest prevalence was noticed in the free-grazing system. Grazing had a significant effect on disease outcome (X2 = 16.917, df = 2, p = 0.000). A total of 59 goats and sheep were treated regularly, 99 were irregularly treated with acaricides, and 242 had never received any acaricidal treatment. The highest disease positivity was observed in the group that had never used acaricidal treatment, with a statistically significant effect (X2 = 68.048, df = 2, p = 0.000). The highest infection rate was recorded in the Nachi breed of goat. The breed factor showed as a significantly associated predictive variable (X2 = 68.048, df = 2, p = 0.000), while season had a non-significant effect on disease outcome.
Figure 2.
Gel image showing the 347 bp product of A. ovis in well number L5. Wells: L1 ladder; L2 and L3 were negative controls; L4 acted as a positive control.
3.2. Risk Factor Study
Risk factor estimation based on univariate regression analysis indicated that age (B = 0.504; OR = 1.655; p = 0.001, CI = 1.214–2.258), acaricide use (B = 1.317; OR = 3.734; p = 0.000, CI = 2.611–5.340), and sex (B = 0.534; OR = 1.705; p = 0.031, CI = 1.050–2.769) were significantly at a higher risk of acquiring A. ovis infection (p ≤ 0.05; OR > 1). Additionally, host species were retained for final multivariate analysis (B = 0.935; OR = 2.546; p = 0.070, CI = 0.925–7.007). Conversely, the independent variables of area, host species, tick infestation load, grazing pattern, breed, and season had non-significant effects on disease outcome (p > 0.05 and OR < 1), (Table 1).
Table 1.
Univariate regression analysis for the estimation of risk factors related to anaplasmosis in sheep and goats.
Multivariate logistic regression analysis indicated that host species (goats; B = 1.167; OR = 3.212; p = 0.000, CI = 1.968–5.242), age (adult; B = 0.958; OR = 2.606; p = 0.003, CI = 1.398–4.858), and acaricide use (never; B = 2.615; OR = 13.671; p = 0.000, CI = 6.414–26.283) were significantly at higher risk for anaplasmosis (p ≤ 0.05 and OR > 1). Goats were 3.121 times at higher risk compared to sheep. Similarly, age-based variables demonstrated that animals of >12 months and 6–12 months of age had 2.606- and 1.702-fold higher chances of getting infected compared to <6 months of age, respectively. Likewise, small ruminants who never or irregularly treated with acaricide were at 13.671 and 2.986 times higher risk, respectively, compared to regular use of acaricide. Sex proved to be a non-significant risk factor, with a higher p-value (> 0.05) and lower odds ratio (<1) (Table 2).
Table 2.
Multivariate regression analysis for the estimation of risk factors related to anaplasmosis in sheep and goats.
3.3. Phylogenetic Analysis
Representative PCR-positive products (n = 4) were sent for nucleotide sequencing and later submitted to NCBI. We successfully obtained GenBank accession numbers for four isolates: two from sheep (OQ319592 and OQ319593) and two from goats (OQ302202 and OQ302203). The maximum likelihood method-based phylogenetic tree of A. ovis (msp4) indicated two major clades. Clade I was divided into four clusters. The current study’s isolates collected from sheep (OQ319592 and OQ319593) were in cluster I, along with genotypes of countries belonging to Iran MH017206, MH41146, MH017205, MF360028, MF360027, MF360026, LC430940, LC430942, KY659324, KY659323, KY283958; Kenya MF360026, MF360027, MF360028; Tunisia KY659323, KY659324, KC432643; Turkey KY283958; China KU525123, KU525120, KU525115, KU525114; Spain EF067341; Italy GQ130275; Cyprus FJ460443, FJ460455; and Hungary EF190509, EF190510, EF190511. Cluster II comprised of isolates from Iran MH790273, MH790274, MK252270; Egypt MN882167, MN882168, OL859532, OL859533, OP244843, OP244845; Pakistan MT311200, MT311201, MT311202, MT311203; Turkey MT344080, MT344081, MT344082, OM127900; and China MZ502497, MZ502499. Cluster III consisted of Mongolia LC141086; India MW561186; China KU525117, KU525119, MZ502498; and Iran KY091899. Cluster IV included isolates from China KU525113, KU525118 and Iran MK82860 (Figure 3). Our isolates from goats (OQ302202 and OQ302203) showed higher diversity and were grouped in a separate clade II. Our sequences from small ruminants showed 97–100% similarity with global isolates submitted to GenBank from different countries.
