CgSCD1 Is Essential for Melanin Biosynthesis and Pathogenicity of Colletotrichum gloeosporioides
Abstract
:1. Introduction
2. Results
2.1. Cloning of the Scytalone Dehydratase Gene from C. gloeosporioides
2.2. Generation of the △Cgscd1 Mutant and Complementation
2.3. Characterization of ΔCgscd1 and Cgscd1com
2.4. In Vitro Scytalone Release from ΔCgscd1 is Able to Restore Sclerotia Melanization in ΔBcpks12
2.5. Analysis of ΔCgscd1 Mutant Virulence
2.6. Loss of Partial Appressorium Function due to Deletion of the CgSCD1 Gene
2.7. Localization of the CgSCD1 Protein
3. Discussion
4. Materials and Methods
4.1. Fungal Strains and Culture Conditions
4.2. Nucleotide Sequencing and Sequence Analysis
4.3. Fungal Transformation
4.4. Disruption of the CgSCD1 Gene and Verification
4.5. Complementation and Cyan Fluorescent Protein (CFP) Fusion Constructs
4.6. Growth and Appressorial Formation Assay
4.7. Pathogenicity Assay
4.8. Detection of In Vitro Scytalone Release from ΔCgscd1
4.9. Turgor Pressures Assay of Appressoria and Nile Red Stain
4.10. Gene Expression Analysis by qPCR
4.11. Subcellular Localization Analysis
4.12. Statistical Analysis
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Perfect, S.E.; Hughes, H.B.; O’Connell, R.J.; Green, J.R. Colletotrichum: A model genus for studies on pathology and fungal-plant interactions. Fungal Genet. Biol. 1999, 27, 186–198. [Google Scholar] [CrossRef] [PubMed]
- O’Connell, R.J.; Thon, M.R.; Hacquard, S.; Amyotte, S.G.; Kleemann, J.; Torres, M.F.; Damm, U.; Buiate, E.A.; Epstein, L.; Alkan, N.; et al. Lifestyle transitions in plant pathogenic Colletotrichum fungi deciphered by genome and transcriptome analyses. Nat. Genet. 2012, 44, 1060–1065. [Google Scholar] [CrossRef] [PubMed]
- Henson, J.M.; Butler, M.J.; Day, A.W. The dark side of the mycelium: Melanins of Phytopathogenic Fungi. Annu. Rev. Phytopathol. 1999, 37, 447–471. [Google Scholar] [CrossRef] [PubMed]
- Gao, Q.; Garcia-Pichel, F. Microbial ultraviolet sunscreens. Nat. Rev. Microbiol. 2011, 9, 791–802. [Google Scholar] [CrossRef]
- Gessler, N.; Egorova, A.; Belozerskaya, T. Melanin Pigments of Fungi under Extreme Environmental Conditions (Review). Appl. Biochem. Microbiol. 2014, 50, 125–134. [Google Scholar] [CrossRef]
- Eisenman, H.C.; Casadevall, A. Synthesis and assembly of fungal melanin. Appl. Microbiol. Biotechnol. 2012, 93, 931–940. [Google Scholar] [CrossRef] [Green Version]
- Damm, U.; Cannon, P.F.; Liu, F.; Barreto, R.W.; Guatimosim, E.; Crous, P.W. The Colletotrichum orbiculare species complex: Important pathogens of field crops and weeds. Fungal Divers. 2013, 61, 29–59. [Google Scholar] [CrossRef]
- Tsuji, G.; Sugahara, T.; Fujii, I.; Mori, Y.; Ebizuka, Y.; Shiraishi, T.; Kubo, Y. Evidence for involvement of two naphthol reductases in the first reduction step of melanin biosynthesis pathway of Colletotrichum lagenarium. Mycol. Res. 2003, 107, 854–860. [Google Scholar] [CrossRef]
- Takano, Y.; Kubo, Y.; Shimizu, K.; Mise, K.; Okuno, T.; Furusawa, I. Structural analysis of PKS1, a polyketide synthase gene involved in melanin biosynthesis in Colletotrichum lagenarium. Mol. Gen. Genet. 1995, 249, 162–167. [Google Scholar] [CrossRef]
