Characterization of Latex-Clearing Protein and Aldehyde Dehydrogenases Involved in the Utilization of poly(cis-1,4-isoprene) by Nocardia farcinica NBRC 15532
Abstract
:1. Introduction
2. Materials and Methods
2.1. Bacterial Strains and Culture Conditions
2.2. DNA Manipulation, Nucleotide Sequencing, and Sequence Analysis
2.3. Expression of His-Tagged Lcp and Aldehyde Dehydrogenase Genes in E. coli
2.4. Enzyme Assays
2.4.1. Lcp
2.4.2. Oligo-Isoprene Aldehyde Dehydrogenase
2.5. Determination of Oligo-Isoprene Aldehydes and Acids
2.6. Construction of Deletion Mutants
2.7. Quantitative Reverse Transcription-PCR (qRT-PCR) Analysis
3. Results and Discussion
3.1. Characterization of Lcp-Coding Gene of Strain NBRC 15532
3.2. Identification of ALDH for the Oxidation of Oligo-Isoprene Aldehydes
3.3. Transcriptional Induction of the lcp and the ALDH Genes
3.4. Disruption of the ALDH Genes in NBRC 15532
3.5. Identification of the Reaction Product of Oligo-Isoprene Aldehydes
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Acknowledgments
Conflicts of Interest
References
- Backhaus, R.A. Rubber formation in plants—A minireview. Israel J. Bot. 1985, 34, 283–293. [Google Scholar]
- Nayanashree, G.; Thippeswamy, B. Biodegradation of natural rubber by laccase and manganese peroxidase enzyme of Bacillus subtilis. Environ. Process. 2015, 2, 761–772. [Google Scholar] [CrossRef] [Green Version]
- Bode, H.B.; Kerkhoff, K.; Jendrossek, D. Bacterial degradation of natural and synthetic rubber. Biomacromolecules 2001, 2, 295–303. [Google Scholar] [CrossRef] [PubMed]
- Yikmis, M.; Steinbuchel, A. Historical and recent achievements in the field of microbial degradation of natural and synthetic rubber. Appl. Environ. Microbiol. 2012, 78, 4543–4551. [Google Scholar] [CrossRef] [Green Version]
- Braaz, R.; Fischer, P.; Jendrossek, D. Novel type of heme-dependent oxygenase catalyzes oxidative cleavage of rubber (poly-cis-1,4-isoprene). Appl. Environ. Microbiol. 2004, 70, 7388–7395. [Google Scholar] [CrossRef] [Green Version]
- Bröker, D.; Dietz, D.; Arenskötter, M.; Steinbüchel, A. The genomes of the non-clearing-zone-forming and natural-rubber-degrading species Gordonia polyisoprenivorans and Gordonia westfalica harbor genes expressing Lcp activity in Streptomyces strains. Appl. Environ. Microbiol. 2008, 74, 2288–2297. [Google Scholar] [CrossRef] [Green Version]
- Yikmis, M.; Arenskötter, M.; Rose, K.; Lange, N.; Wernsmann, H.; Wiefel, L.; Steinbüchel, A. Secretion and transcriptional regulation of the latex-clearing protein, Lcp, by the rubber-degrading bacterium Streptomyces sp. strain K30. Appl. Environ. Microbiol. 2008, 74, 5373–5382. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hiessl, S.; Schuldes, J.; Thürmer, A.; Halbsguth, T.; Bröker, D.; Angelov, A.; Liebl, W.; Daniel, R.; Steinbüchel, A. Involvement of two latex-clearing proteins during rubber degradation and insights into the subsequent degradation pathway revealed by the genome sequence of Gordonia polyisoprenivorans strain VH2. Appl. Environ. Microbiol. 2012, 78, 2874–2887. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Luo, Q.; Hiessl, S.; Poehlein, A.; Daniel, R.; Steinbüchel, A. Insights into the microbial degradation of rubber and gutta-percha by analysis of the complete genome of Nocardia nova SH22a. Appl. Environ. Microbiol. 2014, 80, 3895–3907. [Google Scholar] [CrossRef] [Green Version]
