The Early Peritoneal Cavity Immune Response to Vibrio Anguillarum Infection and to Inactivated Bacterium in Olive Flounder (Paralichthys olivaceus)
Abstract
1. Introduction
2. Material and Methods
2.1. Animals and Bacteria
2.2. Antibodies
2.3. Fish Challenge and Isolation of PerC Cells
2.4. Sorting Cells via Flow Cytometry
2.5. Indirect Immunofluorescence and FACS Analysis
2.6. Transmission Electron Microscopy
2.7. PerC Cells Analyzed via Flow Cytometry
2.8. Quantitative Real-Time PCR
2.9. Statistic Analysis
3. Results
3.1. Composition and Characteristics of PerC Resident Cells
3.2. Composition Changes in PerC Cells after Infection and Immunization
3.3. Gene Expression of PerC Cells in Response to V. Anguillarum Infection and Vaccination
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Meseguer, J.; Esteban, M.A.; Muñoz, J.; López-Ruiz, A. Ultrastructure of the peritoneal exudate cells of seawater teleosts, seabream (Sparus aurata) and sea bass (Dicentrarchus labrax). Cell Tissue Res. 1993, 273, 301–307. [Google Scholar] [CrossRef] [Scilit]
- Capobianco, A.; Cottone, L.; Monno, A.; Manfredi, A.A.; Rovere-Querini, P. The peritoneum: Healing, immunity, and diseases. J. Pathol. 2017, 243, 137–147. [Google Scholar] [CrossRef] [Scilit]
- Afonso, A.; Ellis, A.E.; Silva, M.T. The leucocyte population of the unstimulated peritoneal cavity of rainbow trout (Oncorhynchus mykiss). Fish Shellfish Immunol. 1997, 7, 335–348. [Google Scholar] [CrossRef] [Scilit]
- Moss, L.D.; Monette, M.M.; Jaso-Friedmann, L.; Leary, J.H., III; Dougan, S.T.; Krunkosky, T.; Evans, D.L. Identification of phagocytic cells, NK-like cytotoxic cell activity and the production of cellular exudates in the coelomic cavity of adult zebrafish. Dev. Comp. Immunol. 2009, 33, 1077–1087. [Google Scholar] [CrossRef] [Scilit]
- Tumbol, R.A.; Baiano, J.C.F.; Barnes, A.C. Differing cell population structure reflects the different activity of Percoll-separated pronephros and peritoneal leucocytes from barramundi (Lates calcarifer). Aquaculture 2009, 292, 180–188. [Google Scholar] [CrossRef] [Scilit]
- Lugo-Villarino, G.; Balla, K.M.; Stachura, D.L.; Bañuelos, K.; Werneck, M.B.F.; Traver, D. Identification of dendritic antigen-presenting cells in the zebrafish. Proc. Natl. Acad. Sci. USA 2010, 107, 15850–15855. [Google Scholar] [CrossRef] [Scilit]
- Scapigliati, G. Functional aspects of fish lymphocytes. Dev. Comp. Immunol. 2013, 41, 200–208. [Google Scholar] [CrossRef] [Scilit]
- Dong, F.; Song, X.; Xing, J.; Tang, X.; Sheng, X.; Chi, H.; Zhan, W. Immunological Characteristics of Dendritic Cells Marker CD83 in Flounder (Paralichthys olivaceus). Fish Shellfish Immunol. Rep. 2021, 2, 100030. [Google Scholar] [CrossRef] [Scilit]
- Geissmann, F.; Manz, M.G.; Jung, S.; Sieweke, M.H.; Merad, M.; Ley, K. Development of monocytes, macrophages, and dendritic cells. Science 2010, 327, 656–661. [Google Scholar] [CrossRef] [Scilit]
- Arazna, M.; Pruchniak, M.P.; Demkow, U. Neutrophil extracellular traps in bacterial infections: Strategies for escaping from killing. Respir. Physiol. Neurobiol. 2013, 187, 74–77. [Google Scholar] [CrossRef] [Scilit]