- Perpetua, N.S.; Kubo, Y.; Yasuda, N.; Takano, Y.; Furusawa, I. Cloning and characterization of a melanin biosynthetic THR1 reductase gene essential for appressorial penetration of Colletotrichum lagenarium. Mol. Plant-Microbe Interact. 1996, 9, 323–329. [Google Scholar] [CrossRef]
- Kubo, Y.; Takano, Y.; Endo, N.; Yasuda, N.; Tajima, S.; Furusawa, I. Cloning and structural analysis of the melanin biosynthesis gene SCD1 encoding scytalone dehydratase in Colletotrichum lagenarium. Appl. Environ. Microbiol. 1996, 62, 4340–4344. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tsuji, G.; Kenmochi, Y.; Takano, Y.; Sweigard, J.; Farrall, L.; Furusawa, I.; Horino, O.; Kubo, Y. Novel fungal transcriptional activators, Cmr1p of Colletotrichum lagenarium and pig1p of Magnaporthe grisea, contain Cys2His2 zinc finger and Zn(II)2Cys6 binuclear cluster DNA-binding motifs and regulate transcription of melanin biosynthesis genes in a developmentally specific manner. Mol. Microbiol. 2000, 38, 940–954. [Google Scholar] [PubMed]
- Woo, P.; Tam, E.; Chong, K.; Cai, J.; Tung, E.; Ngan, A.; Lau, S.; Yuen, K. High diversity of polyketide synthase genes and the melanin biosynthesis gene cluster in Penicillium marneffei. FEBS J. 2010, 277, 3750–3758. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Engh, I.; Nowrousian, M.; Kück, U. Regulation of melanin biosynthesis via the dihydroxynaphthalene pathway is dependent on sexual development in the ascomycete Sordaria macrospora. FEMS Microbiol. Lett. 2007, 275, 62–70. [Google Scholar] [CrossRef] [Green Version]
- Howard, R.; Valent, B. Breaking and entering: Host penetration by the fungal rice blast pathogen Magnaporthe grisea. Annu. Rev. Microbiol. 1996, 50, 491–512. [Google Scholar] [CrossRef]
- Chumley, F.; Valent, B. Genetic Analysis of Melanin-Deficient, Nonpathogenic Mutants of Magnaporthe grisea. Mol. Plant-Microbe Interact. 1990, 3, 135–143. [Google Scholar] [CrossRef]
- Howard, R.; Ferrari, M. Role of melanin in appressorium function. Experimental Mycology 1990, 14, 195–196. [Google Scholar] [CrossRef]
- Jong, J.; McCormack, B.; Smirnoff, N.; Talbot, N. Glycerol generates turgor in rice blast. Nature 1997, 389, 244–245. [Google Scholar] [CrossRef]
- Chen, Z.; Nunes, M.; Silva, M.; Rodrigues, C. Appressorium turgor pressure of Colletotrichum kahawae might have a role in coffee cuticle penetration. Mycologia 2004, 96, 1199–1208. [Google Scholar] [CrossRef]
- Ludwig, N.; Löhrer, M.; Hempel, M.; Mathea, S.; Schliebner, I.; Menzel, M. Melanin is not required for turgor generation but enhances cell-wall rigidity in appressoria of the corn pathogen Colletotrichum graminicola. Mol. Plant-Microbe Interact. 2014, 27, 315–327. [Google Scholar] [CrossRef] [Green Version]
- Chang, H.; Miller, L.; Hartman, G. Melanin-independent accumulation of turgor pressure in appressoria of Phakopsora pachyrhizi. Phytopathology 2014, 104, 977–984. [Google Scholar] [CrossRef] [PubMed]
