Characterisation of the Major Extracellular Proteases of Stenotrophomonas maltophilia and Their Effects on Pulmonary Antiproteases
Abstract
1. Introduction
2. Results
2.1. Optimal Conditions for K279a Extracellular Protease Production
2.2. The Major Secreted Extracellular Protease of K279a Exhibits Serine Protease Activity
2.3. Screening K279a for Extracellular Serine Proteases
2.4. Identification of the Major Secreted Proteases by Mass Spectrometry
2.5. Incomplete Attenuation of Protease Activity in a K279a StmPR1 Mutant
2.6. AAT, SLPI and Elafin Are Degraded in the Presence of K279a Culture Supernatant
2.7. The Anti-NE Capacity of AAT, But Not SLPI or Elafin, Is Lost Due to K279a Proteases
3. Discussion
4. Conclusions
5. Materials and Methods
5.1. Bacterial Growth and Reparation of K279a Culture Supernatant
5.2. Protease Activity Studies
5.3. PCR
5.4. Gelatin Zymography
5.5. Polyacrylamide Gel Electrophoresis and Western Immunoblotting
5.6. In-gel Digestion
5.7. LC-MS/MS Analysis
5.8. Protein Identification and Peptidomic Data Analysis
5.9. Construction of K279a StmPR1 Knock-Out
5.10. Neutrophil Elastase Inhibition Studies
5.11. Statistical Analysis
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Guyot, N.; Bergsson, G.; Butler, M.W.; Greene, C.M.; Weldon, S.; Kessler, E.; Levine, R.L.; O’Neill, S.J.; Taggart, C.C.; McElvaney, N.G. Functional study of elafin cleaved by Pseudomonas aeruginosa metalloproteinases. Boil. Chem. 2010, 391, 705–716. [Google Scholar] [CrossRef] [PubMed]
- Kida, Y. Roles of Pseudomonas aeruginosa-derived proteases as a virulence factor. Nihon Saikingaku Zasshi 2013, 68, 313–323. [Google Scholar] [CrossRef] [PubMed]
- Wettlaufer, J.; Klingel, M.; Yau, Y.; Stanojevic, S.; Tullis, E.; Ratjen, F.; Waters, V. Longitudinal study of Stenotrophomonas maltophilia antibody levels and outcomes in cystic fibrosis patients. J. Cyst. Fibros. 2017, 16, 58–63. [Google Scholar] [CrossRef] [PubMed]
- Waters, V.; Yau, Y.; Prasad, S.; Lu, A.; Atenafu, E.; Crandall, I.; Tom, S.; Tullis, E.; Ratjen, F. Stenotrophomonas maltophilia in cystic fibrosis: Serologic response and effect on lung disease. Am. J. Respir. Crit. Care Med. 2011, 183, 635–640. [Google Scholar] [CrossRef]
- Waters, V.; Atenafu, E.G.; Lu, A.; Yau, Y.; Tullis, E.; Ratjen, F. Chronic Stenotrophomonas maltophilia infection and mortality or lung transplantation in cystic fibrosis patients. J. Cyst. Fibros. 2013, 12, 482–486. [Google Scholar] [CrossRef]
- Windhorst, S. The Major Extracellular Protease of the Nosocomial Pathogen Stenotrophomonas maltophilia CHARACTERIZATION OF THE PROTEIN AND MOLECULAR CLONING OF THE GENE. J. Boil. Chem. 2002, 277, 11042–11049. [Google Scholar] [CrossRef]
- Dumont, A.L.; Karaba, S.M.; Cianciotto, N.P. Type II Secretion-Dependent Degradative and Cytotoxic Activities Mediated by Stenotrophomonas maltophilia Serine Proteases StmPr1 and StmPr2. Infect. Immun. 2015, 83, 3825–3837. [Google Scholar] [CrossRef]
