Next Article in Journal
Characterization and Protective Activity of Monoclonal Antibodies Directed against Streptococcus suis Serotype 2 Capsular Polysaccharide Obtained Using a Glycoconjugate
Previous Article in Journal
Insights into the HIV Latency and the Role of Cytokines
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Molecular Detection of Spotted-Fever Group Rickettsiae in Ticks Collected from Domestic and Wild Animals in Corsica, France

by
Vincent Cicculli
1,
Oscar Maestrini
2,
Francois Casabianca
2,
Natacha Villechenaud
1,
Remi Charrel
3,
Xavier de Lamballerie
3 and
Alessandra Falchi
1,*
1
Laboratoire de Virologie, Université de Corse-Inserm, 20250 EA7310 Corte, France
2
Laboratoire de Recherches sur le Développement de l’Elevage (Research Laboratory for the Development of Livestock), 20250 UR045 Corte, France
3
Unité des Virus Emergents (UVE: Aix Marseille Université, IRD 190, Inserm 1207, IHU Méditerranée Infection), 13000 Marseille, France
*
Author to whom correspondence should be addressed.
Pathogens 2019, 8(3), 138; https://doi.org/10.3390/pathogens8030138
Submission received: 12 July 2019 / Revised: 16 August 2019 / Accepted: 30 August 2019 / Published: 4 September 2019
(This article belongs to the Section Animal Pathogens)

Abstract

:
To obtain a better understanding of the current magnitude of tick-borne rickettsioses in Corsica, we used molecular methods to characterize the occurrence of Rickettsia spp. in ixodid ticks collected from domestic and wild animals. The presence of Rickettsia spp. was evaluated using real-time polymerase chain reaction targeting the gltA gene and by sequencing of gltA and ompA partial genes for species identification and phylogenetic analysis. Infection rates were calculated as the maximum-likelihood estimation (MLE) with 95% confidence intervals (CI). In total, 1117 ticks belonging to four genera (Rhipicephalus, Hyalomma, Ixodes, and Dermacentor) were collected from cattle, sheep, wild boars, and companion animals during July–August 2017 and July 2018–January 2019. Overall, Rickettsia DNA was detected in 208 of 349 pools of ticks (MLE = 25.6%, 95% CI: 22.6–28.8%). The molecular analysis revealed five different rickettsial species of the spotted-fever group (SFG). We highlighted the exclusive detection of Candidatus Ri. barbariae in R. bursa and of Ri. aeschlimanii in H. marginatum. Rickettsia slovaca was detected in D. marginatus collected from wild boars. This study provides the first evidence of the presence of Ri. monacensis in I. ricinus ticks isolated from a dog in Corsica. In conclusion, our data revealed wide dispersal of SFG Rickettsiae and their arthropod hosts in Corsica, highlighting the need for surveillance of the risk of infection for people living and/or working close to infected or infested animals.

1. Introduction

Rickettsiae are obligate intracellular Gram-negative bacteria that are transmitted to vertebrate hosts by arthropod vectors such as ticks, fleas, lice, and mites. The genus Rickettsia (family Rickettsiaceae; order Rickettsiales) comprises 31 species that cause diseases in vertebrate hosts, including humans and domestic and wild animals [1]. Ticks can transmit these bacteria to humans and animals by feeding. Members of the genus Rickettsia can be classified into four phylogenetic groups: (1) the spotted-fever group (SFG), (2) the typhus group (TG), which includes the agents of epidemic typhus and murine typhus, (3) the ancestral group (AG), consisting of Ri. bellii and Ri. canadensis, and (4) the transitional group, the Ri. akari group (TRG) [2]. The SFG and AG Rickettsiae are mainly associated with ticks, while TG and TRG Rickettsiae are associated with other arthropods such as lice, fleas, and mites [3].
Rickettsia spp. and their associated human clinical diseases vary depending on geographical location [4]. In Europe, rickettsioses are caused mainly by tick-borne SFG Rickettsiae [4]. In the Mediterranean area, Rickettsiae species have been detected in several tick species, but human rickettsioses are usually considered to be caused by Ri. conorii, the causative agent of Mediterranean spotted fever (MSF) [1,5]. Rickettsia aeschlimanii, Ri. massiliae, and Ri. monacensis can also cause a similar clinical presentation. Other species that have been associated with human disease and detected in Europe include Ri. slovaca and Ri. raoultii, both causes of tick-borne lymphadenopathy and Dermacentor-borne necrosis lymphadenopathy (TIBOLA/DEBONEL) [6,7].
Information about the circulation and distribution of Rickettsia-infected tick species in Corsica, a French Mediterranean island, is scarce and fragmented. Rickettsia aeschlimanii and Candidatus Ri. barbariae were identified in Hyalomma marginatum and Rhipicephalus bursa collected from domestic animals in 2016 [8]. Rickettsia slovaca has been detected in ticks collected from vegetation. Rickettsia massiliae was reported from an R. turanicus collected from a dog in Corsica in 2005, and Ri. africae was detected in one Amblyomma variegatum collected from bovine in August 2018.
To obtain a better understanding of the current magnitude of tick-borne rickettsioses in Corsica, we aimed to use molecular methods to describe the presence of tick-borne Rickettsiae in tick species collected from domestic and wild animals. From a public health perspective, a better understanding of local tick species and of Rickettsia species carried by them is essential to improve local surveillance systems.