- Wang, T.; Xiang, S.; Ren, D.; Zhu, P.; Xu, L. First Report of Colletotrichum gloeosporioides Causing Postharvest Fruit Rot on Citrus aurantifolia in China. Plant Dis. 2019, 103, 2686. [Google Scholar] [CrossRef]
- Jordan, D.; Basarab, G.; Steffens, J.; Lundqvist, T.; Pfrogner, B.; Schwartz, R.; Wawrzak, Z. Catalytic mechanism of scytalone dehydratase from Magnaporthe grisea. Pestic. Sci. 1999, 55, 277–280. [Google Scholar] [CrossRef]
- Basarab, G.; Steffens, J.; Wawrzak, Z.; Schwartz, R.; Lundqvist, T.; Jordan, D. Catalytic mechanism of scytalone dehydratase: Site-directed mutagenisis, kinetic isotope effects, and alternate substrates. Biochemistry 1999, 38, 6012–6024. [Google Scholar] [CrossRef]
- Kubo, Y.; Suzuki, K.; Furusawa, I.; Yamamoto, M. Scytalone as a natural intermediate of melanin biosynthesis in appressoria of Colletotrichum lagenarium. Exp. Mycol. 1983, 7, 208–215. [Google Scholar] [CrossRef]
- Schumacher, J. DHN melanin biosynthesis in the plant pathogenic fungus Botrytis cinerea is based on two developmentally regulated key enzyme (PKS)-encoding genes. Mol. Microbiol. 2016, 99, 729–748. [Google Scholar] [CrossRef] [Green Version]
- Zhu, P.; Li, Q.; Zhang, C.; Na, Y.; Xu, L. Bcpks12 gene inactivation substantiates biological functions of sclerotium melanization in Botrytis cinerea. Physiol. Mol. Plant Pathol. 2017, 98, 80–84. [Google Scholar] [CrossRef]
- Howard, R.; Ferrari, M.; Roach, D.; Money, N. Penetration of hard substrates by a fungus employing enormous turgor pressures. Proc. Natl. Acad. Sci. USA 1991, 88, 11281–11284. [Google Scholar] [CrossRef] [Green Version]
- Kihara, J.; Moriwaki, A.; Ueno, M.; Tokunaga, T.; Arase, S.; Honda, Y. Cloning, functional analysis and expression of a scytalone dehydratase gene (SCD1) involved in melanin biosynthesis of the phytopathogenic fungus Bipolaris oryzae. Curr. Genet. 2004, 45, 197–204. [Google Scholar] [CrossRef]
- Dubey, A.; Barad, S.; Luria, N.; Kumar, D.; Espeso, E.; Prusky, D. Cation-Stress-Responsive Transcription Factors SltA and CrzA Regulate Morphogenetic Processes and Pathogenicity of Colletotrichum gloeosporioides. PLoS ONE 2016, 11, e0168561. [Google Scholar] [CrossRef] [Green Version]
- Chung, K.; Shilts, T.; Li, W.; Timmer, L. Engineering a genetic transformation system for Colletotrichum acutatum, the causal fungus of lime anthracnose and postbloom fruit drop of citrus. FEMS Microbiol. Lett. 2002, 213, 33–39. [Google Scholar] [CrossRef] [PubMed]
- Kars, I.; McCalman, M.; Wagemakers, L.; Kan, J. Functional analysis of Botrytis cinerea pectin methylesterase genes by PCR-based targeted mutagenesis: Bcpme1 and Bcpme2 are dispensable for virulence of strain B05.10. Mol. Plant Pathol. 2005, 6, 641–652. [Google Scholar] [CrossRef] [PubMed]
- Zhang, A.; Lu, P.; Dahl-Roshak, A.; Paress, P.; Kennedy, S.; Tkacz, J.; An, Z. Efficient disruption of a polyketide synthase gene (pks1) required for melanin synthesis through Agrobacterium-mediated transformation of Glarea lozoyensis. Mol. Genet. Genom. 2003, 268, 645–655. [Google Scholar] [CrossRef] [PubMed]