- Chi, H.; Sun, L. Neutrophils of Scophthalmus maximus produce extracellular traps that capture bacteria and inhibit bacterial infection. Dev. Comp. Immunol. 2016, 56, 7–12. [Google Scholar] [CrossRef] [Scilit]
- Grayfer, L.; Kerimoglu, B.; Yaparla, A.; Hodgkinson, J.W.; Xie, J.; Belosevic, M. Mechanisms of Fish Macrophage Antimicrobial Immunity. Front. Immunol. 2018, 9, 1105. [Google Scholar] [CrossRef] [Scilit]
- Li, Q.; Chi, H.; Shi, X.; Gan, Q.; Dalmo, R.A.; Sun, Y.Y.; Tang, X.; Xing, J.; Sheng, X.; Zhan, W. Vaccine Adjuvants Induce Formation of Intraperitoneal Extracellular Traps in Flounder (Paralichthys olivaceus). Front. Cell Infect. Microbiol. 2022, 12, 875409. [Google Scholar] [CrossRef] [Scilit]
- Zhou, Z.; Wang, Z.; Gao, J.; Lin, Z.; Wang, Y.; Shan, P.; Li, M.; Zhou, T.; Li, P. Noncoding RNA-mediated macrophage and cancer cell crosstalk in hepatocellular carcinoma. Mol. Ther. Oncolytics. 2022, 25, 98–120. [Google Scholar] [CrossRef] [Scilit]
- Xing, J.; Tian, H.; Tang, X.; Sheng, X.; Zhan, W. Kinetics of T lymphocyte subsets and B lymphocytes in response to immunostimulants in flounder (Paralichthys olivaceus): Implications for CD4+ T lymphocyte differentiation. Sci. Rep. 2020, 10, 13827. [Google Scholar] [CrossRef] [Scilit]
- Li, Q.; Zhan, W.; Xing, J.; Sheng, X. Production, characterisation and applicability of monoclonal antibodies to immunoglobulin of Japanese flounder (Paralichthys olivaceus). Fish Shellfish Immunol. 2007, 23, 982–990. [Google Scholar] [CrossRef] [Scilit]
- Liang, C.; Sheng, X.; Tang, X.; Xing, J.; Chi, H.; Zhan, W. Structural characteristics and mucosal immune response of the interbranchial lymphoid tissue in the gills of flounder (Paralichthys olivaceus). Fish Shellfish Immunol. 2022, 123, 388–398. [Google Scholar] [CrossRef] [Scilit]
- Xing, J.; Zhou, X.; Tang, X.; Sheng, X.; Zhan, W. FlaC supplemented with VAA, OmpK or OmpR as bivalent subunit vaccine candidates induce immune responses against Vibrio anguillarum in flounder (Paralichthys olivaceus). Vaccine 2018, 36, 1316–1322. [Google Scholar] [CrossRef] [Scilit]
- Castro, R.; Abós, B.; González, L.; Granja, A.G.; Tafalla, C. Expansion and differentiation of IgM+ B cells in the rainbow trout peritoneal cavity in response to different antigens. Dev. Comp. Immunol. 2017, 70, 119–127. [Google Scholar] [CrossRef] [Scilit]
- Jenberie, S.; Peñaranda, M.M.D.; Thim, H.L.; Styrvold, M.B.; Strandskog, G.; Jørgensen, J.B.; Jensen, I. Salmonid Alphavirus Subtype 3 Induces Prolonged Local B Cell Responses in Atlantic Salmon (Salmo salar) After Intraperitoneal Infection. Front Immunol. 2020, 11, 1682. [Google Scholar] [CrossRef] [Scilit]