2. Results

2.1. Sampling and Identification of Ticks

In total, 1117 ticks were collected from 1014 animals (381 cattle, 500 sheep, 119 wild boars, 13 dogs, and 1 cat) (Table 1). Of these, 1075 (96% of 1117) were adult ticks and 674 (60% of 1117) were male ticks (Table 1). The sequences of mitochondrial 16S rDNA fragments of 12 ticks selected in this study, were confirmed, after BLAST analysis, to be D. marginatus (n = 5), R. bursa (n = 1), H. marginatum (n = 1), I. ricinus (n = 1), and R. sanguineus s.l. (n = 4).
Overall, 834 ticks were collected from 381 cattle skins, from which, three tick species were morphologically identified. The most abundant species was R. bursa (n = 608; 73.0% of ticks collected in cattle) followed by H. marginatum (n = 216; 25.8%), and I. ricinus (n = 10; 1.2%) (Table 1).
Ten ticks were collected from 500 sheep in one farm (Biguglia, Haute-Corse) in June 2017. All these were R. bursa (Table 1).
Two-hundred forty-five ticks were collected from 119 wild boars from August 2018 to January 2019. Four tick species were identified in wild boars. The most abundant species was D. marginatus (n = 223; 91.0%), followed by I. ricinus (n = 13; 5.3%), R. bursa (n = 8; 3.3%), and H. marginatum (n = 1; 0.4%) (Table 1).
Twenty-seven ticks were collected from 13 dogs from July to August 2017. Two tick species were identified in dogs: Rhipicephalus sanguineus s.l. (n = 24; 88.8%) and I. ricinus (n = 3; 11.2%). One D. marginatus was collected from one cat.

2.2. Infestation Rate in Cattle, Sheep, and Wild Boars

The infestation rate in cattle was 19.2% (27/140) in 2017 (May–August 2017) and 36.0% (87/241) in 2018 (July–December 2018). Overall, the July–August 2018 infestation rate (65.1%; 54/83) was significantly higher than the July–August 2017 infestation rate (46.5%; 40/86) (p = 0.02), with a peak in July 2018 (70.7%; 29/41) (Figure 1a). The observed proportion of H. marginatum was significantly higher in July–August 2018 (53.7%; 116/216) than in July–August 2017 (22.2%; 48/216) (p < 0.0001) (Figure 1). Similarly, the observed proportion of R. bursa was significantly higher in July–August 2018 (45.0%; 208/608) than July–August 2017 (33.0%; 273/608) (p < 0.0001) (Figure 1a). Ixodes ricinus showed its peak activity in September–October 2018 (60.0%; 6/10).
The infestation rate of sheep was 2% and it was not drastically different from the 4% observed in cattle during the same period (May 2017) (p = 0.68).
The infestation rate observed in wild boars was 38.6% (46/119). Dermacentor marginatus was mainly collected from wild boars throughout the surveillance period (August 2018–January 2019), with a peak of activity in December 2018. September 2018 was characterized by the co-circulation of four species of ticks in wild boars (Figure 1b).

