Next Article in Journal
Listeria monocytogenes in Irrigation Water: An Assessment of Outbreaks, Sources, Prevalence, and Persistence
Next Article in Special Issue
The MinCDE Cell Division System Participates in the Regulation of Type III Secretion System (T3SS) Genes, Bacterial Virulence, and Motility in Xanthomonas oryzae pv. oryzae
Previous Article in Journal
Lomentospora prolificans: An Emerging Opportunistic Fungal Pathogen
Previous Article in Special Issue
Unraveling Plant Cell Death during Phytophthora Infection
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Control of Maize Sheath Blight and Elicit Induced Systemic Resistance Using Paenibacillus polymyxa Strain SF05

Institute of Maize and Featured Upland Crops, Zhejiang Academy of Agricultural Sciences, Dongyang 322100, China
*
Author to whom correspondence should be addressed.
Microorganisms 2022, 10(7), 1318; https://doi.org/10.3390/microorganisms10071318
Submission received: 6 June 2022 / Revised: 24 June 2022 / Accepted: 28 June 2022 / Published: 29 June 2022
(This article belongs to the Special Issue Advances in Plant-Microbe Interactions)

Abstract

:
Maize (Zea mays L.) is an important crop in the world and maize sheath blight damages the yield and quality greatly. In this study, an antagonist strain, which exhibited antagonism against pathogenic fungi of maize and controlled maize banded leaf sheath blight in the field, was effectively isolated and named Paenibacillus polymyxa strain SF05. High cellulase and chitinase activity of the strain were detected in this study, which might contribute to degrading the cell wall of fungi. Furthermore, different resistant genes such as ZmPR1a, OPR1 and OPR7 were elicited differently by the strain in the leaves and stems of maize. In order to explain the biocontrol mechanism of P. polymyxa strain SF05, the genome was sequenced and then the genes involving the biocontrol mechanism including biofilm formation pathways genes, cell wall degradation enzymes, secondary metabolite biosynthesis gene clusters and volatile organic compounds biosynthesis genes were predicted. The study revealed the biocontrol mechanism of P. polymyxa strain SF05 preliminary and laid a foundation for further research of biocontrol mechanism of P. polymyxa.

1. Introduction

Mazie (Zae mays L.) is an important crop in the world. According to FAOSTAT (https://www.fao.org/faostat/en/#home accessed on 17 February 2022), more than 197 million ha of maize were planted all over the world in 2019 and the production reached 1.15 billion tons. The pathogens, including Bipolaris maydis, Exserohilum turcicum, Rhizoctonia solani, Fusurium verticillioides, etc., caused great losses of maize in production and quality, and the infected maize even affects human health [1]. Chemical control is the most commonly used method to control maize fungal diseases. Fludioxonil, triazoles, azoxystrobin, etc., are usually used for controlling the diseases caused by the pathogens mentioned above in maize [2,3,4,5]. However, Maize sheath blight caused by R. solani is a common disease in maize and it always breaks out in summer and autumn when the maize is nearly ripe [4]. However, maize, especially fresh maize such as waxy and sweet maize, is an important food for human. Meanwhile, the abusive application of chemical pesticides results in problems such as environment pollution [6]. Therefore, chemical pesticides are not suitable to be used too much when maize sheath blight breaks out. In order to control maize sheath blight safely, the demand for safe and clean biological pesticides in production is quite urgent.
Paenibacillus polymyxa is usually reported as plant growth-promoting rhizobacteria (PGPR), which could enhance plant productivity and often elicit plant immunity against multiple plant pathogens [7,8,9]. In previous research, P. polymyxa was reported as a safe antagonist for crops and could colonize in the host to fix nitrogen [10,11,12], which was beneficial for plant growth. Antibiotic compounds (polymyxins, fusaricidins, etc.) and hydrolytic enzymes (xylanases, cellulases, pectinases, etc.) secreted by P. polymyxa could inhibit the reproduction of pathogens [13]. Furthermore, the expression levels of resistant genes or defense enzymes of plants treated by the bacterium were upregulated, suggesting P. polymyxa induced systemic resistance of the host plant [14,15]. However, the molecular mechanism of systemic resistance induced by P. polymyxa was still unclear.
The aim of the study is to isolate an antagonistic bacteria strain to control maize sheath blight and determine the biocontrol mechanism of it especially in systemic resistance inducement. In this study, a strain of P. polymyxa was isolated from maize and exhibited strong activities to inhibit some pathogenic fungi. Furthermore, different resistant genes were elicited differently by the strain in the leaves and stems of maize. In order to explain the mechanism of induced systemic resistance, the genome of P. polymyxa strain SF05 was sequenced and then the genes involving resistance inducing component biosynthesis were predicted.

2. Materials and Methods

2.1. Isolation of Antagonistic Bacteria from Maize

The symptomatic sheath tissue was cut into the size of 3 × 3 mm and sterilized with 70% ethanol. The sterilized tissue was placed on the center of potato sucrose agar (PSA) plates at the temperature of 28 °C for two days. Some of the plates showed a zone of inhibition without hyphae, and the bacteria in the center of the zone of inhibition were streaked onto lysogeny broth (LB) agar plants for purification of three generation. To determine the antimicrobial ability of the bacteria, the dish of Rhizoctonia solani with a diameter of 5 mm was placed on the center of PSA plate and then 10 μL of bacterial suspension (≈1 × 108 CFU/mL) was dropped on the plate 2 cm away from the dish. The bacterial strain of which the inhibition zone was biggest was selected to continuous culture. Strains that maintained better antibacterial activity after five generations of continuous culture were identified by molecular and biological characteristics.