Figure 3.
Maximum likelihood based evolutionary tree of Pakistani isolates of A. ovis (msp4) collected from sheep and goats. Sheep local isolates are indicated with yellow rhombus along with bold font and asterisk symbol *; goat local isolates are indicated in red triangle along with bold font and asterisk symbol *; I, II, III, IV are indicating clusters; V (clade).
4. Discussion
Anaplasmosis is one of the most common tick-borne diseases (TBDs) worldwide, particularly in tropical and subtropical regions. Anaplasma ovis has been reported globally, including in Africa, Asia, Europe, and America [14,23,25,26,27,28,33,34,36,43]. In Pakistan, similar molecular studies are limited to two surveys that differ in terms of sample size, seasonality, targeted species, outcome, and study location [11,14]. In the current surveillance study, we estimated disease status based on molecular detection, risk factors, seasonality, and phylogenetic analysis of A. ovis (msp4) in both sheep and goats from the agro-ecologically diverse central and southern regions of Punjab, Pakistan.
The present study indicated an overall disease positivity of 57.5%. In Pakistan, earlier studies by Khan and coworkers are consistent with our research; they demonstrated a higher seropositivity of 59% in the Charsadda district, Pakistan, utilizing a commercially available competitive enzyme-linked immunosorbent assay [16]. The findings of our study strongly differ from the study by Niaz and his colleagues, who depicted a lower disease occurrence of 45.1% in Northern Pakistan [11]. Earlier reports from different countries depicted higher prevalence, ranging from 63 to 94%, viz. Iran, Iraq, Hungary, Turkey, Portugal, and Tunisia [3,20,26,44,45], while lower disease positivity rates compared to our study were documented from Senegal, Egypt, Slovakia, and India [36,46,47,48]. The diagnostic assay, local climatic conditions, flock size, poor hygienic conditions, and breeds may have been attributed to the variable occurrence of disease. A higher prevalence was recorded in Dera Ghazi Khan (61.5%; 123/200) compared to Jhang (53.5%; 107/200). The geographic location-based prevalence indicated a non-significant association. The higher occurrence of disease in Dera Ghazi Khan was due to higher vegetation cover, higher flock size, higher grazing, and poor husbandry practices.
The regression analysis indicated that goats were at a 3.212-fold higher risk compared to sheep. Similarly, the prevalence of anaplasmosis was significantly higher in goats than in sheep, regardless of the study area. These findings are in agreement with previous research by Selim et al. [22], Yousefi et al. [40], and Enkhtaivan et al. [49], as they demonstrated higher infection rates in goats (71.3%, 21.3%, and 34.7%, respectively) compared to sheep (69%, 18.3%, and 20.8%, respectively). There is a local trend of rearing goats with cows by resource-limited smallholder dairy farmers in Pakistan. This factor can contribute to a higher disease prevalence.
The results of the current study indicated a significant association between positive outcomes and the age of the animals. The highest prevalence (64.9%) was noticed in more than 12 months of age, while the lowest prevalence was in animals under 6 months of age. The age-wise results are consistent with Khan et al. [16] and Cabezas-Cruz et al. [50] and inconsistent with Hornok et al. [26]; they depicted a higher seroprevalence in adult small ruminants. The age-wise results are attributed to the fact that prevalence increases with age. The higher prevalence might be due to a higher number of carriers and adults, owing to exposure to various tick seasons [36,51].