- Dumont, A.L.; Cianciotto, N.P. Stenotrophomonas maltophilia Serine Protease StmPr1 Induces Matrilysis, Anoikis, and Protease-Activated Receptor 2 Activation in Human Lung Epithelial Cells. Infect. Immun. 2017, 85, e00544-17. [Google Scholar] [CrossRef] [PubMed]
- Nicoletti, M.; Iacobino, A.; Prosseda, G.; Fiscarelli, E.V.; Zarrilli, R.; De Carolis, E.; Petrucca, A.; Nencioni, L.; Colonna, B.; Casalino, M. Stenotrophomonas maltophilia strains from cystic fibrosis patients: Genomic variability and molecular characterization of some virulence determinants. Int. J. Med Microbiol. 2011, 301, 34–43. [Google Scholar] [CrossRef]
- Crossman, L.C.; Gould, V.C.; Dow, J.M.; Vernikos, G.S.; Okazaki, A.; Sebaihia, M.; Saunders, D.; Arrowsmith, C.; Carver, T.; Peters, N.; et al. The complete genome, comparative and functional analysis of Stenotrophomonas maltophilia reveals an organism heavily shielded by drug resistance determinants. Genome Boil. 2008, 9, R74. [Google Scholar] [CrossRef]
- Ribitsch, D.; Heumann, S.; Karl, W.; Gerlach, J.; Leber, R.; Birner-Gruenberger, R.; Gruber, K.; Eiteljoerg, I.; Remler, P.; Siegert, P.; et al. Extracellular serine proteases from Stenotrophomonas maltophilia: Screening, isolation and heterologous expression in E. coli. J. Biotechnol. 2012, 157, 140–147. [Google Scholar] [CrossRef] [PubMed]
- Karaba, S.M.; White, R.C.; Cianciotto, N.P. Stenotrophomonas maltophilia Encodes a Type II Protein Secretion System That Promotes Detrimental Effects on Lung Epithelial Cells. Infect. Immun. 2013, 81, 3210–3219. [Google Scholar] [CrossRef] [PubMed]
- Mori, M.; Kitagawa, T.; Sasaki, Y.; Yamamoto, K.; Onaka, T.; Yonezawa, A.; Imada, K. Lethal Pulmonary Hemorrhage Caused by Stenotrophomonas maltophilia Pneumonia in a Patient with Acute Myeloid Leukemia. Kansenshogaku Zasshi 2012, 86, 300–305. [Google Scholar] [CrossRef] [PubMed]
- Kelly, E.; Greene, C.M.; McElvaney, N.G. Targeting neutrophil elastase in cystic fibrosis. Expert Opin. Ther. Targets 2008, 12, 145–157. [Google Scholar] [CrossRef] [PubMed]
- Greene, C.M.; McElvaney, N.G. Proteases and antiproteases in chronic neutrophilic lung disease-relevance to drug discovery. Br. J. Pharmacol. 2009, 158, 1048–1058. [Google Scholar] [CrossRef] [PubMed]
- Lantz, M.S. Are bacterial proteases important virulence factors? J. Periodontal Res. 1997, 32, 126–132. [Google Scholar] [CrossRef]
- Schmidtchen, A.; Frick, I.-M.; Andersson, E.; Tapper, H.; Björck, L. Proteinases of common pathogenic bacteria degrade and inactivate the antibacterial peptide LL-37. Mol. Microbiol. 2002, 46, 157–168. [Google Scholar] [CrossRef]
- Kuang, Z.; Hao, Y.; Walling, B.E.; Jeffries, J.L.; Ohman, D.E.; Lau, G.W. Pseudomonas aeruginosa Elastase Provides an Escape from Phagocytosis by Degrading the Pulmonary Surfactant Protein-A. PLoS ONE 2011, 6, e27091. [Google Scholar] [CrossRef] [PubMed]