- Watcharakul, S.; Rother, W.; Birke, J.; Umsakul, K.; Hodgson, B.; Jendrossek, D. Biochemical and spectroscopic characterization of purified Latex clearing protein (Lcp) from newly isolated rubber degrading Rhodococcus rhodochrous strain RPK1 reveals novel properties of Lcp. BMC Microbiol. 2016, 16, 92. [Google Scholar] [CrossRef] [Green Version]
- Kasai, D.; Imai, S.; Asano, S.; Tabata, M.; Iijima, S.; Kamimura, N.; Masai, E.; Fukuda, M. Identification of natural rubber degradation gene in Rhizobacter gummiphilus NS21. Biosci. Biotechnol. Biochem. 2017, 81, 614–620. [Google Scholar] [CrossRef]
- Oetermann, S.; Vivod, R.; Hiessl, S.; Hogeback, J.; Holtkamp, M.; Karst, U.; Steinbüchel, A. Histidine at position 195 is essential for association of Heme-b in Lcp1VH2. Earth Syst. Environ. 2018, 2, 5–14. [Google Scholar] [CrossRef]
- Birke, J.; Rother, W.; Jendrossek, D. Rhizobacter gummiphilus NS21 has two rubber oxygenases (RoxA and RoxB) acting synergistically in rubber utilisation. Appl. Microbiol. Biotechnol. 2018, 102, 10245–10257. [Google Scholar] [CrossRef]
- Linh, D.V.; Huong, N.L.; Tabata, M.; Imai, S.; Iijima, S.; Kasai, D.; Anh, T.K.; Fukuda, M. Characterization and functional expression of a rubber degradation gene of a Nocardia degrader from a rubber-processing factory. J. Biosci. Bioeng. 2017, 123, 412–418. [Google Scholar] [CrossRef]
- Gibu, N.; Arata, T.; Kuboki, S.; Linh, D.V.; Fukuda, M.; Steinbuchel, A.; Kasai, D. Characterization of the genes responsible for rubber degradation in Actinoplanes sp. strain OR16. Appl. Microbiol. Biotechnol. 2020, 104, 7367–7376. [Google Scholar] [CrossRef]
- Gibu, N.; Linh, D.V.; Suzuki, N.; Thuy Ngan, N.T.; Fukuda, M.; Anh, T.K.; Huong, N.L.; Kasai, D. Identification and transcriptional analysis of poly(cis-1,4-isoprene) degradation gene in Rhodococcus sp. strain RDE2. J. Biosci. Bioeng. 2022, 133, 452–458. [Google Scholar] [CrossRef]
- Jendrossek, D.; Reinhardt, S. Sequence analysis of a gene product synthesized by Xanthomonas sp. during growth on natural rubber latex. FEMS Microbiol. Lett. 2003, 224, 61–65. [Google Scholar] [CrossRef] [Green Version]
- Imai, S.; Ichikawa, K.; Muramatsu, Y.; Kasai, D.; Masai, E.; Fukuda, M. Isolation and characterization of Streptomyces, Actinoplanes, and Methylibium strains that are involved in degradation of natural rubber and synthetic poly(cis-1,4-isoprene). Enzyme Microb. Technol. 2011, 49, 526–531. [Google Scholar] [CrossRef]
- Sharma, V.; Siedenburg, G.; Birke, J.; Mobeen, F.; Jendrossek, D.; Prakash, T. Metabolic and taxonomic insights into the Gram-negative natural rubber degrading bacterium Steroidobacter cummioxidans sp. nov., strain 35Y. PLoS ONE 2018, 13, e0197448. [Google Scholar] [CrossRef] [Green Version]