The chi-square-based results of the current study on sex revealed a statistically significant association. The sex-wise results are supported by Khan et al. [16], who showed a 64.3% positivity rate in females for anaplasmosis in small ruminants. These findings are also endorsed by Niaz and colleagues, who depicted a higher disease positivity rate (16%) in females compared to males (7.3%) from Northern Pakistan [11]. The possible reason is that female animals are kept for a longer period of time and are likely exposed to several vector seasons.
The breed-wise prevalence in sheep expressed a significant relationship among different breeds, irrespective of age, sex, and area. However, the breed variable was not a significant determinant in univariate and multivariate regression analysis. These results are in agreement with Khan et al. [16], Cabzas-Cruz et al. [44], and Cabzas-Cruz et al. [50], who stated that the prevalence of TBDs is associated with breeds of domestic small ruminants, while Khan and colleagues depicted inconsistent findings in which breed was not a significant risk factor for acquiring anaplasmosis [51]. Certainly, local Pakistani breeds are more resistant to tick-borne infection. Regional Iranian breeds of sheep expressed a higher tendency to infection, parasitemia, and anemia during infection [52].
The highest prevalence was noticed in free-grazing animals (39.6%), followed by stall-fed or zero-grazing animals (36.5%), and the lowest in semi-grazing animals (23.9%). The chi-square test indicated a significant association between grazing pattern and disease in small ruminants, while regression analysis revealed a non-significant outcome. Yang and colleagues depicted that animals are more prone to infection, and the occurrence of anaplasmosis is associated with free-grazing [33]. Niaz and associates depicted that grazing is a predisposing factor for anaplasmosis [11]. Grazing could have increased contact between vectors, different farms, and other small animals [53].
A higher prevalence of A. ovis was recorded in the summer months. Our findings are consistent with those of Atif et al. [54], who also reported the highest prevalence of infection during summer, owing to a higher abundance and tick vector activity. Conversely, our findings are contradictory to those of Ashraf et al. [55], who mentioned that the highest occurrence was in autumn. When tick vectors are not widespread, it suggests that mechanical transmission might have played a role in the transmission of disease. This lets us suggest that the variations in disease prevalence rates are due to differences in geographical location and breeding microenvironment [11,14]. However, this factor was non-significant in all utilized statistical tests. The studied regions have extended dry, humid summers and short, cool winters, owing to less seasonal variation influencing disease occurrence.
In the current study, chi-square and regression analysis revealed that no application of acaricide is the most significant risk factor. The odds of developing the disease were 13.671 times higher in animals who had never received acaricide than in animals with regular acaricidal application. These results are in agreement with Rahman et al. [56], concluding that regular treatment with acaricide can control tick infestation, which eventually prevents anaplasmosis.
The phylogenetic analysis of the current study based on msp4 revealed four novel isolates with a higher diversity of A. ovis genotypes in goats compared to sheep. The higher genetic diversity of goat isolates is linked to goat movement across the country for sale, purchase, and religious festivals, as we know that Pakistan is the third largest goat producer in the world. Our goat isolates were in a separate clade, while our sheep isolates were clustered with other geographical isolates from different countries like Italy, Spain, Hungary, Cyprus, Spain, Iran, and China. Our isolates from small ruminants showed 97–100% resemblance with isolates from different countries.
5. Conclusions
It is concluded that anaplasmosis is highly endemic in small ruminants. Never using acaricide is the major risk factor associated with the molecular occurrence of anaplasmosis. Phylogenetic analysis revealed novel isolates of A. ovis in sheep and goats. Further studies need to be conducted to evaluate the clinicopathological, economic loss, and vector transmission aspects of these genotypes for better prevention and control of anaplasmosis.