2.2. Identification of Antagonistic Bacteria SF05

Antagonistic bacteria SF05 was isolated from the sheath of maize and exhibited steady and strong antimicrobial activity. The genome DNA of antagonistic bacteria SF05 was extracted by TIANamp Bacteria DNA Kit (DP302-02, TIANGEN, Beijing, China) and 16s rDNA was amplified with the primers: 5′-AGAGTTTGATCATGGCTCAG-3′ (16sF) and 5′-TAGGGTTACCTTGTTACGACTT-3′ (16sR) [16]. The PCR products were sequenced by Tsingke Biotechnology Co., Ltd. and the sequences were aligned on NCBI with the BLASTN program. The phylogenetic tree of 16S rDNA sequences of SF05 and kindred strains were constructed by MEGA 7.0 with the method of neighbor joining setting the bootstrap as 1000.
The biological characteristics of SF05 were processed by API 20 E: Identification system for Enterobacteriaceae and other non-fastidious Gram-negative rods and BIOLOG system.

2.3. Antimicrobial Activity of Antagonistic Bacteria Strain SF05 to Pathogenic Fungi

To determine the antimicrobial ability of the bacteria, the dish of pathogen fungi with a diameter of 5 mm was placed onto the center of a PSA plate and then 10 μL of bacterial suspension (≈1 × 108 CFU/mL) was dropped onto the plate 2 cm away from the dish. Sterile water was used as negative control (NT). All plates were incubated in 28 °C until the colony of NT was just full of the plates. Pathogenic fungi used in this study are listed in Table 1. The inhibition rate was calculated as: Inhibition rate (%) = (diameter of NT fungi colony − diameter of treated fungi colony)/(diameter of NT fungi colony − diameter of fungi dish) × 100.

2.4. Control Effect of P. polymyxa Strain SF05 on Banded Leaf and Sheath Blight in Field

The third sheath of maize (cv. Zhetian 19) at the booting stage (V10) was inoculated by sorghum grains that had been affected by R. solani. The bacterial suspension (≈1 × 108 CFU/mL) and sterile water were mixed in the ratio of 1:1 and sprayed on the inoculated sheath of maize at the tassel stage (VT). Armistar Top (Syngenta) diluent (effective constituent: 0.2 g/L) was used as positive control and sterile water and blank LB liquid medium as NT. The disease index of maize banded leaf and sheath blight before treatment and at the milk stage (R4) was investigated by the method described in the Technical Specification on Evaluation of Maize Resistance to Pests—Part 9: Banded Leaf and Sheath Blight. Control effect was calculated as: Control effect (%) = ((disease index of NT − disease index of treated fungi colony)/ disease index of NT) × 100.

2.5. Detection of Expression Levels of Resistant Gene Induced by P. polymyxa Strain SF05 in Maize Seedling

Maize seedlings (cv. Zhetian 19) at the V3 stage were sprayed by bacterial suspension (≈1 × 108 CFU/mL) until droplets covered the surfaces of the leaves and stems and incubation was carried out with HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) (R312-01, Vazyme, Nanjing, China). The expression of resistant genes was analyzed using the primers list in Table 2 [17,18,19]. The concentration of cDNA was adjusted to 100 ng/μL. qRT-PCR was conducted using ABI QuantStudio 7 (Thermo Fisher, Waltham, MA, USA). The reaction mixture (5 μL) contained 2.5 μL of 2 × ChamQ Universal SYBR qPCR Master Mix, 0.1 μL of forward primer, 0.1 μL of reverse primers, 1 μL of cDNA and 1.3 μL of ddH2O. The thermocycle parameters were as follows: initial polymerase activation for 30 seconds (s) at 95 °C, and then 40 cycles of 30 at 95 °C, 60 s at 58 °C, and 30 s at 72 °C. Relative expression levels were calibrated and normalized to the level of Actin. inoculated seedlings in 28 °C greenhouses. Blank LB liquid medium was used as control. Twenty-four hours after inoculation, the total RNA of leaves, stems and roots was extracted by TIANGEN RNAprep Pure Plant Kit (DP432) and then first-strand cDNA synthesis.

2.6. Cell Wall Degradation Enzyme Activities of P. polymyxa Strain SF05

Chitinase, pectinase and cellulase were considered as main cell wall degradation enzymes in this study. The activities of cellulase and pectinase were determined according to the methods described by Chen et al. [20]. Chitinase Activity Detection Kit (BC0825, Solarbio, Beijing, China) was used to determine the chitinase activity of P. polymyxa strain SF05. Another antagonistic bacterial strain Bacillus subtilis BS0512 (Laboratory Collection) and a pathogenic bacterial strain Dickeya zeae NCPPB 3531 (Nanjing Agricultural University) were also determined as control.

2.7. Genome Sequencing of P. polymyxa Strain SF05

Genomic DNA was extracted with the SDS method [21]. The harvested DNA was detected by the agarose gel electrophoresis and quantified by Qubit® 2.0 (Invitrogen, Thermo Fisher Scientific, Hillsboro, OR, USA). The whole genome of P. polymyxa strain SF05 was sequenced using the Nanopore PromethION platform and Illumina NovaSeq PE150 at the Beijing Novogene Bioinformatics Technology Co., Ltd. (Beijing, China). Unicycler was used to combine PE150 data and Nanopore data which were used to assemble then compare the readings to the assembled sequence, count the distribution of sequencing depth, and distinguish whether the assembled sequence was a chromosomal sequence or a plasmid sequence according to sequence length and alignment, and check whether it was a circular genome. The genes of the genome were predicted by the Pan-genome analysis pipeline (PAGP) [22].