- Rose, K.; Tenberge, K.B.; Steinbüchel, A. Identification and characterization of genes from Streptomyces sp. strain K30 responsible for clear zone formation on natural rubber latex and poly(cis-1,4-isoprene) rubber degradation. Biomacromolecules 2005, 6, 180–188. [Google Scholar] [CrossRef]
- Vivod, R.; Oetermann, S.; Hiessl, S.; Gutsche, S.; Remmers, N.; Meinert, C.; Voigt, B.; Riedel, K.; Steinbüchel, A. Oligo(cis-1,4-isoprene) aldehyde-oxidizing dehydrogenases of the rubber-degrading bacterium Gordonia polyisoprenivorans VH2. Appl. Microbiol. Biotechnol. 2017, 101, 7945–7960. [Google Scholar] [CrossRef]
- Luo, Q.; Hiessl, S.; Poehlein, A.; Steinbüchel, A. Microbial gutta-percha degradation shares common steps with rubber degradation by Nocardia nova SH22a. Appl. Environ. Microbiol. 2013, 79, 1140–1149. [Google Scholar] [CrossRef] [Green Version]
- Vivod, R.; Andler, R.; Oetermann, S.; Altenhoff, A.L.; Seipel, N.; Holtkamp, M.; Hogeback, J.; Karst, U.; Steinbüchel, A. Characterization of the latex clearing protein of the poly(cis-1,4-isoprene) and poly(trans-1,4-isoprene) degrading bacterium Nocardia nova SH22a. J. Gen. Appl. Microbiol. 2019, 65, 293–300. [Google Scholar] [CrossRef] [Green Version]
- Araki, N.; Suzuki, T.; Miyauchi, K.; Kasai, D.; Masai, E.; Fukuda, M. Identification and characterization of uptake systems for glucose and fructose in Rhodococcus jostii RHA1. J. Mol. Microb. Biotech. 2011, 20, 125–136. [Google Scholar] [CrossRef]
- Masai, E.; Yamada, A.; Healy, J.M.; Hatta, T.; Kimbara, K.; Fukuda, M.; Yano, K. Characterization of biphenyl catabolic genes of gram-positive polychlorinated biphenyl degrader Rhodococcus sp. strain RHA1. Appl. Environ. Microbiol. 1995, 61, 2079–2085. [Google Scholar] [CrossRef] [Green Version]
- Kasai, D.; Fujinami, T.; Abe, T.; Mase, K.; Katayama, Y.; Fukuda, M.; Masai, E. Uncovering the protocatechuate 2,3-cleavage pathway genes. J. Bacteriol. 2009, 191, 6758–6768. [Google Scholar] [CrossRef] [Green Version]
- Teufel, F.; Almagro Armenteros, J.J.; Johansen, A.R.; Gíslason, M.H.; Pihl, S.I.; Tsirigos, K.D.; Winther, O.; Brunak, S.; von Heijne, G.; Nielsen, H. SignalP 6.0 predicts all five types of signal peptides using protein language models. Nat. Biotechnol. 2022, 40, 1023–1025. [Google Scholar] [CrossRef]
- Kasai, D.; Araki, N.; Motoi, K.; Yoshikawa, S.; Iino, T.; Imai, S.; Masai, E.; Fukuda, M. γ-Resorcylate catabolic-pathway genes in the soil actinomycete Rhodococcus jostii RHA1. Appl. Environ. Microbiol. 2015, 81, 7656–7665. [Google Scholar] [CrossRef] [Green Version]
- Sharp, J.O.; Sales, C.M.; LeBlanc, J.C.; Liu, J.; Wood, T.K.; Eltis, L.D.; Mohn, W.W.; Alvarez-Cohen, L. An inducible propane monooxygenase is responsible for N-nitrosodimethylamine degradation by Rhodococcus sp. strain RHA1. Appl. Environ. Microbiol. 2007, 73, 6930–6938. [Google Scholar] [CrossRef] [Green Version]
- Schäfer, A.; Tauch, A.; Jäger, W.; Kalinowski, J.; Thierbach, G.; Pühler, A. Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: Selection of defined deletions in the chromosome of Corynebacterium glutamicum. Gene 1994, 145, 69–73. [Google Scholar] [CrossRef]