Author Contributions
Conceptualization, F.A.A. and S.U.; writing—original draft, S.U., F.A.A., R.C.-B., M.K., A.U.K. and W.-F.W.; methodology, S.U.; formal analysis, investigation, resources, and data curation, S.U., F.A.A. and A.U.K.; writing—review and editing, F.A.A., S.U., R.C.-B., M.K., A.U.K. and W.-F.W.; project administration, F.A.A.; funding acquisition, F.A.A., R.C.-B. and W.-F.W. All authors have read and agreed to the published version of the manuscript.
Funding
This research was partially supported by the Higher Education Commission of Pakistan’s project No. 9041/Punjab/NRPU/R&D/HEC/2017; entitled “Molecular epidemiology, concurrent detection and characterization of Anaplasma, Babesia, Theileria and Ehrlichia species from cattle, buffaloes and ixodid ticks”.
Institutional Review Board Statement
All procedures, including the handling and care of animals, were approved vide No. DAS-623, dated 17 March 2022, by the Institutional Review Committee for Biomedical Research, University of Veterinary and Animal Sciences, Lahore, Pakistan.
Data Availability Statement
The data will be available upon request.
Conflicts of Interest
The authors declare no conflict of interest.
References
- Economic Survey of Pakistan. Agriculture, Ministry of National Food Security and Research; Government of Pakistan: Islamabad, Pakistan, 2023; pp. 34–36.
- Khan, M.; Khan, M.; Ahmad, S.; Mahmood, S. Genetic resources and diversity in Pakistani sheep. Int. J. Agric. Biol. 2007, 9, 941–944. [Google Scholar]
- Renneker, S.; Abdo, J.; Salih, D.E.; Karagenç, T.; Bilgiç, H.; Torina, A.; Oliva, A.G.; Campos, J.; Kullmann, B.; Ahmed, J.; et al. Can Anaplasma ovis in small ruminants be neglected any longer? Transbound. Emerg. Dis. 2013, 60 (Suppl. S2), 105–112. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jabbar, A.; Abbas, T.; Sandhu, Z.-D.; Saddiqi, H.A.; Qamar, M.F.; Gasser, R.B. Tick-borne diseases of bovines in Pakistan: Major scope for future research and improved control. Parasites Vectors 2015, 8, 283. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yasini, S.P.; Khaki, Z.; Rahbari, S.; Kazemi, B.; Amoli, J.S.; Gharabaghi, A.; Jalali, S.M. Hematologic and clinical aspects of experimental ovine anaplasmosis caused by Anaplasma ovis in Iran. Iran. J. Parasitol. 2012, 7, 91. [Google Scholar]
- Bevan, L.E.W. Anaplasmosis of sheep. Vet. J. 1912, 68, 400–401. [Google Scholar] [CrossRef] [Scilit]
- Li, H.; Zheng, Y.C.; Ma, L.; Jia, N.; Jiang, B.G.; Jiang, R.R.; Huo, Q.B.; Wang, Y.W.; Liu, H.B.; Chu, Y.L.; et al. Human infection with a novel tick-borne Anaplasma species in China: A surveillance study. Lancet Infect. Dis. 2015, 15, 663–670. [Google Scholar] [CrossRef] [Scilit]
- Atif, F.A. Alpha proteobacteria of genus Anaplasma (Rickettsiales: Anaplasmataceae): Epidemiology and characteristics of Anaplasma species related to veterinary and public health importance. Parasitology 2016, 143, 659–685. [Google Scholar] [CrossRef] [Scilit]