2.8. Prediction of Genes Involving Resistance Inducing Component Biosynthesis of P. polymyxa Strain SF05

Nine P. polymyxa genomes (ZF129, CF05, YC0573, Sb3-1, HY96-2, CJX518, JE201, EBL06 and E681) were used in this study to compare with SF05. dbCAN2 meta server (https://bcb.unl.edu/dbCAN2/, accessed on 3 October 2021) was used for the annotation of CWDEs and signal peptide (SP) in P. polymyxa genome. Proteins that were both positive in CWDE and SP were considered as the enzymes that could be secreted outside of the cell. The genes involving biofilm formation of selected P. polymyxa genomes were predicted by the database of KEGG. Secondary metabolite biosynthetic gene clusters in P. polymyxa were analyzed by antiSMASH (https://antismash.secondarymetabolites.org/, accessed on 7 June 2021). According to the method described in Shi [23] and Lee [24], genes involving VOCs biosynthesis were predicted by aligning the protein sequences of SF05 to the database of reported genes from KEGG by the program BLASTP.

2.9. Statistical Analysis

Analysis of variance of experimental data was performed using SPSS Statistics 25 (IBM, Armonk, NY, USA). Significant treatment effects were determined based on the magnitude of the F value (p = 0.05). All tests were conducted in triplicate.

3. Results

3.1. Isolate and Identification of Antagonist Bacterium Strain SF05

After continuous culture for purification, a strain with steady and strong antimicrobial activity was isolated and named SF05 (CCTCC NO: M2020384). The sequence of 16S rDNA was amplified by the primers of 16sF/R and was uploaded to the National Center for Biotechnology Information (NCBI, https://www.ncbi.nlm.nih.gov/, accessed on 3 October 2021) (GenBank: MT820612.1). The alignment results showed that the identities of 16S rDNA and P. polymyxa reached 99%, and strain SF05 was in one branch in the phylogenetic tree based on the sequences of 16S rDNA of the Paenibacillus genus (Figure 1). The results suggested that antagonist bacterium strain SF05 belonged to Paenibacillus genus and might be P. polymyxa.
Biological characteristics of SF05 determined by SPI 20 E showed that P. polymyxa strain SF05 was positive in β-Galactosidase and gelatinase activities but negative in urease activity (Table S1). The strain could uptake glycerol, ribose, D-xylose, galactose, mannose, glucose, fructose, etc., to produce acid (Table S2). Identification by the BIOLOG system showed that SF05 could assimilate dextrin, D-maltose, D-trehalose, D-cellobiose, gentian disaccharide, sucrose, D-turanose, stachyose, etc., for growth (Table S3). Meanwhile, P. polymyxa strain SF05 was observed to grow in the environment of pH = 6 but not in 8% NaCl. Finally, the strain was identified as P. polymyxa according to its physiological and biochemical characteristics by Handbook of Systematic for Common Bacteria [25].

3.2. Antimicrobial Activity of P. polymyxa Strain SF05 to Pathogenic Fungi

Two to seven days after incubation, P. polymyxa strain SF05 exhibited strong antimicrobial activity to most pathogenic fungi tested in this study (Figure 2). The inhibition rates of fungi ranged from 57.06% to 80%. P. polymyxa strain SF05 could inhibit some important pathogenic fungi including P. oryzae, S. sclertiorum, F. graminearum, R. solani, E. turcicum, B. maydis, F. verticillioides, C. lunata which caused great losses in the production of rice, maize, rape and wheat.

3.3. Control Effect of P. polymyxa Strain SF05 on Banded Leaf and Sheath Blight in Field

No symptoms of banded leaf and sheath blight were observed in the field before being treated (data not shown). Thirty-one days later, the disease index of biological and chemical treatment to banded leaf and sheath blight in the field was significantly decreased compared to NT. The control effect of biological control was slightly lower than that of chemical treatment (Table 3).

3.4. Expression Levels of Resistant Gene Induced by P. polymyxa Strain SF05 in Maize Seedling Differed in Stem and Leaf

OPR1 was downregulated by nearly 92% in root, while the expression levels of most detected genes just changed a little. ZmPR1a was upregulated in stem treated by P. polymyxa strain SF05 by 4.72-fold and the other genes remained near levels of those in the root. On the contrary, the expression level of ZmPR1a did not exhibit an obvious variation in treated leaves to the control but other genes were upregulated by 2.55–4.59-fold (Figure 3).

3.5. Cell Wall Degradation Enzyme Activities of P. polymyxa Strain SF05

The radius of halo degraded by P. polymyxa strain SF05 in cellulase activity assay plates was significantly bigger than that by B. subtilis BS0512 (Figure 4), which was another antagonist strain. Moreover, the strain did not exhibit any pectinase activity in assay plants. The chitinase activities of three strains tested in this study were sorted from high to low as D. zeae NCPPB 3531, P. polymyxa strain SF05 and B. subtilis BS0512 (Figure 5).

3.6. Genome Information of P. polymyxa Strain SF05

The total length of the P. polymyxa strain SF05 genome (Accession: CP071875) was 5.46 M with a GC content of 45.5%. No plasmid was found in this genome. A total of 4615 proteins, 43 rRNA and 108 tRNA were annotated in the genome of SF05. Here, nine P. polymyxa genomes including the representative genome, ZF129, were selected to compare with the genome of SF05. It was not difficult to find that the genome size and protein numbers of SF05 were less than most genomes (Table 4), suggesting the characteristics might be varied.