- van der Wal, Y.A.; Jenberie, S.; Nordli, H.; Greiner-Tollersrud, L.; Kool, J.; Jensen, I.; Jørgensen, J.B. The importance of the Atlantic salmon peritoneal cavity B cell response: Local IgM secreting cells are predominant upon Piscirickettsia salmonis infection. Dev. Comp. Immunol. 2021, 123, 104125. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ishibe, K.; Osatomi, K.; Hara, K.; Kanai, K.; Yamaguchi, K.; Oda, T. Comparison of the responses of peritoneal macrophages from Japanese flounder (Paralichthys olivaceus) against high virulent and low virulent strains of Edwardsiella tarda. Fish Shellfish Immunol. 2008, 24, 243–251. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brudeseth, B.E.; Wiulsrød, R.; Fredriksen, B.N.; Lindmo, K.; Løkling, K.E.; Bordevik, M.; Steine, N.; Klevan, A.; Gravningen, K. Status and future perspectives of vaccines for industrialised fin-fish farming. Fish Shellfish Immunol. 2013, 35, 1759–1768. [Google Scholar] [CrossRef] [Scilit]
- Mutoloki, S.; Reite, O.B.; Brudeseth, B.; Tverdal, A.; Evensen, Ø. A comparative immunopathological study of injection site reactions in salmonids following intraperitoneal injection with oil-adjuvanted vaccines. Vaccine 2006, 24, 578–588. [Google Scholar] [CrossRef] [Scilit]
- Chaves-Pozo, E.; Muñoz, P.; López-Muñoz, A.; Pelegrín, P.; García Ayala, A.; Mulero, V.; Meseguer, J. Early innate immune response and redistribution of inflammatory cells in the bony fish gilthead seabream experimentally infected with Vibrio anguillarum. Cell Tissue Res. 2005, 320, 61–68. [Google Scholar] [CrossRef] [Scilit]
- Do Vale, A.; Afonso, A.; Silva, M.T. The professional phagocytes of sea bass (Dicentrarchus labrax L.): Cytochemical characterisation of neutrophils and macrophages in the normal and inflamed peritoneal cavity. Fish Shellfish Immunol. 2002, 13, 183–198. [Google Scholar] [CrossRef] [Scilit]
- Eggset, G.; Mikkelsen, H.; Killie, J.E.A. Immunocompetence and duration of immunity against Vibrio salmonicida and Aeromonas salmonicida after vaccination of Atlantic salmon (Salmo salar L) at low and high temperatures. Fish Shellfish Immunol. 1997, 7, 247–260. [Google Scholar] [CrossRef] [Scilit]
- Alejo, A.; Tafalla, C. Chemokines in teleost fish species. Dev. Comp. Immunol. 2011, 35, 1215–1222. [Google Scholar] [CrossRef] [Scilit]
- Frans, I.; Michiels, C.W.; Bossier, P.; Willems, K.A.; Lievens, B.; Rediers, H. Vibrio anguillarum as a fish pathogen: Virulence factors, diagnosis and prevention. J. Fish Dis. 2011, 34, 643–661. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Midtlyng, P.J.; Reitan, L.J.; Lillehaug, A.; Ramstad, A. Protection, immune responses and side effects in Atlantic salmon (Salmo salar L) vaccinated against furunculosis by different procedures. Fish Shellfish Immunol. 1996, 6, 599–613. [Google Scholar] [CrossRef] [Scilit]
- Zhou, X.; Xing, J.; Tang, X.; Zhan, W. Evaluation of bivalent vaccines candidates among VAA, OmpK and OmpR from Vibrio anguillarum in flounder (Paralichthys olivaceus). Dev. Comp. Immunol. 2018, 85, 1–9. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, H.; Xing, J.; Tang, X.; Sheng, X.; Chi, H.; Zhan, W. Two bicistronic DNA vaccines against Vibrio anguillarum and the immune effects on flounder Paralichthys olivaceus. J. Oceanol. Limnol. 2022, 40, 786–804. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tkach, M.; Kowal, J.; Zucchetti, A.E.; Enserink, L.; Jouve, M.; Lankar, D.; Saitakis, M.; Martin-Jaular, L.; Théry, C. Qualitative differences in T-cell activation by dendritic cell-derived extracellular vesicle subtypes. Embo. J. 2017, 36, 3012–3028. [Google Scholar] [CrossRef] [Scilit]
- Gómez-González, N.E.; García-García, E.; Montero, J.; García-Alcázar, A.; Meseguer, J.; García-Ayala, A.; Mulero, V. Isolation of mast cells from the peritoneal exudate of the teleost fish gilthead sea bream (Sparus aurata L). Fish Shellfish Immunol. 2014, 40, 225–232. [Google Scholar] [CrossRef] [Scilit]
- Granja, A.G.; Tafalla, C. Different IgM(+) B cell subpopulations residing within the peritoneal cavity of vaccinated rainbow trout are differently regulated by BAFF. Fish Shellfish Immunol. 2019, 85, 9–17. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Korytář, T.; Jaros, J.; Verleih, M.; Rebl, A.; Kotterba, G.; Kühn, C.; Goldammer, T.; Köllner, B. Novel insights into the peritoneal inflammation of rainbow trout (Oncorhynchus mykiss). Fish Shellfish Immunol. 2013, 35, 1192–1199. [Google Scholar] [CrossRef] [Scilit]
- Afonso, A.; Lousada, S.; Silva, J.; Ellis, A.E.; Silva, M.T. Neutrophil and macrophage responses to inflammation in the peritoneal cavity of rainbow trout Oncorhynchus mykiss. A light and electron microscopic cytochemical study. Dis. Aquat. Organ. 1998, 34, 27–37. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Okumoto, K.; Tamura, S.; Honsho, M.; Fujiki, Y. Peroxisome: Metabolic Functions and Biogenesis. Adv. Exp. Med. Biol. 2020, 1299, 3–17. [Google Scholar] [CrossRef] [Scilit]
- Zhou, Z.; He, Y.; Wang, S.; Wang, Y.; Shan, P.; Li, P. Autophagy regulation in teleost fish: A double-edged sword. Aquaculture 2022, 558, 738369. [Google Scholar] [CrossRef] [Scilit]
- Banchereau, J.; Briere, F.; Caux, C.; Davoust, J.; Lebecque, S.; Liu, Y.J.; Pulendran, B.; Palucka, K. Immunobiology of dendritic cells. Annu. Rev. Immunol. 2000, 18, 767–811. [Google Scholar] [CrossRef] [Scilit]
- Pineda-Torra, I.; Gage, M.; de Juan, A.; Pello, O.M. Isolation, Culture, and Polarization of Murine Bone Marrow-Derived and Peritoneal Macrophages. Methods Mol. Biol. 2015, 1339, 101–109. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Romano, N.; Abelli, L.; Mastrolia, L.; Scapigliati, G. Immunocytochemical detection and cytomorphology of lymphocyte subpopulations in a teleost fish Dicentrarchus labrax. Cell Tissue Res. 1997, 289, 163–171. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aerts-Toegaert, C.; Heirman, C.; Tuyaerts, S.; Corthals, J.; Aerts, J.; Bonehill, A.; Thielemans, K.; Breckpot, K. CD83 expression on dendritic cells and T cells: Correlation with effective immune responses. Eur. J. Immunol. 2007, 37, 686–695. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McLellan, A.D.; Starling, G.C.; Hart, D.N.J. Isolation of human blood dendritic cells by discontinuous Nycodenz gradient centrifugation. J. Immunol. Methods 1995, 184, 81–89. [Google Scholar] [CrossRef] [Scilit]
- Li, M.; Li, Y.; Sun, L. CD83 is required for the induction of protective immunity by a DNA vaccine in a teleost model. Dev. Comp. Immunol. 2015, 51, 141–147. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bassity, E.; Clark, T. Functional Identification of Dendritic Cells in the Teleost Model, Rainbow Trout (Oncorhynchus mykiss). PLoS One 2012, 7, 33196. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pazhakh, V.; Clark, S.; Keightley, M.C.; Lieschke, G.J. A GCSFR/CSF3R zebrafish mutant models the persistent basal neutrophil deficiency of severe congenital neutropenia. Sci. Rep. 2017, 7, 44455. [Google Scholar] [CrossRef] [Scilit]
- Glimcher, L.H.; Kara, C.J. Sequences and factors: A guide to MHC class-II transcription. Annu. Rev. Immunol. 1992, 10, 13–49. [Google Scholar] [CrossRef]
- Cresswell, P. Assembly, transport, and function of MHC class II molecules. Annu. Rev. Immunol. 1994, 12, 259–293. [Google Scholar] [CrossRef]
- Parrish, H.L.; Deshpande, N.R.; Vasic, J.; Kuhns, M.S. Functional evidence for TCR-intrinsic specificity for MHCII. Proc. Natl. Acad. Sci. USA 2016, 113, 3000–3005. [Google Scholar] [CrossRef] [Scilit]
- Nathan, C.; Nathan, C. Neutrophils and immunity: Challenges and opportunities. Nat. Rev. Immunol. 2006, 6, 173–182. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Magarinos, B. Vibrisosis: Vibrio Anguillarum, V.ordalii and Aliivibrio Salmonicida. In Fish Viruses and Bacteria: Pathobiology and Protection; CABI: London, UK, 2017. [Google Scholar] [CrossRef] [Scilit]
- Wang, H.; Guo, M.; Tang, X.; Xing, J.; Sheng, X.; Chi, H.; Zhan, W. Immune adjuvant effects of interferon-gamma (IFN-γ) of flounder (Paralichthys olivaceus) against Edwardsiella tarda. Dev. Comp. Immunol. 2021, 123, 104159. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wei, X.; Li, C.; Zhang, Y.; Li, K.; Li, J.; Ai, K.; Li, K.; Zhang, J.; Yang, J. Fish NF-κB couples TCR and IL-17 signals to regulate ancestral T-cell immune response against bacterial infection. FASEB J. 2021, 35, 21457. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tian, H.; Xing, J.; Tang, X.; Chi, H.; Sheng, X.; Zhan, W. Identification and Characterization of a Master Transcription Factor of Th1 Cells, T-bet, Within Flounder (Paralichthys olivaceus). Front Immunol. 2021, 12, 704324. [Google Scholar] [CrossRef] [Scilit]
- Tian, H.; Xing, J.; Tang, X.; Chi, H.; Sheng, X.; Zhan, W. Cluster of differentiation antigens: Essential roles in the identification of teleost fish T lymphocytes. Mar. Life Sci. Tech. 2022, 12, 303–316. [Google Scholar] [CrossRef] [Scilit]
- Chi, H.; Zhang, Z.; Inami, M.; Bøgwald, J.; Zhan, W.; Dalmo, R.A. Molecular characterizations and functional assessments of GATA-3 and its splice variant in Atlantic cod (Gadus morhua L.). Dev. Comp. Immunol. 2012, 36, 491–501. [Google Scholar] [CrossRef] [Scilit]
- Wang, T.; Holland, J.W.; Martin, S.A.M.; Secombes, C.J. Sequence and expression analysis of two T helper master transcription factors, T-bet and GATA3, in rainbow trout Oncorhynchus mykiss and analysis of their expression during bacterial and parasitic infection. Fish Shellfish Immunol. 2010, 29, 705–715. [Google Scholar] [CrossRef] [Scilit]
- Guo, M.; Tang, X.; Sheng, X.; Xing, J.; Zhan, W. The Immune Adjuvant Effects of Flounder (Paralichthys olivaceus) Interleukin-6 on E. tarda Subunit Vaccine OmpV. Int. J. Mol. Sci. 2017, 18, 1445. [Google Scholar] [CrossRef] [Scilit]
- Guo, M.; Tang, X.; Sheng, X.; Xing, J.; Zhan, W. The effects of IL-1β, IL-8, G-CSF and TNF-α as molecular adjuvant on the immune response to an E. tarda subunit vaccine in flounder (Paralichthys olivaceus). Fish Shellfish Immunol. 2018, 77, 374–384. [Google Scholar] [CrossRef] [Scilit]






| Gene | Primer Sequence (5′-3′) | Accession Number |
|---|---|---|
| 18sRNA | F: GGTCTGTGATGCCCTTAGATGTC R: AGTGGGGTTCAGCGGGTTAC | EF126037 |
| β-actin | F: GAGGGAAATCGTTCGTGACAT R: ATTGCCGATGGTGATGACCTG | AF135499.1 |
| CD4-1 | F: CCAGTGGTCCCCACCTAAAA R: CACTTCTGGGACGGTGAGATG | AB643634 |
| CD4-2 | F: CACAGCGAGGACGTCAGAAA R: TCTCTCCCATCACTCCTTTAGCA | AB640684 |
| IgM | F: AAGTCCACAAATTACCCTCCAA R: TTCTCGCTTTTATGTTCCTCAG | AB052744 |
| CD83 | F: CCCAACGGCACGACGACATAC R: CCCAAAGGTGCTGCCAGGTGA | KR998303.1 |
| G-CSFR | F: ACCTCCCCACCCAGTACACC R: AGTTCATTCACCGCCTTCACAT | 109626803 |
| MHCII | F: GACGGTGAAGAGATGTGGTT R: ATCGGACTGGAGGGAGGC | AY99753 |
| CCL19 | F: GACATCAGCACAGGTTCCCA R: GGATGGTGGCGTCGATAGAG | AB937788.1 |
| CCL4 | F: ATGCTGGCTGCCATTACTGT R: CATGTAGCCGACCACCTTGT | AB937786.1 |
| TNF-α | F: TCCTGGCGTTTTCTTGGT R: TGGCTCTGCTGCTGATTT | AB040448.1 |
| IL6 | F: CAAAGGTTGGCTGAAGGC R: TGGAAAGTGCTGGGGTTG | DQ267937.1 |
| IFN-γ | F: TGGTCTGTCTGTCCCTGTG R: GCTTCCCGTTGAATCTGT | AB435093.1 |
| Gata3 | F: CAGGAGGACAAAGAGTGCATAAAGT R: GAAGATGACCCACCTATCAGGCTAC | XM_020108979.1 |
| T-bet | F: GCCGACATCAGCAGTCACCT R: TGTGCGTAAAACCTGCCG | KR822591.1 |
| RORα | F: CCTTACTGCTCCTTCACCAACG R: GGCGAACTCCACCACATACTG | XM_020079419.1 |
| IL17A | F: CCTGGATGTGACTCCTTGTTGG R: GACGCTCTGGTAGATGGGAACT | XM_020111881.1 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shi, X.; Chi, H.; Sun, Y.; Tang, X.; Xing, J.; Sheng, X.; Zhan, W. The Early Peritoneal Cavity Immune Response to Vibrio Anguillarum Infection and to Inactivated Bacterium in Olive Flounder (Paralichthys olivaceus). Microorganisms 2022, 10, 2175. https://doi.org/10.3390/microorganisms10112175
Shi X, Chi H, Sun Y, Tang X, Xing J, Sheng X, Zhan W. The Early Peritoneal Cavity Immune Response to Vibrio Anguillarum Infection and to Inactivated Bacterium in Olive Flounder (Paralichthys olivaceus). Microorganisms. 2022; 10(11):2175. https://doi.org/10.3390/microorganisms10112175
Chicago/Turabian StyleShi, Xueyan, Heng Chi, Yuanyuan Sun, Xiaoqian Tang, Jing Xing, Xiuzhen Sheng, and Wenbin Zhan. 2022. "The Early Peritoneal Cavity Immune Response to Vibrio Anguillarum Infection and to Inactivated Bacterium in Olive Flounder (Paralichthys olivaceus)" Microorganisms 10, no. 11: 2175. https://doi.org/10.3390/microorganisms10112175
APA StyleShi, X., Chi, H., Sun, Y., Tang, X., Xing, J., Sheng, X., & Zhan, W. (2022). The Early Peritoneal Cavity Immune Response to Vibrio Anguillarum Infection and to Inactivated Bacterium in Olive Flounder (Paralichthys olivaceus). Microorganisms, 10(11), 2175. https://doi.org/10.3390/microorganisms10112175