- Aouadi, A.; Leulmi, H.; Boucheikhchoukh, M.; Benakhla, A.; Raoult, D.; Parola, P. Molecular evidence of tick-borne hemoprotozoan-parasites (Theileria ovis and Babesia ovis) and bacteria in ticks and blood from small ruminants in Northern Algeria. Comp. Immunol. Microbiol. Infect. Dis. 2017, 50, 34–39. [Google Scholar] [CrossRef] [Scilit]
- Ruiz, H.; de Arcaute, M.R.; Benito, A.Á.; Villanueva-Saz, S.; Jiménez, J.C.; Lacasta, D. Long-lasting infection with Anaplasma ovis in sheep. Vet. Res. Commun. 2023, 1–5. [Google Scholar] [CrossRef] [Scilit]
- Niaz, S.; Ur Rahman, Z.; Ali, I.; Cossío-Bayúgar, R.; Amaro-Estrada, I.; Alanazi, A.D.; Khattak, I.; Zeb, J.; Nasreen, N.; Khan, A. Molecular prevalence, characterization and associated risk factors of Anaplasma spp. and Theileria spp. in small ruminants in Northern Pakistan. Parasite 2021, 28, 3. [Google Scholar] [CrossRef] [Scilit]
- Talat, R.; Khanum, T.; Hayat, A. Studies on mammalian haematozoan parasites of NWFP Pakistan. J. Biol. Sci. 2005, 8, 726–729. [Google Scholar]
- Ghaffar, A.; Ijaz, M.; Ali, A.; Farooqi, S.H.; Rehman, A.; Ali, M.M.; Zafar, M.Z.; Naeem, M.A. First report on molecular characterization of anaplasmosis in small ruminants in Pakistan. J. Parasitol. 2020, 106, 360–368. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Naeem, M.; Amaro-Estrada, I.; Taqadus, A.; Swelum, A.A.; Alqhtani, A.H.; Asif, M.; Sajid, M.; Khan, A.U.; Tariq, A.; Anjum, S.; et al. Molecular prevalence and associated risk factors of Anaplasma ovis in Pakistani sheep. Front. Vet. Sci. 2023, 10, 1096418. [Google Scholar] [CrossRef] [Scilit]
- Taqadus, A.; Chiou, C.C.; Amaro-Estrada, I.; Asif, M.; Nasreen, N.; Ahmad, G.; Iqbal, J.; Ali, M.; Khan, A.; Iqbal, F.; et al. Epidemiology and phylogeny of Anaplasma ovis with a note on hematological and biochemical changes in asymptomatic goats enrolled from four districts in Punjab, Pakistan. Vector-Borne Zoonotic Dis. 2023. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Khan, A.; Nasreen; Mitchell, R.D.; Niaz, S.; Ayaz, S.; Khattak, I.; Naeem, H.; de León, A.A.P.; Zaman, M.A. Seroprevalence of Anaplasma spp. among sheep and goats in Charsadda District, Pakistan. Small Rumin. Res. 2019, 176, 5–10. [Google Scholar] [CrossRef] [Scilit]
- Splitter, E.J.; Twiehaus, M.J.; Castro, E.R. Anaplasmosis in sheep in the United States. J. Am. Vet. Med. Assoc. 1955, 127, 244–245. [Google Scholar]
- Lacasta, D.; Lorenzo, M.; González, J.M.; Ruiz de Arcaute, M.; Benito, A.Á.; Baselga, C.; Milian, M.E.; Lorenzo, N.; Jiménez, C.; Villanueva-Saz, S.; et al. Epidemiological study related to the first outbreak of ovine anaplasmosis in Spain. Animals 2021, 11, 2036. [Google Scholar] [CrossRef] [Scilit]
- Primo, M.E.; Bellezze, J.; Morel, N.; Panizza, M.M.; Valentini, B.S.; Torioni, S.M.; Thompson, C.S. Development and field evaluation of a nested polymerase chain reaction-restriction fragment length polymorphism (nPCR-RFLP) analysis to identify A. marginale-infected and A. centrale-vaccinated cattle. Ticks Tick-Borne Dis. 2022, 13, 101952. [Google Scholar] [CrossRef] [Scilit]
- Ahmadi-Hamedani, M.; Ahmadi-Hamedani, M.; Fathi, E.; Sani, R.N. Comparison of selected biochemical parameters between naturally infected and non-infected goats with Anaplasma ovis. Comp. Clin. Pathol. 2014, 23, 989–992. [Google Scholar] [CrossRef] [Scilit]