3.7. Annotation Information of Biocontrol Mechanism of P. polymyxa Strain SF05

To explore the biocontrol mechanism of P. polymyxa strain SF05, biofilm formation pathways genes, cell wall degradation enzymes (CWDEs), secondary metabolite biosynthesis gene clusters and volatile organic compounds (VOCs) biosynthesis genes were predicted and compared with nine other P. polymyxa genomes including a representative genome of ZF129. Biofilm formation pathways genes were found in all genomes, suggesting SF05 could form biofilm in maize. In addition, 10 genes were predicted in the pathways of Biofilm formation—Pseudomonas aeruginosa in the genome of SF05, which was more than other compared genomes (Table S4). Cellulases, chitinases and peptidoglycan hydrolases were also annotated in 10 genomes of P. polymyxa (Table S5) by the CAZy database and 17 related genes were found in the genome of SF05. Secondary metabolite biosynthesis gene clusters in P. polymyxa genomes were predicted by antiSMASH (Table S6) and 16 clusters were found in the genome of SF05, in which the Bacitracin biosynthesis gene cluster was only found. Similar to CWDEs, VOCs including 2,3-butanediol biosynthesis genes ranging from 14 to 16 were found in 10 P. polymyxa genomes (Table 5). Annotation information revealed that the biocontrol mechanism of P. polymyxa strain SF05 was similar to other strains but there were also some differences.

4. Discussion

In this study, P. polymyxa strain SF05 was isolated and identified which exhibited significant antagonism to some important pathogenic fungi. Moreover, for the first time, it was reported that the P. polymyxa strain primed different plant defense genes in different tissues. The genome of the bacterium was sequenced and the expression levels of VOCs biosynthesis genes were analyzed in the cDNA of maize-SF05 interaction to explain the mechanism of biological control.
Similar with some Bacillus and Paenibacillus strains, P. polymyxa exhibited a strong ability to inhibit the growth of pathogens, which could be used to control some plant disease. It was also reported that B. velezensis CE100, B. amyloliquefaciens F9 and B. velezensis VB7 could be used against F. oxysporum effectively [26,27,28]. Likely, P. polymyxa strain SF05 could also inhibit the growth of the fungi, suggesting the strain might also help to control the disease caused by F. oxysporum in strawberry and banana. In addition, B. amyloliquefaciens F9 was also found to be able to control citrus canker caused by Xanthomonas citri subsp. citri [28]. Therefore, it might be a new insight for P. polymyxa strain SF05 to control the bacterial diseases. Different from traditional pre-harvest control, some antagonistic bacteria such as B. amyloliquefaciens HF-01 and P. polymyxa strain SG-6 were used to control postharvest diseases [29,30], suggesting P. polymyxa strain SF05 could be used to control the saprophytic fungi in harvest fruits and crops.
As was reported, P. polymyxa was a PGPR that could colonize plants and inhibit some pathogens. The bacterium was observed colonizing A. thaliana and then antagonizing Pseudomonas syringae [31], Phytophthora palmivora and Pythium aphanidermatum [32]. P. polymyxa was also isolated from soil around peanut roots and it controlled crown rot disease [33]. Son et al. reported that P. polymyxa suppressed the disease complex caused by root-knot nematode and fusarium wilt fungus [9]. It was observed that P. polymyxa infected the roots of plants and formed biofilm in intercellular space. Five days after inoculation to roots, more P. polymyxa cells were colonized in the leaves of A. thaliana rather than in roots, indicating the bacterium could be transferred in the plant [31]. The antagonistic components secreted by P. polymyxa were mainly polysaccharides, peptides and proteins, which exhibited superior water solubility, heat resistance and acid-base stability and were easy in store and use [34,35]. The strain isolated and identified in this study exhibited significant antagonism to some important pathogenic fungi, while controlling banded leaf and sheath blight in field effectively, indicating P. polymyxa strain SF05 could secret some components to inhibit the fungi and increase the resistance of maize.
Elicitation of ISR is an important part of biological control mechanism of P. polymyxa. The phenomenon that the response of A. thaliana treated by the bacterium to biotic and abiotic stress increased was firstly reported by Timmusk and Wagner [14]. In addition, gene expression analysis indicated the elicitation of ISR might be related to drought stress caused by P. polymyxa. Activities of defense enzymes and content of salicylic acid (SA) in tomato leaves treated by P. polymyxa were higher than those in control [15]. Lee et al. and Shi et al. proved that some components secreted by P. polymyxa could elicit ISR [23,24]. In this study, P. polymyxa strain SF05 induced the expressions of defense genes, which was the same as reported previously. In particular, upregulation of ZmPR1a in stem might enhance the resistance to banded leaf and sheath blight in maize [36].
Genomic information partly explained the mechanism of antimicrobial activity to pathogen fungi. Biofilms are formed by bacteria that attach to surfaces aggregating in a hydrated polymeric matrix of their own synthesis [37], which could contribute to P. polymyxa colonizing the rhizosphere of Arabidopsis thaliana, peanut, tomato, cucumber, wheat and maize [33,38,39]. Since the cell wall of fungi and bacterium are mainly composed of cellulose, chitin and peptidoglycan, degradation of the cell wall could inhibit the growth of the pathogen. In addition, secondary metabolite secreted by bacterium usually exhibit antimicrobial activities [40]. Cellulases, chitinases, peptidoglycan hydrolases and secondary metabolite biosynthesis gene clusters were found in the genome, suggesting the bacteria secreted some CWDEs and secondary metabolites that could inhibit the growth of pathogens.
However, P. polymyxa strain SF05 primed different plant defense genes in different tissues of maize, which was not reported in previous literature. In order to explain the mechanism preliminarily, the genome of P. polymyxa strain SF05 was sequenced. The related annotation information revealed some genes that might be involved in the inducement of resistance. Some VOCs produced by P. polymyxa were reported as being able to induce ISR in the host plant [23]. The genes involved in the biosynthesis of the reported VOCs were also found in the genome, suggesting P. polymyxa strain SF05 could prime the defense genes by producing VOCs.