- Van der Geize, R.; Hessels, G.I.; van Gerwen, R.; van der Meijden, P.; Dijkhuizen, L. Unmarked gene deletion mutagenesis of kstD, encoding 3-ketosteroid Δ1-dehydrogenase, in Rhodococcus erythropolis SQ1 using sacB as counter-selectable marker. FEMS Microbiol. Lett. 2001, 205, 197–202. [Google Scholar] [CrossRef]
- Birke, J.; Rother, W.; Jendrossek, D. Latex clearing protein (Lcp) of Streptomyces sp. strain K30 is a b-type cytochrome and differs from rubber oxygenase A (RoxA) in its biophysical properties. Appl. Environ. Microbiol. 2015, 81, 3793–3799. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hiessl, S.; Böse, D.; Oetermann, S.; Eggers, J.; Pietruszka, J.; Steinbüchel, A. Latex clearing protein-an oxygenase cleaving poly(cis-1,4-isoprene) rubber at the cis double bonds. Appl. Environ. Microbiol. 2014, 80, 5231–5240. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Altenhoff, A.L.; de Witt, J.; Andler, R.; Steinbüchel, A. Impact of additives of commercial rubber compounds on the microbial and enzymatic degradation of poly(cis-1,4-isoprene). Biodegradation 2019, 30, 13–26. [Google Scholar] [CrossRef] [PubMed]
- Lüddeke, F.; Wülfing, A.; Timke, M.; Germer, F.; Weber, J.; Dikfidan, A.; Rahnfeld, T.; Linder, D.; Meyerdierks, A.; Harder, J. Geraniol and geranial dehydrogenases induced in anaerobic monoterpene degradation by Castellaniella defragrans. Appl. Environ. Microbiol. 2012, 78, 2128–2136. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ishige, T.; Tani, A.; Sakai, Y.; Kato, N. Long-chain aldehyde dehydrogenase that participates in n-alkane utilization and wax ester synthesis in Acinetobacter sp. strain M-1. Appl. Environ. Microbiol. 2000, 66, 3481–3486. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Niederreither, K.; McCaffery, P.; Dräger, U.C.; Chambon, P.; Dollé, P. Restricted expression and retinoic acid-induced downregulation of the retinaldehyde dehydrogenase type 2 (RALDH-2) gene during mouse development. Mech. Dev. 1997, 62, 67–78. [Google Scholar] [CrossRef] [PubMed]
- Gagnon, I.; Duester, G.; Bhat, P.V. Kinetic analysis of mouse retinal dehydrogenase type-2 (RALDH2) for retinal substrates. Biochim. Biophys. Acta 2002, 1596, 156–162. [Google Scholar] [CrossRef]
- Chakraborty, S.; Karmakar, K.; Chakravortty, D. Cells producing their own nemesis: Understanding methylglyoxal metabolism. IUBMB Life 2014, 66, 667–678. [Google Scholar] [CrossRef] [PubMed]
- Chen, N.H.; Djoko, K.Y.; Veyrier, F.J.; McEwan, A.G. Formaldehyde Stress Responses in Bacterial Pathogens. Front. Microbiol. 2016, 7, 257. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Umansky, C.; Morellato, A.E.; Rieckher, M.; Scheidegger, M.A.; Martinefski, M.R.; Fernandez, G.A.; Pak, O.; Kolesnikova, K.; Reingruber, H.; Bollini, M.; et al. Endogenous formaldehyde scavenges cellular glutathione resulting in redox disruption and cytotoxicity. Nat. Commun. 2022, 13, 745. [Google Scholar] [CrossRef] [PubMed]
Oligo Nucleotide | Sequence (5’ to 3’) |
---|---|
For gene expression | |
lcp_Nde_F | GAAGGAGATATACATATGGATGGACTCAGCAGGCG |