- Kocan, K.M.; de la Fuente, J.; Cabezas-Cruz, A. The genus Anaplasma: New challenges after reclassification. Rev. Sci. Tech. 2015, 34, 577–586. [Google Scholar] [CrossRef] [Scilit]
- Selim, A.; Attia, K.A.; Alsubki, R.A.; Albohairy, F.; Kimiko, I.; Said, M.B. The first study on the seroprevalence of Anaplasma spp. in small ruminants and assessment of associated risk factors in North Egypt. Vet. World 2022, 15, 1221–1227. [Google Scholar] [CrossRef] [Scilit]
- Friedhoff, K.T. Tick-borne diseases of sheep and goats caused by Babesia, Theileria or Anaplasma spp. Parasitologia 1997, 39, 99–109. [Google Scholar]
- Stiller, D.; Crosbie, P.R.; Boyce, W.M.; Goff, W.L. Dermacentor hunteri (Acari: Ixodidae): An experimental vector of Anaplasma marginale and A. ovis (Rickettsiales: Anaplasmataceae) to calves and sheep. J. Med. Entomol. 1997, 36, 321–324. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- de la Fuente, J.; Atkinson, M.W.; Naranjo, V.; Fernández de Mera, I.G.; Mangold, A.J.; Keating, K.A.; Kocan, K.M. Sequence analysis of the msp4 gene of Anaplasma ovis strains. Vet. Microbiol. 2007, 119, 375–381. [Google Scholar] [CrossRef] [Scilit]
- Hornok, S.; Elek, V.; de la Fuente, J.; Naranjo, V.; Farkas, R.; Majoros, G.; Földvári, G. First serological and molecular evidence on the endemicity of Anaplasma ovis and A. marginale in Hungary. Vet. Microbiol. 2007, 122, 316–322. [Google Scholar] [CrossRef] [Scilit]
- Torina, A.; Alongi, A.; Naranjo, V.; Scimeca, S.; Nicosia, S.; Di Marco, V.; Caracappa, S.; Kocan, K.; De La Fuente, J. Characterization of anaplasma infections in Sicily, Italy. Ann. N. Y. Acad. Sci. 2008, 1149, 90–93. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aktas, M.; Altay, K.; Dumanli, N.; Kalkan, A. Molecular detection and identification of Ehrlichia and Anaplasma species in ixodid ticks. Parasitol. Res. 2009, 104, 1243–1248. [Google Scholar] [CrossRef] [Scilit]
- Hornok, S.; Micsutka, A.; de Mera, I.F.; Meli, M.L.; Gönczi, E.; Tánczos, B.; Mangold, A.J.; Farkas, R.; Lutz, H.; Hofmann-Lehmann, R.; et al. Fatal bovine anaplasmosis in a herd with new genotypes of Anaplasma marginale, Anaplasma ovis and concurrent haemoplasmosis. Res. Vet. Sci. 2012, 92, 30–35. [Google Scholar] [CrossRef] [Scilit]
- Belkahia, H.; Said, M.B.; Ghribi, R.; Selmi, R.; Asker, A.B.; Yahiaoui, M.; Bousrih, M.; Daaloul-Jedidi, M.; Messadi, L. Molecular detection, genotyping and phylogeny of Anaplasma spp. in Rhipicephalus ticks from Tunisia. Acta Trop. 2019, 191, 38–49. [Google Scholar] [CrossRef] [Scilit]
- Jabeen, F.; Mushtaq, M.; Qayyum, M.; Hasan, M.U.; Zafar, M.A.; Riaz, A.; Nasir, F. Tick taxonomy and nucleotide sequence analysis by internal transcribed spacer 2 (ITS 2) in large ruminants of Pothohar, Pakistan. Pak. Vet. J. 2022, 42, 554–560. [Google Scholar]
- Hosseini-Vasoukolaei, N.; Oshaghi, M.A.; Shayan, P.; Vatandoost, H.; Babamahmoudi, F.; Yaghoobi-Ershadi, M.R.; Telmadarraiy, Z.; Mohtarami, F. Anaplasma infection in ticks, livestock and human in Ghaemshahr, Mazandaran Province, Iran. J. Arthropod-Borne Dis. 2014, 8, 204–211. [Google Scholar] [PubMed]