5. Conclusions

P. polymyxa strain SF05 is a potential biological fungicide that could prevent some important diseases while being safe for plants. It was found for the first time that P. Polymyxa strain SF05 elicited different resistant genes in leaves and stems of maize. The biocontrol mechanism of P. polymyxa strain SF05 might include: (i) inhibiting the growth of pathogens by secreting CWDEs and secondary metabolites; (ii) producing VOCs to induce the defense response of maize. The study laid a foundation for research on the function of VOCs biosynthesis genes and the roles they play in the network of defense gene expression regulation in interaction of maize-SF05.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/microorganisms10071318/s1, Table S1: Physiological and biochemical characteristics (enzyme activities, carbon source oxidation) of P. polymyxa strain SF05; Table S2: Physiological and biochemical characteristics (acid production from carbon source) of P. polymyxa strain SF05; Table S3: Physiological and biochemical characteristics (BIOLOG carbon assimilation) of P. polymyxa strain SF05; Table S4: Prediction of biofilm formation pathways genes in P. polymyxa genomes; Table S5: Prediction of cell wall degradation enzyme genes in P. polymyxa genomes; Table S6: Prediction of secondary metabolite biosynthesis gene cluster in P. polymyxa genomes.

Author Contributions

Conceptualization, B.C.; methodology, G.W.; formal analysis, H.H. and H.T.; investigation, J.H. and X.L.; writing—original draft preparation, B.C. and J.H.; writing—review and editing, B.C. and F.Z.; visualization, F.B. All authors have read and agreed to the published version of the manuscript.