lcp_Hind_R | GAGTGCGGCCGCAAGCTTGCGATGCGGTTTGGTCA |
07830_Nde_F | TCGAAGGTAGGCATATGACCACTTCCGCCCCCACC |
07830_Nde_R | GTACCGAGCTCCATATCAGGGTCGGCAGACGTCCT |
09370_Nde_F | TCGAAGGTAGGCATATGAACCGATCGATGTCCGTC |
09370_Nde_R | GTACCGAGCTCCATATCACACCATGATGTTGATGA |
14000_Nde_F | TCGAAGGTAGGCATATGATCTATGCAAAGCCGGG |
14000_EcoR_R | CGACAAGCTTGAATTACGGTGATGTGGGTGTGT |
14385_Nde_F | TCGAAGGTAGGCATATGACCGACACGCTTTCCGAG |
14385_Nde_R | GTACCGAGCTCCATATCACAACTGCGCGTTGATCG |
14465_Nde_F | TCGAAGGTAGGCATATGCGAAACCAGCTCTTCATC |
14465_Nde_R | GTACCGAGCTCCATATCAGGCCAACGCGGTCCAGA |
24625_Nde_F | TCGAAGGTAGGCATAATGCATTACGACAGCTTGTT |
24625_EcoR_R | CGACAAGCTTGAATTCTAGCCGGTCCAGCCCAT |
28775_Nde_F | TCGAAGGTAGGCATAATGAGCGGACTTCTGCCC |
28775_EcoR_R | CGACAAGCTTGAATTTCAGACCGCGGTGGCGAT |
02580_VH2_Nde_F | TCGAAGGTAGGCATATGATCACCTACGACAAACTC |
02580_VH2_Nde_R | GTACCGAGCTCCATATCAGGCGTAGATCGACTTG |
For qRT-PCR | |
lcp_F | GATCAGCCAGAACGACATGA |
lcp_R | CGAGTTGGGGATGTACTCGT |
14000_F | GCACTGATCCACTCCTCCAT |
14000_R | CAGGTTCTTGGTCTGCTGGT |
14385_F | CGTTCGAGGGTGAATGGTCG |
14385_R | TTGCCGTTGTCCAGCGATTC |
16S_F | AGAGATGTAGGCCCCCTTGT |
16S_R | CCGGTACGGCTACCTTGTTA |
For gene disruption | |
lcp_UP_F | CGACTCTAGAGGATCGAACACCGAGGAGAGAGAGG |
lcp_UP_R | CGACTCTAGAGGATCACGAAGCCGACCAGCTGCGT |
lcp_DW_F | CGTGTACTGGCTCTTCGACG |
lcp_DW_F | CGGTACCCGGGGATCCGGTGGCGGTGCCCGGCGCT |
14000_UP_F | CGGTACCCGGGGATCACCTCGCTTCCGTCGTGG |
14000_UP_R | ACCGTAGAGGGTGTCAATGTTGGCGCGCTCGCTCG |
14000_DW_F | GACACCCTCTACGGTCTGGG |
14000_DW_R | CGACTCTAGAGGATCCCGAGTGGGACACGATCG |
14385_UP_F | CGGTACCCGGGGATCGCCCTCGAGCAACTGCTG |
14385_UP_R | TAGGGGGTGTCGTTGCACAGCGACCATTCACCCTC |
14385_DW_F | CAACGACACCCCCTACGGCC |
14385_DW_R | CGACTCTAGAGGATCGGGATGTGGTCCGGATGC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Suzuki, N.; Suda, D.; Ngan, N.T.T.; Gibu, N.; Huong, N.L.; Anh, T.K.; Kasai, D. Characterization of Latex-Clearing Protein and Aldehyde Dehydrogenases Involved in the Utilization of poly(cis-1,4-isoprene) by Nocardia farcinica NBRC 15532. Microorganisms 2022, 10, 2324. https://doi.org/10.3390/microorganisms10122324
Suzuki N, Suda D, Ngan NTT, Gibu N, Huong NL, Anh TK, Kasai D. Characterization of Latex-Clearing Protein and Aldehyde Dehydrogenases Involved in the Utilization of poly(cis-1,4-isoprene) by Nocardia farcinica NBRC 15532. Microorganisms. 2022; 10(12):2324. https://doi.org/10.3390/microorganisms10122324
Chicago/Turabian StyleSuzuki, Natsuhei, Daito Suda, Nguyen Thi Thuy Ngan, Namiko Gibu, Nguyen Lan Huong, To Kim Anh, and Daisuke Kasai. 2022. "Characterization of Latex-Clearing Protein and Aldehyde Dehydrogenases Involved in the Utilization of poly(cis-1,4-isoprene) by Nocardia farcinica NBRC 15532" Microorganisms 10, no. 12: 2324. https://doi.org/10.3390/microorganisms10122324
APA StyleSuzuki, N., Suda, D., Ngan, N. T. T., Gibu, N., Huong, N. L., Anh, T. K., & Kasai, D. (2022). Characterization of Latex-Clearing Protein and Aldehyde Dehydrogenases Involved in the Utilization of poly(cis-1,4-isoprene) by Nocardia farcinica NBRC 15532. Microorganisms, 10(12), 2324. https://doi.org/10.3390/microorganisms10122324