- Yang, J.; Li, Y.; Liu, Z.; Liu, J.; Niu, Q.; Ren, Q.; Chen, Z.; Guan, G.; Luo, J.; Yin, H. Molecular detection and characterization of Anaplasma spp. in sheep and cattle from Xinjiang, northwest China. Parasites Vectors 2015, 8, 108. [Google Scholar] [CrossRef] [Scilit]
- Chochlakis, D.; Ioannou, I.; Tselentis, Y.; Psaroulaki, A. Human anaplasmosis and Anaplasma ovis variant. Emerg. Infect. Dis. 2010, 16, 1031. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xue, J.; Ren, Q.; Yang, X.L.; Wang, J.; Xie, G.; Du, L.; Guo, W.P. Human pathogens in ticks removed from humans in Hebei, China. Heliyon 2023, 9, e13859. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ben Said, M.B.; Attia, K.A.; Alsubki, R.A.; Mohamed, A.A.; Kimiko, I.; Selim, A. Molecular epidemiological survey, genetic characterization and phylogenetic analysis of Anaplasma ovis infecting sheep in Northern Egypt. Acta Trop. 2022, 229, 106370. [Google Scholar] [CrossRef] [Scilit]
- Ulucesme, M.C.; Ozubek, S.; Aktas, M. Molecular Prevalence and genetic diversity based on Msp1a Gene of Anaplasma ovis in goats from Türkiye. Life 2023, 13, 1101. [Google Scholar] [CrossRef] [Scilit]
- Weather Spark. 2023. Available online: https://weatherspark.com/y/106985/Average-Weather-in-Dera-Ghazi-Khan-Pakistan-Year-Round (accessed on 7 August 2023).
- Government of Punjab. Dera Ghazi Khan, Climate. 2023. Available online: https://dgkhandivision.punjab.gov.pk/division_climate#:~:text=The%20overall%20climate%20of%20the,F%20(4%C2%B0C) (accessed on 7 August 2023).
- Yousefi, A.; Rahbari, S.; Shayan, P.; Sadeghi-dehkordi, Z.; Bahonar, A. Molecular detection of Anaplasma marginale and Anaplasma ovis in sheep and goat in west highland pasture of Iran. Asian Pac. J. Trop. Biomed. 2017, 7, 455–459. [Google Scholar] [CrossRef] [Scilit]
- Tamura, K. Estimation of the number of nucleotide substitutions when there are strong transition-transversion and G+C-content biases. Mol. Biol. Evol. 1992, 9, 678–687. [Google Scholar]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis, Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [Scilit]
- Lew, A.E.; Gale, K.R.; Minchin, C.M.; Shkap, V.; de Waal, D.T. Phylogenetic analysis of the erythrocytic Anaplasma species based on 16S rDNA and GroEL (HSP60) sequences of A. marginale, A. centrale, and A. ovis and the specific detection of A. centrale vaccine strain. Vet. Microbiol. 2003, 92, 145–160. [Google Scholar] [CrossRef] [Scilit]
- Cabezas-Cruz, A.; Gallois, M.; Fontugne, M.; Allain, E.; Denoual, M.; Moutailler, S.; Devillers, E.; Zientara, S.; Memmi, M.; Chauvin, A.; et al. Epidemiology and genetic diversity of Anaplasma ovis in goats in Corsica, France. Parasite Vectors 2019, 12, 1–11. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ceylan, C.; Ekici, Ö.D. Molecular investigation of ovine and caprine anaplasmosis in south-eastern Anatolia region of Turkey. Pak. Vet. J. 2023, 43, 139–145. [Google Scholar]
- Djiba, M.L.; Mediannikov, O.; Mbengue, M.; Thiongane, Y.; Molez, J.-F.; Seck, M.T.; Fenollar, F.; Raoult, D.; Ndiaye, M. Survey of Anaplasmataceae bacteria in sheep from Senegal. Trop. Anim. Health Prod. 2013, 45, 1557–1561. [Google Scholar] [CrossRef] [Scilit]