Funding

The research was supported by Zhejiang Provincial Key Research & Development Plan of China (2020C02001), Major Agriculture Science Foundation of Upland Grain Crops Breeding of Zhejiang Province (2021C02064-4) and China Agriculture Research System of MOF and MARA.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All relevant data are presented in the article. Raw data can be provided on reasonable request.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Egal, S.; Hounsa, A.; Gong, Y.Y.; Turner, P.C.; Wild, C.P.; Hall, A.J.; Hell, K.; Cardwell, K.F. Dietary exposure to aflatoxin from maize and groundnut in young children from Benin and Togo, West Africa. Int. J. Food Microbiol. 2005, 104, 215–224. [Google Scholar] [CrossRef]
  2. Han, X.; Zhao, H.; Ren, W.; Lv, C.; Chen, C. Resistance risk assessment for fludioxonil in Bipolaris maydis. Pestic. Biochem. Physiol. 2017, 139, 32–39. [Google Scholar] [CrossRef] [PubMed]
  3. Da Costa, D.I.; Boller, W. Aerial and ground applications of fungicide for the control of leaf diseases in maize crop (Zea mays L.). In Proceedings of the CIGR–International Conference of Agricultural Engineering, Foz do Iguaçu, Brazil, 31 August–4 September 2008. [Google Scholar]
  4. Wang, G.; Han, H.; Zhao, F.; Tan, H.; Bao, F.; Lou, X. Occurrence and control of sheath blight of sweet and waxy corn in Zhejiang Province. China Plant Prot. 2016, 36, 32–36. [Google Scholar]
  5. Liu, H. Pathogen Identification, Pathogenic Factors and Control of Spring Maize Ear Rot disease in The Northern Region. Master s Thesis, Northeast Agricultural University, Harbin, China, 2018. [Google Scholar]
  6. Carvalho, F.P. Pesticides, environment, and food safety. Food Energy Secur. 2017, 6, 48–60. [Google Scholar] [CrossRef]
  7. Ryu, C.-M.; Murphy, J.F.; Mysore, K.S.; Kloepper, J.W. Plant growth-promoting rhizobacteria systemically protect Arabidopsis thaliana against Cucumber mosaic virus by a salicylic acid and NPR1-independent and jasmonic acid-dependent signaling pathway. Plant J. 2004, 39, 381–392. [Google Scholar] [CrossRef] [PubMed]
  8. Ryu, C.-M.; Kim, J.; Choi, O.; Kim, S.H.; Park, C.S. Improvement of biological control capacity of Paenibacillus polymyxa E681 by seed pelleting on sesame. Biol. Control 2006, 39, 282–289. [Google Scholar] [CrossRef]
  9. Son, S.H.; Khan, Z.; Kim, S.G.; Kim, Y.H. Plant growth-promoting rhizobacteria, Paenibacillus polymyxa and Paenibacillus lentimorbus suppress disease complex caused by root-knot nematode and fusarium wilt fungus. J. Appl. Microbiol. 2009, 107, 524–532. [Google Scholar] [CrossRef]
  10. Heulin, T.; Berge, O.; Mavingui, P.; Gouzoux, L.; Hebbar, P.; Balandreau, J. Bacillus polymyxa and Rahnella aquatilis, the dominant N2-fixing bacteria associated with wheat roots in French soils. Eur. J. Soil Biol. 1994, 30, 35–42. [Google Scholar]
  11. Choi, S.K.; Park, S.Y.; Kim, R.; Lee, C.H.; Kim, J.F.; Park, S.H. Identification and functional analysis of the fusaricidin biosynthetic gene of Paenibacillus polymyxa E681. Biochem. Biophys. Res. Commun. 2008, 365, 89–95. [Google Scholar] [CrossRef]
  12. Abdallah, Y.; Yang, M.; Zhang, M.; Masum, M.M.I.; Ogunyemi, S.O.; Hossain, A.; An, Q.; Yan, C.; Li, B. Plant growth promotion and suppression of bacterial leaf blight in rice by Paenibacillus polymyxa Sx3. Lett. Appl. Microbiol. 2019, 68, 423–429. [Google Scholar] [CrossRef]
  13. Raza, W.; Yang, W.; Shen, Q. Paenibacillus polymyxa: Antibiotics, hydrolytic enzymes and hazard assessment. J. Plant. Pathol. 2008, 90, 419–430. [Google Scholar]
  14. Timmusk, S.; Wagner, E.G. The plant-growth-promoting rhizobacterium Paenibacillus polymyxa induces changes in Arabidopsis thaliana gene expression: A possible connection between biotic and abiotic stress responses. Mol. Plant Microbe Interact. 1999, 12, 951–959. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  15. Tong, Y.; Guo, G.; Xu, J.; Ji, Z.; Chen, X. Mechanisms of resistance to gray mould in tomato plant induced by antagonistic bacteria. Acta Phytopathol. Sin. 2004, 34, 507–511. [Google Scholar]
  16. Polz, M.F.; Cavanaugh, C.M. Bias in template-to-product ratios in multitemplate PCR. Appl. Environ. Microbiol. 1998, 64, 3724–3730. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  17. Cao, N. Transcriptomic Analysis of the Functions of BR, JA, and SA Involved in Maize Chlorotic Mottle Virus Infection; Chinese Academy of Agricultural Sciences: Beijing, China, 2019. [Google Scholar]
  18. Fan, L.; Fu, K.; Yu, C.; Li, Y.; Li, Y.; Chen, J. Thc6 protein, isolated from Trichoderma harzianum, can induce maize defense response against Curvularia Lunata. J. Basic Microbiol. 2015, 55, 591–600. [Google Scholar] [CrossRef]
  19. Wang, S.-q.; Ma, J.; Wang, M.; Wang, X.-h.; Li, Y.-Q.; Chen, J. Combined application of Trichoderma harzianum SH2303 and difenoconazole-propiconazolein controlling Southern corn leaf blight disease caused by Cochliobolus heterostrophus in maize. J. Integr. Agric. 2019, 18, 2063–2071. [Google Scholar] [CrossRef]
  20. Chen, B.; Tian, Y.; Zhao, Y.; Wang, J.; Xu, Z.; Li, X.; Hu, B. Bleeding canker of pears caused by Dickeya fangzhongdai: Symptoms, etiology and biology. J. Integr. Agric. 2020, 19, 889–897. [Google Scholar] [CrossRef]
  21. Goldenberger, D.; Perschil, I.; Ritzler, M.; Altwegg, M. A Simple Universal DNA Extraction Procedure Using Sds and Proteinase-K Is Compatible with Direct Pcr Amplification. Pcr. Meth. Appl. 1995, 4, 368–370. [Google Scholar] [CrossRef] [Green Version]
  22. Zhao, Y.; Wu, J.; Yang, J.; Sun, S.; Xiao, J.; Yu, J. PGAP: Pan-genomes analysis pipeline. Bioinformatics 2012, 28, 416–418. [Google Scholar] [CrossRef] [Green Version]