- Jacquot, J.; Tournier, J.M.; Puchelle, E. In vitro evidence that human airway lysozyme is cleaved and inactivated by Pseudomonas aeruginosa elastase and not by human leukocyte elastase. Infect. Immun. 1985, 47, 555–560. [Google Scholar]
- Morihara, K.; Tsuzuki, H.; Harada, M.; Iwata, T. Purification of human plasma alpha 1-proteinase inhibitor and its inactivation by Pseudomonas aeruginosa elastase. J. Biochem. 1984, 95, 795–804. [Google Scholar] [CrossRef]
- Johnson, D.A.; Carter-Hamm, B.; Dralle, W.M. Inactivation of human bronchial mucosal proteinase inhibitor by Pseudomonas aeruginosa elastase. Am. Rev. Respir. Dis. 1982, 126, 1070–1073. [Google Scholar] [PubMed]
- Johnson, D.A.; Barrett, A.J.; Mason, R.W. Cathepsin L inactivates alpha 1-proteinase inhibitor by cleavage in the reactive site region. J. Biol. Chem. 1986, 261, 14748–14751. [Google Scholar] [PubMed]
- Thompson, R.C.; Ohlsson, K. Isolation, properties, and complete amino acid sequence of human secretory leukocyte protease inhibitor, a potent inhibitor of leukocyte elastase. Proc. Natl. Acad. Sci. USA 1986, 83, 6692–6696. [Google Scholar] [CrossRef] [PubMed]
- Hiemstra, P.S.; Maassen, R.J.; Stolk, J.; Heinzel-Wieland, R.; Steffens, G.J.; Dijkman, J.H. Antibacterial activity of antileukoprotease. Infect. Immun. 1996, 64, 4520–4524. [Google Scholar] [PubMed]
- Wiedow, O.; Harder, J.; Bartels, J.; Streit, V.; Christophers, E. Antileukoprotease in Human Skin: An Antibiotic Peptide Constitutively Produced by Keratinocytes. Biochem. Biophys. Res. Commun. 1998, 248, 904–909. [Google Scholar] [CrossRef] [PubMed]
- Kazmi, S.H.; Naglik, J.R.; Sweet, S.P.; Evans, R.W.; O’Shea, S.; Banatvala, J.E.; Challacombe, S.J. Comparison of Human Immunodeficiency Virus Type 1-Specific Inhibitory Activities in Saliva and Other Human Mucosal Fluids. Clin. Vaccine Immunol. 2006, 13, 1111–1118. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Jin, F.-Y.; Nathan, C.; Radzioch, D.; Ding, A. Secretory Leukocyte Protease Inhibitor: A Macrophage Product Induced by and Antagonistic to Bacterial Lipopolysaccharide. Cell 1997, 88, 417–426. [Google Scholar] [CrossRef]
- Lentsch, A.B.; Jordan, J.A.; Czermak, B.J.; Diehl, K.M.; Younkin, E.M.; Sarma, V.; Ward, P.A. Inhibition of NF-kappaB activation and augmentation of IkappaBbeta by secretory leukocyte protease inhibitor during lung inflammation. Am. J. Pathol. 1999, 154, 239–247. [Google Scholar] [CrossRef]
- Taggart, C.C.; Lowe, G.J.; Greene, C.M.; Mulgrew, A.T.; O’Neill, S.J.; Levine, R.L.; McElvaney, N.G. Cathepsin B, L, and S Cleave and Inactivate Secretory Leucoprotease Inhibitor. J. Boil. Chem. 2001, 276, 33345–33352. [Google Scholar] [CrossRef] [PubMed]
- McMichael, J.W.; Roghanian, A.; Jiang, L.; Ramage, R.; Sallenave, J.-M. The Antimicrobial Antiproteinase Elafin Binds to Lipopolysaccharide and Modulates Macrophage Responses. Am. J. Respir. Cell Mol. Boil. 2005, 32, 443–452. [Google Scholar] [CrossRef]