- Derdáková, M.; Štefančíková, A.; Špitalská, E.; Tarageľová, V.; Košťálová, T.; Hrkľová, G.; Kybicová, K.; Schánilec, P.; Majláthová, V.; Várady, M.; et al. Emergence and genetic variability of Anaplasma species in small ruminants and ticks from Central Europe. Vet. Microbiol. 2011, 153, 293–298. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Prajapati, A.; Prajapati, B.; Patel, A.; Chauhan, P.; Das, B.; Raval, S.; Suthar, A.; Sutaria, T.; Chaudhari, R.K.; Patel, P.; et al. Molecular identification and genetic characterization of Theileria and Anaplasma infection in sheep and goat of North Gujarat, India. Parasitol. Res. 2023, 122, 1427–1433. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Enkhtaivan, B.; Narantsatsral, S.; Davaasuren, B.; Otgonsuren, D.; Amgalanbaatar, T.; Uuganbayar, E.; Zoljargal, M.; Myagmarsuren, P.; Suganuma, K.; Molefe, N.I.; et al. Molecular detection of Anaplasma ovis in small ruminants and ixodid ticks from Mongolia. Parasitol. Int. 2019, 69, 47–53. [Google Scholar] [CrossRef] [Scilit]
- Cabezas-Cruz, A.; Estrada-Peña, A.; de la Fuente, J. The good, the bad and the tick. Front. Cell Dev. Biol. 2019, 7, 79. [Google Scholar] [CrossRef] [Scilit]
- Abid, K.; Bukhari, S.; Asif, M.; Sattar, A.; Arshad, M.; Aktas, M.; Ozubek, S.; Shaikh, R.S.; Iqbal, F. Molecular detection and prevalence of Theileria ovis and Anaplasma marginale in sheep blood samples collected from Layyah district in Punjab, Pakistan. Trop. Anim. Health Prod. 2021, 53, 439. [Google Scholar] [CrossRef] [Scilit]
- Noaman, V.; Sazmand, A. Anaplasma ovis infection in sheep from Iran: Molecular prevalence, associated risk factors, and spatial clustering. Trop. Animal Health Prod. 2021, 54, 6. [Google Scholar] [CrossRef] [Scilit]
- Eisawi, N.M.; El Hussein, A.R.M.; Hassan, D.A.; Musa, A.B.; Hussien, M.O.; Enan, K.A.; Bakheit, M.A. A molecular prevalence survey on Anaplasma infection among domestic ruminants in Khartoum State, Sudan. Trop. Anim. Health Prod. 2020, 52, 1845–1852. [Google Scholar] [CrossRef] [Scilit]
- Atif, F.A.; Abbas, R.Z.; Mehnaz, S.; Qamar, M.F.; Hussain, K.; Nazir, M.U.; Zaman, M.A.; Khan, A.U.; Said, M.B. First report on molecular surveillance based on duplex detection of Anaplasma marginale and Theileria annulata in dairy cattle from Punjab, Pakistan. Trop. Anim. Health Prod. 2022, 54, 155. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ashraf, S.; Parveen, A.; Muhammad Awais, M.; Gillani, Q.; Aktas, M.; Ozubek, S.; Iqbal, F. A report on molecular detection and phylogenetic evaluation of Anaplasma marginale in ticks and blood samples collected from cattle in district Layyah in Punjab (Pakistan). Curr. Microbiol. 2021, 78, 274–281. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rahman, M.; Faruque, M.R.; Rahman, M.M.; Chowdhury, M.Y.E. Epidemiology and molecular detection of Anaplasma spp. in goats from Chattogram district, Bangladesh. Vet. Med. Sci. 2022, 8, 1240–1249. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).