  23. Shi, Y.; Niu, K.; Huang, B.; Liu, W.; Ma, H. Transcriptional Responses of Creeping Bentgrass to 2,3-Butanediol, a Bacterial Volatile Compound (BVC) Analogue. Molecules 2017, 22, 1318. [Google Scholar] [CrossRef] [Green Version]
  24. Lee, B.; Farag, M.A.; Park, H.B.; Kloepper, J.W.; Lee, S.H.; Ryu, C.M. Induced resistance by a long-chain bacterial volatile: Elicitation of plant systemic defense by a C13 volatile produced by Paenibacillus polymyxa. PLoS ONE 2012, 7, e48744. [Google Scholar] [CrossRef] [PubMed]
  25. Dong, X.; Cai, M. Handbook of Systematic for Common Bacteria; Science Press: Beijing, China, 2001. [Google Scholar]
  26. Saravanan, R.; Nakkeeran, S.; Saranya, N.; Senthilraja, C.; Renukadevi, P.; Krishnamoorthy, A.S.; El Enshasy, H.A.; El-Adawi, H.; Malathi, V.G.; Salmen, S.H.; et al. Mining the Genome of Bacillus velezensis VB7 (CP047587) for MAMP Genes and Non-Ribosomal Peptide Synthetase Gene Clusters Conferring Antiviral and Antifungal Activity. Microorganisms 2021, 9, 2511. [Google Scholar]
  27. Hong, S.R.; Kim, T.Y.; Won, S.J.; Moon, J.H.; Ajuna, H.B.; Kim, K.Y.; Ahn, Y.S. Control of Fungal Diseases and Fruit Yield Improvement of Strawberry Using Bacillus velezensis CE 100. Microorganisms 2022, 10, 365. [Google Scholar] [CrossRef] [PubMed]
  28. Wang, X.; Liang, L.; Shao, H.; Ye, X.; Yang, X.; Chen, X.; Shi, Y.; Zhang, L.; Xu, L.; Wang, J. Isolation of the Novel Strain Bacillus amyloliquefaciens F9 and Identification of Lipopeptide Extract Components Responsible for Activity against Xanthomonas citri subsp. citri. Plants 2022, 11, 457. [Google Scholar] [CrossRef] [PubMed]
  29. Hong, P.; Hao, W.N.; Luo, J.J.; Chen, S.H.; Hu, M.Y.; Zhong, G.H. Combination of hot water, Bacillus amyloliquefaciens HF-01 and sodium bicarbonate treatments to control postharvest decay of mandarin fruit. Postharvest Biol. Technol. 2014, 88, 96–102. [Google Scholar] [CrossRef]
  30. Lai, K.P.; Chen, S.H.; Hu, M.Y.; Hu, Q.B.; Geng, P.; Weng, Q.F.; Jia, J.W. Control of postharvest green mold of citrus fruit by application of endophytic Paenibacillus polymyxa strain SG-6. Postharvest Biol. Technol. 2012, 69, 40–48. [Google Scholar] [CrossRef]
  31. Hong, C.E.; Kwon, S.Y.; Park, J.M. Biocontrol activity of Paenibacillus polymyxa AC-1 against Pseudomonas syringae and its interaction with Arabidopsis thaliana. Microbiol. Res. 2016, 185, 13–21. [Google Scholar] [CrossRef]
  32. Timmusk, S. Biofilm forming Paenibacillus polymyxa antagonizes oomycete plant pathogens Phytophthora palmivora and Pythium aphanidermatum. J. Biotechnol. 2008, 136, S265–S266. [Google Scholar] [CrossRef]
  33. Haggag, W.M.; Timmusk, S. Colonization of peanut roots by biofilm-forming Paenibacillus polymyxa initiates biocontrol against crown rot disease. J. Appl. Microbiol. 2008, 104, 961–969. [Google Scholar] [CrossRef]
  34. McAuliffe, O.; Ross, R.P.; Hill, C. Lantibiotics: Structure, biosynthesis and mode of action. FEMS Microbiol. Rev. 2001, 25, 285–308. [Google Scholar] [CrossRef] [Green Version]
  35. Piuri, M.; Sanchez-Rivas, C.; Ruzal, S.M. A novel antimicrobial activity of a Paenibacillus polymyxa strain isolated from regional fermented sausages. Lett. Appl. Microbiol. 1998, 27, 9–13. [Google Scholar] [CrossRef] [PubMed]
  36. Chen, B.; Han, H.; Hou, J.; Wang, G.; Zhao, F. Rapid screening of maize cultivars with resistance to banded leaf and sheath blight by ZmPR1a gene expression level. Mol. Plant Breed. 2021, 19, 7467–7472. [Google Scholar]
  37. Costerton, J.W.; Stewart, P.S.; Greenberg, E.P. Bacterial biofilms: A common cause of persistent infections. Science 1999, 284, 1318–1322. [Google Scholar] [CrossRef] [Green Version]
  38. Timmusk, S.; Grantcharova, N.; Wagner, E.G. Paenibacillus polymyxa invades plant roots and forms biofilms. Appl. Environ. Microbiol. 2005, 71, 7292–7300. [Google Scholar] [CrossRef] [Green Version]
  39. Hao, T.; Chen, S. Colonization of Wheat, Maize and Cucumber by Paenibacillus polymyxa WLY78. PLoS ONE 2017, 12, e0169980. [Google Scholar] [CrossRef]
  40. Pandey, K.D.; Patel, A.K.; Singh, M.; Vandana; Kumari, A.; Jalaluddin. Chapter 2—Secondary metabolites from bacteria and viruses. In Natural Bioactive Compounds; Sinha, R.P., Häder, D.-P., Eds.; Academic Press: Cambridge, MA, USA, 2021; pp. 19–40. [Google Scholar]
Figure 1. Phylogenetic tree constructed based on sequences of 16S rDNA of Paenibacillus genus. The phylogenetic tree was constructed by the neighbor joining method and the sequence of 16S rDNA of Bacillus subtilis subsp. subtilis str. 168 was used as root. Numbers nearby the branches indicate the percentage of support for 1000 bootstrap resampling analysis. The length of 0.01 was the genetic distance.
Figure 1. Phylogenetic tree constructed based on sequences of 16S rDNA of Paenibacillus genus. The phylogenetic tree was constructed by the neighbor joining method and the sequence of 16S rDNA of Bacillus subtilis subsp. subtilis str. 168 was used as root. Numbers nearby the branches indicate the percentage of support for 1000 bootstrap resampling analysis. The length of 0.01 was the genetic distance.
Microorganisms 10 01318 g001
Figure 2. Antagonistic activities of P. polymyxa strain SF05 against pathogenic fungi. The antagonistic results were observed enough times after co-inoculation of P. polymyxa strain SF05 and pathogenic fungi on PSA plates and incubation at the temperature of 28 °C.
Figure 2. Antagonistic activities of P. polymyxa strain SF05 against pathogenic fungi. The antagonistic results were observed enough times after co-inoculation of P. polymyxa strain SF05 and pathogenic fungi on PSA plates and incubation at the temperature of 28 °C.
Microorganisms 10 01318 g002