- Mullins, E.; Chen, X.; Romaine, P.; Raina, R.; Geiser, D.; Kang, S. Agrobacterium-Mediated Transformation of Fusarium oxysporum: An Efficient Tool for Insertional Mutagenesis and Gene Transfer. Phytopathology 2001, 91, 173–180. [Google Scholar] [CrossRef] [Green Version]
- Eloy, Y.; Vasconcelos, I.; Barreto, A.; Freire-Filho, F.; Oliveria, J. H2O2 plays an important role in the lifestyle of Colletotrichum gloeosporioides during interaction with cowpea [Vigna unguiculata (L.) Walp.]. Fungal Biol. 2015, 119, 747–757. [Google Scholar] [CrossRef] [Green Version]
- He, P.; Wang, Y.; Wang, X.; Zhang, X.; Tian, C. The mitogen-activated protein kinase CgMK1 governs appressorium formation, melanin synthesis, and plant infection of Colletotrichum gloeosporioides. Front. Microbiol. 2017, 8, 2216. [Google Scholar] [CrossRef]
- Money, N. Turgor pressure and the mechanics of fungal penetration. Can. J. Bot. 1995, 73, 96–102. [Google Scholar] [CrossRef]
Title | Description |
---|---|
Strains | |
WT | Wild-type strain EX2016-02 |
ΔCgscd1 | A knockout mutant of CgSCD1 gene, NrsR |
Cgscd1com | Ectopic complementation mutant from ΔCgscd1 NrsR,HygR |
Agl1 | The strain used for Agrobacterium-mediated transformation |
Plasmids | |
pNR2 | Contains nourseothricin resistance sequence |
pflu6 | Contains cyan fluorescent protein sequence |
pAg1-H3 | Agrobacterium-mediated transformation |
pAg1-H3-scd1-com | Contains CgSCD1 for complementation along with the CFP sequence |
Oligonucleotides | Sequence 5′→3′ |
---|---|
1F | GTCCAGATTTTCACTTCATCACG |
2R | GCCCGAATCGGGAATGCGGCTCTAGTATGTCTACTTTTCGAAATTACT |
3F | TGATTACTAACAGATATCAAGCTTAATATGTAATCTGGGCACGGAA |
4R | TTCTCTCATCTTATTCCTTGTT |
F | ATGGCGTCCCCTGCTGGCAACA |
R | TTAGTGAGCCACCGCAGACTT |
conF | GATCGTCACGAGGCACTCTGGG |
conR | GCTCAAGACAGTGAGAAGGAAG |
N-F | CTAGAGCCGCATTCCCGATTCGGGC |
N-R | AAGCTTGATATCTGTTAGTAATCA |
H-F | ATGAAAAAGCCTGAACTCACCG |
H-R | TTCCTTTGCCCTCGGACGAGTG |
pAg-comF | CGACGGCCAGTGAATTCGAGCTGTCCAGATTTTCACTTCATCACG |
pAg-comR | GAACTTGTTGGACAGGGCCATGTGAGCCACCGCAGACTTGAG |
CFP-F | CTCAAGTCTGCGGTGGCTCACATGGCCCTGTCCAACAAGTTC |
CFP-R | CCCGGGCCTTGGTACCGAGCTGAGGCAGATTTTTGTGGTCGG |
Qpcr-F | GAAGGTCTCCGATACGGAGGTC |
Qpcr-R | CCTTGACATCGTTCTTCTCGTCC |
Actin-F | AGCGGAAAGCCTCGCAGT |
Actin-R | TGTCGTTACCATCTCGACCCA |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, T.; Ren, D.; Guo, H.; Chen, X.; Zhu, P.; Nie, H.; Xu, L. CgSCD1 Is Essential for Melanin Biosynthesis and Pathogenicity of Colletotrichum gloeosporioides. Pathogens 2020, 9, 141. https://doi.org/10.3390/pathogens9020141
Wang T, Ren D, Guo H, Chen X, Zhu P, Nie H, Xu L. CgSCD1 Is Essential for Melanin Biosynthesis and Pathogenicity of Colletotrichum gloeosporioides. Pathogens. 2020; 9(2):141. https://doi.org/10.3390/pathogens9020141
Chicago/Turabian StyleWang, Tan, Dandan Ren, Han Guo, Xue Chen, Pinkuan Zhu, Haozhen Nie, and Ling Xu. 2020. "CgSCD1 Is Essential for Melanin Biosynthesis and Pathogenicity of Colletotrichum gloeosporioides" Pathogens 9, no. 2: 141. https://doi.org/10.3390/pathogens9020141