- Shaw, L.; Wiedow, O. Therapeutic potential of human elafin. Biochem. Soc. Trans. 2011, 39, 1450–1454. [Google Scholar] [CrossRef] [PubMed]
- Vachon, E.; Bourbonnais, Y.; Bingle, C.; Rowe, S.J.; Janelle, M.F.; Tremblay, G.M.; Bingle, C. Anti-Inflammatory Effect of Pre-Elafin in Lipopolysaccharide-Induced Acute Lung Inflammation. Boil. Chem. 2002, 383, 1249–1256. [Google Scholar] [CrossRef] [PubMed]
- Baranger, K.; Zani, M.-L.; Chandenier, J.; Moreau, T.; Dallet-Choisy, S.; Dallet-Choisy, S.; Dallet-Choisy, S. The antibacterial and antifungal properties of trappin-2 (pre-elafin) do not depend on its protease inhibitory function. FEBS J. 2008, 275, 2008–2020. [Google Scholar] [CrossRef] [PubMed]
- Tang, W.; Lu, Y.; Tian, Q.-Y.; Zhang, Y.; Guo, F.-J.; Liu, G.-Y.; Syed, N.M.; Lai, Y.; Lin, E.A.; Kong, L.; et al. The Growth Factor Progranulin Binds to TNF Receptors and Is Therapeutic Against Inflammatory Arthritis in Mice. Science 2011, 332, 478–484. [Google Scholar] [CrossRef] [PubMed]
- Guyot, N.; Butler, M.W.; McNally, P.; Weldon, S.; Greene, C.M.; Levine, R.L.; O’Neill, S.J.; Taggart, C.C.; McElvaney, N.G. Elafin, an Elastase-specific Inhibitor, Is Cleaved by Its Cognate Enzyme Neutrophil Elastase in Sputum from Individuals with Cystic Fibrosis. J. Boil. Chem. 2008, 283, 32377–32385. [Google Scholar] [CrossRef] [PubMed]
- Van Sambeek, L.; Cowley, E.S.; Newman, D.K.; Kato, R. Sputum glucose and glycemic control in cystic fibrosis-related diabetes: A cross-sectional study. PLoS ONE 2015, 10, e0119938-37. [Google Scholar] [CrossRef] [PubMed]
- Baker, E.H.; Clark, N.; Brennan, A.L.; Fisher, D.A.; Gyi, K.M.; Hodson, M.E.; Philips, B.J.; Baines, D.L.; Wood, D.M. Hyperglycemia and cystic fibrosis alter respiratory fluid glucose concentrations estimated by breath condensate analysis. J. Appl. Physiol. 2007, 102, 1969–1975. [Google Scholar] [CrossRef]
- Minkwitz, A.; Berg, G. Comparison of Antifungal Activities and 16S Ribosomal DNA Sequences of Clinical and Environmental Isolates of Stenotrophomonas maltophilia. J. Clin. Microbiol. 2001, 39, 139–145. [Google Scholar] [CrossRef]
- Witko-Sarsat, V.; Halbwachs-Mecarelli, L.; Schuster, A.; Nusbaum, P.; Ueki, I.; Canteloup, S.; Lenoir, G.; Descamps-Latscha, B.; Nadel, J.A. Proteinase 3, a Potent Secretagogue in Airways, Is Present in Cystic Fibrosis Sputum. Am. J. Respir. Cell Mol. Boil. 1999, 20, 729–736. [Google Scholar] [CrossRef]
- Goldstein, W.; Döring, G. Lysosomal enzymes from polymorphonuclear leukocytes and proteinase inhibitors in patients with cystic fibrosis. Am. Rev. Respir. Dis. 1986, 134, 49–56. [Google Scholar]
- Ratjen, F.; Hartog, C.-M.; Paul, K.; Wermelt, J.; Braun, J. Matrix metalloproteases in BAL fluid of patients with cystic fibrosis and their modulation by treatment with dornase alpha. Thorax 2002, 57, 930–934. [Google Scholar] [CrossRef] [PubMed]
- Bergin, D.A.; Greene, C.M.; Sterchi, E.E.; Kenna, C.; Geraghty, P.; Belaaouaj, A.; Taggart, C.C.; O’Neill, S.J.; McElvaney, N.G. Activation of the Epidermal Growth Factor Receptor (EGFR) by a Novel Metalloprotease Pathway. J. Boil. Chem. 2008, 283, 31736–31744. [Google Scholar] [CrossRef] [PubMed]
- Cox, J.; Mann, M. MaxQuant enables high peptide identification rates, individualized p.p.b.-range mass accuracies and proteome-wide protein quantification. Nat. Biotechnol. 2008, 26, 1367–1372. [Google Scholar] [CrossRef] [PubMed]
- Tyanova, S.; Temu, T.; Cox, J. The MaxQuant computational platform for mass spectrometry-based shotgun proteomics. Nat. Protoc. 2016, 11, 2301–2319. [Google Scholar] [CrossRef] [PubMed]
- Cox, J.; Neuhauser, N.; Michalski, A.; Scheltema, R.A.; Olsen, J.; Mann, M. Andromeda: A Peptide Search Engine Integrated into the MaxQuant Environment. J. Proteome Res. 2011, 10, 1794–1805. [Google Scholar] [CrossRef]
- Cox, J.; Hein, M.Y.; Luber, C.A.; Paron, I.; Nagaraj, N.; Mann, M. Accurate Proteome-wide Label-free Quantification by Delayed Normalization and Maximal Peptide Ratio Extraction, Termed MaxLFQ. Mol. Cell. Proteom. 2014, 13, 2513–2526. [Google Scholar] [CrossRef]
- Tyanova, S.; Temu, T.; Sinitcyn, P.; Carlson, A.; Hein, M.Y.; Geiger, T.; Mann, M.; Cox, J. The Perseus computational platform for comprehensive analysis of (prote)omics data. Nat. Methods 2016, 13, 731–740. [Google Scholar] [CrossRef]
- Hoang, T.T.; Karkhoff-Schweizer, R.R.; Kutchma, A.J.; Schweizer, H.P. A broad-host-range Flp-FRT recombination system for site-specific excision of chromosomally-located DNA sequences: Application for isolation of unmarked Pseudomonas aeruginosa mutants. Gene 1998, 212, 77–86. [Google Scholar] [CrossRef]
- Martíne, P.; Huedo, P.; Martinez-Servat, S.; Planell, R.; Ferrer-Navarro, M.; Daura, X.; Yero, D.; Gibert, I. Stenotrophomonas maltophilia responds to exogenous AHL signals through the LuxR solo SmoR (Smlt1839). Front. Cell. Infect. Microbiol. 2015, 5, 41. [Google Scholar]
- Korkmaz, B.; Attucci, S.; Juliano, M.A.; Kalupov, T.; Jourdan, M.-L.; Juliano, L.; Gauthier, F. Measuring elastase, proteinase 3 and cathepsin G activities at the surface of human neutrophils with fluorescence resonance energy transfer substrates. Nat. Protoc. 2008, 3, 991–1000. [Google Scholar] [CrossRef]










| StmPR1 | StmPR2 | StmPR3 | ExSP | |
|---|---|---|---|---|
| UniProt ID | B2FNH2 | B2FQ06 | B2FLH5 | B2FI22 |
| Gene | Smlt0686 | expR | Smlt4395 | Smlt4145 |
| Length (AA) | 630 | 580 | 588 | 1,118 |
| Predicted MW | 63,605 Da | 58,291 Da | 61,297 Da | 116,012 Da |
| Predicted PI | 6.47 | 6.22 | 9.14 | 6.15 |
| MEROPS family | S8 (subtilisin) | S8 (subtilisin) | S8 (subtilisin) | S8 (subtilisin) |
| Spectral Count | % Coverage | MW (Da) | |
|---|---|---|---|
| StmPR1 | 15 | 37.3 | 63,605 |
| StmPR2 | 2 | 8 | 58,291 |
| StmPR3 | 16 | 38.1 | 61,297 |