Figure 3. Expression analysis of maize disease resistance genes in different issues after being induced by P. polymyxa strain SF05 compared to the control group. The error bars in the figure are mean ± standard deviation.
Figure 3. Expression analysis of maize disease resistance genes in different issues after being induced by P. polymyxa strain SF05 compared to the control group. The error bars in the figure are mean ± standard deviation.
Microorganisms 10 01318 g003
Figure 4. Pectinase and cellulase activities of D. zeae NCPPB 3531, P. polymyxa strain SF05 and B. subtilis BS0512. Different lowercase letters denote significant differences (p < 0.05).
Figure 4. Pectinase and cellulase activities of D. zeae NCPPB 3531, P. polymyxa strain SF05 and B. subtilis BS0512. Different lowercase letters denote significant differences (p < 0.05).
Microorganisms 10 01318 g004
Figure 5. Chitinase activity of D. zeae NCPPB 3531, P. polymyxa strain SF05, B. subtilis BS0512. Different lowercase letters denote significant differences (p < 0.05).
Figure 5. Chitinase activity of D. zeae NCPPB 3531, P. polymyxa strain SF05, B. subtilis BS0512. Different lowercase letters denote significant differences (p < 0.05).
Microorganisms 10 01318 g005
Table 1. Pathogenic fungi used in this study.
Table 1. Pathogenic fungi used in this study.
SpeciesSource
Rhizoctonia solaniLaboratory Collection
Exserohilum turcicumLaboratory Collection
Bipolaris maydisLaboratory Collection
Fusurium verticillioidesLaboratory Collection
Sclerotinia sclerotiorumLaboratory Collection
Curvularia lunataHebei Academy of Agricultural and Forestry Sciences
F. graminearumNanjing Agricultural University
Lasiodiplodia theobromaeNanjing Agricultural University
F. oxysporum f.sp. niveumNanjing Agricultural University
Didymella bryoniaeNanjing Agricultural University
D. glomerataNanjing Agricultural University
Colletotrichum gloeosporioidesNanjing Agricultural University
Botryosphaeria dothideaNanjing Agricultural University
F. tricinctumNanjing Agricultural University
Pseudopestalotiopsis theaeNanjing Agricultural University
Stemphylium vesicariumNanjing Agricultural University
Phytophthora capsiciNanjing Agricultural University
Pyricularia oryzaeNanjing Agricultural University
Table 2. Sequences of primers used in qRT-PCR.
Table 2. Sequences of primers used in qRT-PCR.
PrimerSequences (5′-3′)References
Actin-FGGTTCTATTCCAGCCATCCTTCATTG [12]
Actin-RTCTCCTTGCTCATGCGGTCAC
ZmPR1a-FGGCGAGAGCCCCTACTAGAC[13]
ZmPR1a-RAAATCGCCTGCATGGTTTTA
PAL-FGAAGCTCATGTCGTCCACCTA[12]
PAL-RGTTCATGGTCAGCACCTTCTT
SOD-FAGAATAACATCCCGAAGACATC[12]
SOD-RAGCCAACAGTCCAACACAGT
OPR1-FCGTATGGGAGGCTGTTCTTG[12]
OPR1-RAGCGGTCGTATTTGTTGAGTG
OPR7-FGAGAAAGGTGGTTGATGCTGTT[12]
OPR7-RGGAGTTGGATACTTGCCATAGG
AOC-FGGGCATCTGCGTGCTCATC[14]
AOC-RACCGCCAGGTACGACTCCTC
Table 3. Control effect of P. polymyxa strain SF05 on maize to banded leaf and sheath blight in the field.
Table 3. Control effect of P. polymyxa strain SF05 on maize to banded leaf and sheath blight in the field.
TreatmentDisease IndexControl Effect
Biological Treatment37.38 ± 1.23 b37.06%
Chemical Treatment32.20 ± 0.75 a45.79%
Negative Control 59.40 ± 2.17 c-
Different lowercase letters denote significant differences (p < 0.05).
Table 4. Genome information of P. polymyxa was analyzed in this study.
Table 4. Genome information of P. polymyxa was analyzed in this study.
StrainGenBankSize (Mb)GC%ProteinrRNAtRNAOther RNAGenePseudogene
SF05-5.4645.546154310845018248
ZF129GCA_006274405.15.8245.44873421114511585
CF05GCA_000785455.15.7645.54738431074496674
YC0573GCA_001874425.36.1345.650913710245442208
Sb3-1GCA_000819665.15.8345.548124610945097126
HY96-2GCA_002893885.15.7545.646634211044955136
CJX518GCA_014854715.15.6945.447494211145034128
JE201 GCA_019852195.16.1745.351454611145425119
EBL06GCA_000955925.15.6845.648217384496494
E681GCA_014706575.15.4245.84532369144872209
Table 5. Prediction of volatile organic compounds biosynthesis genes in P. polymyxa genomes.
Table 5. Prediction of volatile organic compounds biosynthesis genes in P. polymyxa genomes.
VOC12345678910
2,3-Butanediol2222222222
Acetone3333333333
Acetylene1111111111
Glyoxylic acid1011111111
Benzaldehyde2222222221
Butanol1111111111
Ethanol3232222223
Methanethiol2333333333
Total15141615151515151515
The numbers in the first line in the table represented the genome of P. polymyxa SF05 (1), ZF129 (2), CF05 (3), YC0573 (4), Sb3-1 (5), HY96-2 (6), CJX518 (7), JE201 (8), EBL06 (9) and E681 (10).
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Chen, B.; Han, H.; Hou, J.; Bao, F.; Tan, H.; Lou, X.; Wang, G.; Zhao, F. Control of Maize Sheath Blight and Elicit Induced Systemic Resistance Using Paenibacillus polymyxa Strain SF05. Microorganisms 2022, 10, 1318. https://doi.org/10.3390/microorganisms10071318

AMA Style

Chen B, Han H, Hou J, Bao F, Tan H, Lou X, Wang G, Zhao F. Control of Maize Sheath Blight and Elicit Induced Systemic Resistance Using Paenibacillus polymyxa Strain SF05. Microorganisms. 2022; 10(7):1318. https://doi.org/10.3390/microorganisms10071318

Chicago/Turabian Style

Chen, Bin, Hailiang Han, Junfeng Hou, Fei Bao, Heping Tan, Xiaocheng Lou, Guiyue Wang, and Fucheng Zhao. 2022. "Control of Maize Sheath Blight and Elicit Induced Systemic Resistance Using Paenibacillus polymyxa Strain SF05" Microorganisms 10, no. 7: 1318. https://doi.org/10.3390/microorganisms10071318

APA Style

Chen, B., Han, H., Hou, J., Bao, F., Tan, H., Lou, X., Wang, G., & Zhao, F. (2022). Control of Maize Sheath Blight and Elicit Induced Systemic Resistance Using Paenibacillus polymyxa Strain SF05. Microorganisms, 10(7), 1318. https://doi.org/10.3390/microorganisms10071318

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop