OxyR Positively Influences Phaseolotoxin Synthesis and Pyoverdin Production in Pseudomonas savastanoi pv. phaseolicola NPS3121
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacterial Strains, Media, and Growth Conditions
2.2. Molecular Biology Techniques
2.3. Construction of the P. savastanoi pv. phaseolicola NPS3121 oxyR- Mutant Strain and oxyR- Complemented Mutant (oxyR- C)
2.4. Bacterial Growth Curves of the P. savastanoi pv. phaseolicola NPS3121 Strains
2.5. Bacterial Growth Conditions and RNA Isolation
2.6. Analysis of Expression by Reverse Transcriptase (RT)-PCR Assays
2.7. Phaseolotoxin Bioassays
2.8. Pathogenicity and Virulence Assays in Bean Pods
2.9. Quantification of Siderophores
3. Results
3.1. OxyR Positively Influences on the Growth Rate of P. savastanoi pv. phaseolicola NPS3121
3.2. The Virulence of P. savastanoi pv. phaseolicola NPS3121 Is Influenced by the OxyR Global Regulator
3.3. OxyR Positively Influences the Expression of Genes Involved in the Phaseolotoxin Synthesis
3.4. In P. savastanoi pv. phaseolicola NPS3121, the Pyoverdine Synthesis Is Also a Member of the OxyR Regulon
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Department of Crop Science. Bacterial Diseases of Beans; Report on Plant Disease; Department of Crop Science: Urbana, IL, USA, 2000. [Google Scholar]
- Schwartz, H.F. Halo blight. In Bean Production Problems in the Tropics, 2nd ed.; Schwartz, H.F., Pastor-Corrales., M., Eds.; CIAT: Cali, Colombia, 1989; pp. 285–293. ISBN 958-9183-04-2. [Google Scholar]
- Agrios, G.E. Plant Pathology, 5th ed.; Academic Press: Burlington, MA, USA, 2005. [Google Scholar]
- Bender, C.L.; Alarcón-Chaidez, F.; Gross, D.C. Pseudomonas syringae Phytotoxins: Mode of Action, Regulation, and Biosynthesis by Peptide and Polyketide Synthetases. Microbiol. Mol. Biol. Rev. 1999, 63, 266–292. [Google Scholar] [CrossRef] [PubMed]
- Mitchell, R.E. Isolation and Structure of a Chlorosis-Inducing Toxin of Pseudomonas phaseolicola. Phytochemistry 1976, 15, 1941–1947. [Google Scholar] [CrossRef]
- Mitchell, R.E.; Bieleski, R.L. Involvement of Phaseolotoxin in Halo Blight of Beans. Plant Physiol. 1977, 60, 723–729. [Google Scholar] [CrossRef] [PubMed]
- Ferguson, A.R.; Johnston, J.S. Phaseolotoxin: Chlorosis, Ornithine Accumulation and Inhibition of Ornithine Carbamoyltransferase in Different Plants. Physiol. Plant Pathol. 1980, 16, 269–275. [Google Scholar] [CrossRef]
- Smith, A.G.; Rubery, P.H. Investigation of the Mechanism of Action of a Chlorosis-Inducing Toxin Produced by Pseudomonas phaseolicola. Plant Physiol. 1982, 70, 932–938. [Google Scholar] [CrossRef]
- Mitchell, R.E. Bean Halo-Blight Toxin. Nature 1976, 260, 75–76. [Google Scholar] [CrossRef]
- Goss, R.W. The relation of temperature to common and halo blight of beans. Phytopathology 1970, 30, 258–264. [Google Scholar]
- Nüske, J.; Fritsche, W. Phaseolotoxin Production By Pseudomonas syringae pv. phaseolicola: The Influence of Temperature. J. Basic Microbiol. 1989, 29, 441–447. [Google Scholar] [CrossRef]
- Aguilera, S.; López-López, K.; Nieto, Y.; Garciduenas-Pina, R.; Hernández-Guzmán, G.; Hernández-Flores, J.L.; Murillo, J.; Alvarez-Morales, A. Functional Characterization of the Gene Cluster from Pseudomonas syringae pv. Phaseolicola NPS3121 Involved in Synthesis of Phaseolotoxin. J. Bacteriol. 2007, 189, 2834–2843. [Google Scholar] [CrossRef]
- Genka, H.; Baba, T.; Tsuda, M.; Kanaya, S.; Mori, H.; Yoshida, T.; Noguchi, M.T.; Tsuchiya, K.; Sawada, H. Comparative Analysis of ArgK-Tox Clusters and Their Flanking Regions in Phaseolotoxin-Producing Pseudomonas syringae Pathovars. J. Mol. Evol. 2006, 63, 401–414. [Google Scholar] [CrossRef]
- Sawada, H.; Kanaya, S.; Tsuda, M.; Suzuki, F.; Azegami, K.; Saitou, N. A Phylogenomic Study of the OCTase Genes in Pseudomonas syringae Pathovars: The Horizontal Transfer of the ArgKTox Cluster and the Evolutionary History of OCTase Genes on Their Genomes. J. Mol. Evol. 2002, 54, 437–457. [Google Scholar] [CrossRef] [PubMed]
- Guardado-Valdivia, L.; Chacón-López, A.; Murillo, J.; Poveda, J.; Hernández-Flores, J.L.; Xoca-Orozco, L.; Aguilera, S. The Pbo Cluster from Pseudomonas syringae pv. Phaseolicola NPS3121 Is Thermoregulated and Required for Phaseolotoxin Biosynthesis. Toxins 2021, 13, 628. [Google Scholar] [CrossRef] [PubMed]
- Aguilera, S.; De la Torre-Zavala, S.; Hernández-Flores, J.L.; Murillo, J.; Bravo, J.; Alvarez-Morales, A. Expression of the Gene for Resistance to Phaseolotoxin (ArgK) Depends on the Activity of Genes PhtABC in Pseudomonas syringae pv. Phaseolicola. PLoS ONE 2012, 7, e46815. [Google Scholar] [CrossRef] [PubMed]
- Aguilera, S.; Alvarez-Morales, A.; Murillo, J.; Hernández-Flores, J.L.; Bravo, J.; De la Torre-Zavala, S. Temperature-Mediated Biosynthesis of the Phytotoxin Phaseolotoxin by Pseudomonas syringae pv. Phaseolicola Depends on the Autoregulated Expression of the PhtABC Genes. PLoS ONE 2017, 12, e0178441. [Google Scholar] [CrossRef]
- González-Villanueva, L.; Arvizu-Gómez, J.L.; Hernández-Morales, A.; Aguilera-Aguirre, S.; Álvarez-Morales, A. The PhtL Protein of Pseudomonas syringae pv. Phaseolicola NPS3121 Affects the Expression of Both Phaseolotoxin Cluster (Pht) and Non-Pht Encoded Genes. Microbiol. Res. 2014, 169, 221–231. [Google Scholar] [CrossRef]
- Arvizu-Gómez, J.L.; Hernández-Morales, A.; Pastor-Palacios, G.; Brieba, L.G.; Álvarez-Morales, A. Integration Host Factor (IHF) Binds to the Promoter Region of the PhtD Operon Involved in Phaseolotoxin Synthesis in P. Syringae pv. Phaseolicola NPS3121. BMC Microbiol. 2011, 11, 11–90. [Google Scholar] [CrossRef]
- De la Torre-Zavala, S.; Aguilera, S.; Ibarra-Laclette, E.; Hernandez-Flores, J.L.; Hernández-Morales, A.; Murillo, J.; Álvarez-Morales, A. Gene Expression of Pht Cluster Genes and a Putative Non-Ribosomal Peptide Synthetase Required for Phaseolotoxin Production Is Regulated by GacS/GacA in Pseudomonas syringae pv. Phaseolicola. Res. Microbiol. 2011, 162, 488–498. [Google Scholar] [CrossRef]
- Álvarez-Morales, A.; Hernández-Morales, A.; Arvizu-Gómez, J.L. A 14–20 KDa Protein Binds to the Upstream Region of the PhtM Operon Involved in the Synthesis of Phaseolotoxin in Pseudomonas syringae pv. Phaseolicola NPS3121. Rev. Argent. De Microbiol. 2018, 50, 115–125. [Google Scholar] [CrossRef]
- Arvizu-Gómez, J.L.; Hernández-Morales, A.; Aguilar, J.R.P.; Álvarez-Morales, A. Transcriptional Profile of P. Syringae pv. Phaseolicola NPS3121 at Low Temperature: Physiology of Phytopathogenic Bacteria. BMC Microbiol. 2013, 13, 81. [Google Scholar] [CrossRef]
- Hernández-Morales, A.; Rojas-Morales, J.A.; Reynoso-López, M.; Martínez-Rizo, A.B.; Velázquez-Fernández, J.B.; Arvizu-Gómez, J.L. Oxidative Stress Regulates the Expression of the Pht Cluster Genes Involved in Phaseolotoxin Synthesis in Pseudomonas syringae pv. Phaseolicola NPS3121. J. Gen. Plant Pathol. 2018, 84, 137–141. [Google Scholar] [CrossRef]
- Chiang, S.M.; Schellhorn, H.E. Regulators of Oxidative Stress Response Genes in Escherichia coli and Their Functional Conservation in Bacteria. Arch. Biochem. Biophys. 2012, 525, 161–169. [Google Scholar] [CrossRef] [PubMed]
- Demple, B. Regulation of Bacterial Oxidative Stress Genes. Annu. Rev. Genet. 1991, 25, 315–337. [Google Scholar] [CrossRef] [PubMed]
- Imlay, J.A. Cellular Defenses against Superoxide and Hydrogen Peroxide. Annu. Rev. Biochem. 2008, 77, 755–776. [Google Scholar] [CrossRef] [PubMed]
- Teramoto, H.; Inui, M.; Yukawa, H. OxyR Acts as a Transcriptional Repressor of Hydrogen Peroxide-Inducible Antioxidant Genes in Corynebacterium glutamicum R. FEBS J. 2013, 280, 3298–3312. [Google Scholar] [CrossRef]
- Harrison, A.; Ray, W.C.; Baker, B.D.; Armbruster, D.W.; Bakaletz, L.O.; Munson, R.S. The OxyR Regulon in Nontypeable Haemophilus influenzae. J. Bacteriol. 2007, 189, 1004–1012. [Google Scholar] [CrossRef][Green Version]
- Wei, Q.; Le Minh, P.N.; Dötsch, A.; Hildebrand, F.; Panmanee, W.; Elfarash, A.; Schulz, S.; Plaisance, S.; Charlier, D.; Hassett, D.; et al. Global Regulation of Gene Expression by OxyR in an Important Human Opportunistic Pathogen. Nucleic Acids Res. 2012, 40, 4320–4333. [Google Scholar] [CrossRef]
- Dubbs, J.M.; Mongkolsuk, S. Peroxide-Sensing Transcriptional Regulators in Bacteria. J. Bacteriol. 2012, 194, 5495–5503. [Google Scholar] [CrossRef]
- Ishiga, Y.; Ichinose, Y. Pseudomonas syringae pv. tomato OxyR Is Required for Virulence in Tomato and Arabidopsis. Mol. Plant-Microbe Interact. 2016, 29, 119–131. [Google Scholar] [CrossRef][Green Version]
- Burbank, L.; Roper, M.C. OxyR and SoxR Modulate the Inducible Oxidative Stress Response and Are Implicated during Different Stages of Infection for the Bacterial Phytopathogen Pantoea Stewartii Subsp. Stewartii. Mol. Plant-Microbe Interact. 2014, 27, 479–490. [Google Scholar] [CrossRef]
- Flores-Cruz, Z.; Allen, C. Necessity of OxyR for the Hydrogen Peroxide Stress Response and Full Virulence in Ralstonia solanacearum. Appl. Environ. Microbiol. 2011, 77, 6426–6432. [Google Scholar] [CrossRef]
- Peet, R.C.; Lindgren, P.B.; Willis, D.K.; Panopoulos, N.J. Identification and Cloning of Genes Involved in Phaseolotoxin Production by Pseudomonas syringae pv. “Phaseolicola”. J. Bacteriol. 1986, 166, 1096–1105. [Google Scholar] [CrossRef] [PubMed]
- Yanisch-Perron, C.; Vieira, J.; Messing, J. Improved M13 Phage Cloning Vectors and Host Strains: Nucleotide Sequences of the M13mpl8 and PUC19 Vectors. Gene 1985, 33, 103–119. [Google Scholar] [CrossRef]
- Chen, W.; Kuo, T. A Simple and Rapid Method for the Preparation of Gram-Negative Bacterial Genomic DNA. Nucleic Acids Res. 1993, 21, 2260. [Google Scholar] [CrossRef] [PubMed]
- Sambrook, J.; Fritsch, E.F.; Maniatis, T. This Is a Free Sample of Content from Molecular Cloning: A Laboratory Manual, 2nd ed.; Cold Spring Harbor: New York, NY, USA, 1989. [Google Scholar]
- Joardar, V.; Lindeberg, M.; Jackson, R.W.; Selengut, J.; Dodson, R.; Brinkac, L.M.; Daugherty, S.C.; DeBoy, R.; Durkin, A.S.; Giglio, M.G.; et al. Whole-Genome Sequence Analysis of Pseudomonas syringae pv. Phaseolicola 1448A Reveals Divergence among Pathovars in Genes Involved in Virulence and Transposition. J. Bacteriol. 2005, 187, 6488–6498. [Google Scholar] [CrossRef]
- Lane, D.J. 16S/23S rRNA sequencing. In Nucleic Acid Techniques in Bacterial Systematics; Stackebrandt, E., Goodfellow, M., Eds.; John Wiley & Sons, Inc.: New York, NY, USA, 1991; pp. 115–176. [Google Scholar]
- Windgassen, M.; Urban, A.; Jaeger, K.J. Rapid Gene Inactivation in Pseudomonas aeruginosa. FEMS Microbiol. Lett. 2000, 193, 201–205. [Google Scholar] [CrossRef]
- Kovach, M.E.; Elzer, P.H.; Hill, D.S.; Robertson, G.T.; Farris, M.A.; Roop, R.M., II; Peterson, K.M. Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene 1995, 166, 175–176. [Google Scholar] [CrossRef]
- Staskawicz, B.J.; Panopoulos, N.J. A rapid and sensitive assay for phaseolotoxin. Phytopathology 1979, 69, 663–666. [Google Scholar] [CrossRef]
- Hernández-Guzmán, G.; Alvarez-Morales, A. Isolation and Characterization of the Gene Coding for the Amidinotransferase Involved in the Biosynthesis of Phaseolotoxin in Pseudomonas syringae pv. phaseolicola. Mol. Plant-Microbe Interact. 2001, 14, 545–554. [Google Scholar] [CrossRef]
- Cheng, G.Y.; Legard, D.E.; Hunter, J.E.; Burr, T.J. Modified Bean Pod Assay to Detect Strains of Pseudomonas syringae pv. syringae that Cause Bacterial Brown Spot of Snap Bean. Plant Dis. 1989, 73, 419–423. [Google Scholar] [CrossRef]
- Meyer, J.M.; Abdallah, M.A. The Fluorescent pigment of Pseudomonas fluorescens: Biosynthesis, purifications and Physicochemical properties. J. Gen. Microbiol. 1978, 107, 319–328. [Google Scholar] [CrossRef]
- Michel-Briand, Y.; Baysse, C. The pyocins of Pseudomonas aeruginosa. Biochimie 2002, 84, 499–510. [Google Scholar] [CrossRef] [PubMed]
- Arvizu-Gómez, J.L. Image that Demonstrates the Integration of the Suicide Plasmid pCR4-TOPO::oxyR Disrupted in the Interest Chromosomal Region oxyR in the P. savastanoi pv. phaseolicola NPS3121 Validated by PCR Assays; Secretaría de Investigación y Posgrado, Centro Nayarita de Innovación y Transferencia de Tecnología, Universidad Autónoma de Nayarit: Tepic, Mexico, Material Not Intented for Publicaction.
- O’Malley, M.R.; Anderson, J.C. Regulation of the Pseudomonas syringae Type III Secretion System by Host Environment Signals. Microorganisms 2021, 9, 1227. [Google Scholar] [CrossRef]
- Ott, C.M.; Day, D.F.; Koenig, D.W.; Pierson, D.L. The release of alginate lyase from growing Pseudomonas syringae pathovar phaseolicola. Curr. Microbiol. 2001, 42, 78–81. [Google Scholar] [CrossRef] [PubMed]
- González-Flecha, B.; Demple, B. Transcriptional regulation of the Escherichia coli oxyR gene as a function of cell growth. J. Bacteriol. 1997, 179, 6181–6186. [Google Scholar] [CrossRef]
- Schalk, I.J.; Rigouin, C.; Godet, J. An Overview of Siderophore Biosynthesis among Fluorescent Pseudomonads and New Insights into Their Complex Cellular Organization. Environ. Microbiol. 2020, 22, 1447–1466. [Google Scholar] [CrossRef]
- Kang, D.; Revtovich, A.V.; Chen, Q.; Shah, K.N.; Cannon, C.L.; Kirienko, N.V. Pyoverdine-Dependent Virulence of Pseudomonas aeruginosa Isolates From Cystic Fibrosis Patients. Front. Microbiol. 2019, 10, 2048. [Google Scholar] [CrossRef]
- Wilson, M.J.; McMorran, B.J.; Lamont, I.L. Analysis of Promoters Recognized by PvdS, an Extracytoplasmic-Function Sigma Factor Protein from Pseudomonas Aeruginosa. J. Bacteriol. 2001, 183, 2151–2155. [Google Scholar] [CrossRef]
- Chung, C.-H.; Fen, S.; Yu, S.-C.; Wong, H. Influence of OxyR on Growth, Biofilm Formation, and Mobility of Vibrio parahaemolyticus. Appl. Environ. Microbiol. 2016, 82, 788–796. [Google Scholar] [CrossRef]
- Wan, F.; Yin, J.; Sun, W.; Gao, H. Oxidized OxyR Up-Regulates AhpCF Expression to Suppress Plating Defects of OxyR- and Catalase-Deficient Strains. Front. Microbiol. 2019, 10, 439. [Google Scholar] [CrossRef]
- Young, J.M.; Luketina, R.C.; Marshall, A.M. The Effects on Temperature on Growth in Vitro of Pseudomonas syringae and Xanthomonas pruni. J. Appl. Bacteriol. 1977, 42, 345–354. [Google Scholar] [CrossRef]
- Ieva, R.; Roncarati, D.; Metruccio, M.M.E.; Seib, K.L.; Scarlato, V.; Delany, I. OxyR Tightly Regulates Catalase Expression in Neisseria Meningitidis through Both Repression and Activation Mechanisms. Mol. Microbiol. 2008, 70, 1152–1165. [Google Scholar] [CrossRef]
- Taguchi, F.; Suzuki, T.; Inagaki, Y.; Toyoda, K.; Shiraishi, T.; Ichinose, Y. The siderophore pyoverdine of Pseudomonas syringae pv. tabaci 6605 is an intrinsic virulence factor in host tobacco infection. J. Bacteriol. 2010, 92, 117–126. [Google Scholar] [CrossRef]
- Owen, J.G.; Ackerley, D.F. Characterization of pyoverdine and achromobactin in Pseudomonas syringae pv. phaseolicola 1448a. BMC Microbiol. 2011, 11, 218. [Google Scholar] [CrossRef]
- Storz, G.; Tartaglia, L.A.; Ames, B.N. The OxyR Regulon. Antonie Van Leeuwenhoek 1990, 58, 157–161. [Google Scholar] [CrossRef]




| Gene/Primers | Sequence (5´-3´) | Reference |
|---|---|---|
| Pht Cluster | ||
| argK | ||
| L10001 | CTTTGATGGTATGCATGCGGTT | [12] |
| L10002 | GGAAGAACTGGCCAAACATTCG | |
| phtA | ||
| phtA fw | ATACTTTCCCTGTTTCCGGA | [23] |
| phtA rv | TAAACAGTGGTCAGCTTGTC | |
| desI | ||
| P16881 | TCAACAACATCCACGGGCAT | [12] |
| G720 | GATATCGCAGCAACACCCATAAAAC | |
| phtL | ||
| phtL fw | CTGGATGCATCTGTCGGAAT | [23] |
| phtL rv | GCCAGCAATGCATCGCTATG | |
| amtA | ||
| BRL519 | TTCATTCAAACCTCGCCCGTGTG | [12] |
| BRL520 | TGAAAGGAGCCGCCGAAACTATTG | |
| Pbo Cluster | ||
| pboO | ||
| S126d | GCCGTTGTGATAGCCGACAGTGA | [15] |
| S127c | AACGCCAGCGCTTCATCCTTGT | |
| pboL | ||
| S136d | CCACGCTGGACAACATGGTGATC | [15] |
| S137c | CATACTTTCTGGCCGCTACCCATTC | |
| pboA | ||
| S134d | GCAAATTGCCAGTTGCGTTGCC | [15] |
| S135c | CCTTTCGGTGTACCGGTAGAACCAG | |
| pboJ | ||
| S132d | TCTGTTCTGCAGCCTCAACGTGG | [15] |
| S133c | TGAGCTGGACAAATTCAATGGAGTGA | |
| Pyoverdine | ||
| pvdS | ||
| L100277-1909D | GACTCACCATTACTCCAGGC | [22] |
| L100278-1909R | AGACGGTACATCTCGAACGC | |
| Control | ||
| 16S ribosomal | ||
| 27f-1775 | AGAGTTTGATCMTGGCTCAG | [39] |
| 1492R-1776 | TACGGYTACCTTGTTACGACTT | |
| Construction of oxyR-mutant | ||
| OxyR-FWD | AGCAGGCTCAAGGTATTCGT | This study |
| OxyR-REV | GAAGCGACCATGTGCCGAAT | This study |
| Construction of oxyR- complemented mutant (oxyR- C) | ||
| pOxyR250-SmaI | CCCGGGACTCGATTGCCAACAGTTCAGG | This study |
| OxyRRev-BamHI | GGATCCCTAACTTGCGACTGTTTTCGGA | This study |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Arvizu-Gómez, J.L.; Hernández-Morales, A.; Juárez-Navarro, R.A.; Paredes-Tadeo, J.D.; Campos-Guillén, J.; Pacheco-Aguilar, J.R.; Martínez-Rizo, A.B.; González-Reyes, C. OxyR Positively Influences Phaseolotoxin Synthesis and Pyoverdin Production in Pseudomonas savastanoi pv. phaseolicola NPS3121. Microorganisms 2022, 10, 2123. https://doi.org/10.3390/microorganisms10112123
Arvizu-Gómez JL, Hernández-Morales A, Juárez-Navarro RA, Paredes-Tadeo JD, Campos-Guillén J, Pacheco-Aguilar JR, Martínez-Rizo AB, González-Reyes C. OxyR Positively Influences Phaseolotoxin Synthesis and Pyoverdin Production in Pseudomonas savastanoi pv. phaseolicola NPS3121. Microorganisms. 2022; 10(11):2123. https://doi.org/10.3390/microorganisms10112123
Chicago/Turabian StyleArvizu-Gómez, Jackeline Lizzeta, Alejandro Hernández-Morales, Rafael Arnulfo Juárez-Navarro, Juan Diego Paredes-Tadeo, Juan Campos-Guillén, Juan Ramiro Pacheco-Aguilar, Abril Bernardette Martínez-Rizo, and Christian González-Reyes. 2022. "OxyR Positively Influences Phaseolotoxin Synthesis and Pyoverdin Production in Pseudomonas savastanoi pv. phaseolicola NPS3121" Microorganisms 10, no. 11: 2123. https://doi.org/10.3390/microorganisms10112123
APA StyleArvizu-Gómez, J. L., Hernández-Morales, A., Juárez-Navarro, R. A., Paredes-Tadeo, J. D., Campos-Guillén, J., Pacheco-Aguilar, J. R., Martínez-Rizo, A. B., & González-Reyes, C. (2022). OxyR Positively Influences Phaseolotoxin Synthesis and Pyoverdin Production in Pseudomonas savastanoi pv. phaseolicola NPS3121. Microorganisms, 10(11), 2123. https://doi.org/10.3390/microorganisms10112123