| Chitinase | 1 | 1.7 | 72,939 |
| Esterase | 11 | 27 | 64,199 |
| Primer | Description | Sequence (5’–3’) | Length (bp) | GC (%) | Tm (°C) | Product (bp) |
|---|---|---|---|---|---|---|
| 16s rRNA-F | 16s ribosomal RNA | CAGCTCGTGTCGTGAGATGT | 20 | 55 | 54 | 193 |
| 16s rRNA-R | AGCCCTCTGTCCCTACCATT | 20 | 55 | 54 | ||
| FtsH-F | ATP dependent metalloproteinase | GTGGCAACGAGAAGGAAGTC | 20 | 55 | 54 | 179 |
| FtsH-R | CTTGTAGACCGGGTCATGCT | 20 | 55 | 54 | ||
| StmPR1-F | StmPR1 protease | CAACGACTCGATGAATGTGG | 20 | 50 | 52 | 174 |
| StmPR1-R | CAGACATAGCCGTTCGGATT | 20 | 50 | 52 | ||
| StmPR2-F | StmPR2 protease | CAGGTCGAGAGCATCATCAA | 20 | 50 | 52 | 168 |
| StmPR2-R | GGTCACCGGTACGTTGTTCT | 20 | 55 | 54 | ||
| StmPR3-F | StmPR3 protease | AGCGAAAACACGATTCGTTC | 20 | 45 | 50 | 189 |
| StmPR3-R | ACGGTGATGACGTTGAACAG | 20 | 50 | 52 | ||
| ZnMMP-F | Zinc metalloproteinase | CGGTCGGTGTAGAAGTTGGT | 20 | 55 | 54 | 175 |
| ZnMMP-R | ACTACGCCGCTTACATGGAC | 20 | 55 | 54 | ||
| Esterase-F | Esterase | TTAGAAGGTGCCGCTGAAGT | 20 | 50 | 52 | 152 |
| Esterase-R | GCCTGAAGTTCGACAAGGAC | 20 | 55 | 54 | ||
| ExSP-For | Extracellular serine protease | TGGTGAAACCGACTACGTGA | 20 | 50 | 52 | 181 |
| ExSP-Rev | GTACGTGGGATTCTGGCTGT | 20 | 55 | 54 | ||
| Str1-For | StmPR1 gene cloning | GTCGAGCTCGTGATCAAGAAGCAGAAC | 27 | 52 | 62 | |
| Str1-Rev | CAGTCTAGATTACTGCGTGGCGAGAATG | 28 | 52 | 58 | ||
| Str1Inv-5’ | StmPR1 gene deletion (inverse PCR) | CTAGGATCCGTACGGATCGTTGGGCAC | 27 | 59 | 57 | |
| Str1Inv-3’ | ATAGGATCCGCGCCACATGTGGCTGCC | 27 | 63 | 63 | ||
| PErm5′ | Erythromycin cassette | GACGGATCCGAAACGTAAAAGAAGTTATG | 29 | 41 | 59 | |
| PErm3′ | GTCGGATCCTACAAATTCCCCGTAGGC | 27 | 56 | 64 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Molloy, K.; Smith, S.G.; Cagney, G.; Dillon, E.T.; Greene, C.M.; McElvaney, N.G. Characterisation of the Major Extracellular Proteases of Stenotrophomonas maltophilia and Their Effects on Pulmonary Antiproteases. Pathogens 2019, 8, 92. https://doi.org/10.3390/pathogens8030092
Molloy K, Smith SG, Cagney G, Dillon ET, Greene CM, McElvaney NG. Characterisation of the Major Extracellular Proteases of Stenotrophomonas maltophilia and Their Effects on Pulmonary Antiproteases. Pathogens. 2019; 8(3):92. https://doi.org/10.3390/pathogens8030092
Chicago/Turabian StyleMolloy, Kevin, Stephen G. Smith, Gerard Cagney, Eugene T. Dillon, Catherine M. Greene, and Noel G. McElvaney. 2019. "Characterisation of the Major Extracellular Proteases of Stenotrophomonas maltophilia and Their Effects on Pulmonary Antiproteases" Pathogens 8, no. 3: 92. https://doi.org/10.3390/pathogens8030092
APA StyleMolloy, K., Smith, S. G., Cagney, G., Dillon, E. T., Greene, C. M., & McElvaney, N. G. (2019). Characterisation of the Major Extracellular Proteases of Stenotrophomonas maltophilia and Their Effects on Pulmonary Antiproteases. Pathogens, 8(3), 92. https://doi.org/10.3390/pathogens8030092