2.3. Detection of Rickettsial DNA

Overall, Rickettsia DNA was detected in 208 of 349 pools of ticks collected with an infection rate (maximum-likelihood estimation (MLE)) of 25.6% (95% CI: 22.6–28.8%). In ticks collected from cattle, Rickettsia spp. DNA was detected in 157 of 255 pools, with the highest infection rate for H. marginatum (50.5%, 95% CI: 37.0–64.4%) compared with R. bursa (16.6%, 95% CI: 13.3–20.4%) (p < 0.0001) and I. ricinus (2.7%, 95% CI: 0.1–11.6%) (p < 0.0001) (Table 2).
In sheep, the 10 ticks were analyzed in two pools. The detection rate of Rickettsia spp. DNA for R. bursa was 100%.
In ticks collected from wild boars, Rickettsia spp. DNA was detected in 46 of 78 pools with an infection rate of 24.4% (95% CI: 18.5–31.1%). The highest infection rate was observed for D. marginatus (23.0%, 95% CI: 16.9–30.0%) (Table 3).
The Rickettsia spp. DNA infection rate observed in ticks collected from cattle during July–August months of 2018 (34.7%, 95% CI 28.4–41.6%) was similar to that of 2017 during the same period (26.3%, 95% CI: 22.7–30.1%) (p = 0.219).
Rickettsia spp. DNA was detected in 2 (15.3%) of 13 tick pools collected from dogs. The infection rate was 5.0% (95% CI: 0.8–14.9%). The D. marginatus collected from one cat was also positive for Rickettsia spp. DNA.

2.4. Rickettsia Species Identification Based on Sequence Analysis

The molecular characterization of the Rickettsiae in ticks was based on gltA (n = 91 of 208 positive pools; 43.8%). A subset of positive samples (n = 33) was also characterized by sequencing ompA to confirm Rickettsia spp. (Table 4). The molecular analysis of gltA and ompA sequences revealed five different rickettsial species.
All Rickettsia detected in H. marginatum tick pools (n = 56) collected from cattle and wild boars were exclusively Ri. aeschlimanii (Table 4). Candidatus Ri. barbariae was the only bacterium detected in R. bursa tick pools collected from sheep (n = 2) and from cattle in 2017 (n = 5). The DNA of Ri. aeschlimanii and Candidatus Ri. barbariae were respectively detected in five and eleven R. bursa pools collected from cattle in 2018. The DNA of Ri. slovaca was detected in six D. marginatus tick pools, in two I. ricinus tick pools and in four R. bursa tick pools, all collected from wild boars. It is to be noted that Ri. slovaca DNA was also detected in one D. marginatus tick collected from a cat. Rickettsia massiliae and Ri. monacensis DNA have been detected in one pool of R. sanguineus s.l. ticks and in one pool of I. ricinus ticks collected from dogs.

2.5. Phylogenetic Analysis

The results of phylogenetic trees based on gltA and ompA sequences are illustrated in Figure 2A,B). Cluster I corresponded to Ri. aeschlimanii: the sequences were 100% identical to each other and to the Ri. aeschlimanii sequences deposited in GenBank (KU961540 (Russia) [gltA], MG920564 (Turkey) [ompA]). Cluster II represented the Candidatus Ri. barbariae group. Our sequences were 99–100% identical to each other and to the Candidatus Ri. barbariae detected in Sardinia (EU272185 [gltA] and MF002506 [ompA]). Cluster III represented Ri. slovaca; sequences were 100% identical to each other and showed 99.9% identity with that in GenBank (MF002529 (China) [gltA] and MF379311 (Turkey) [ompA]). Cluster four corresponded to the Ri. monacensis sequences group (100% identical to Ri. monacensis MH18982 (Poland) [gltA] and MG32690 (Italy) [ompA]). Cluster five included Ri. massiliae sequences and displayed 99.8% identity with Ri. massiliae (MH990860 (Pakistan) [gltA] and MH990860 (Pakistan) [ompA]).

3. Discussion

To our knowledge, this is the first reported evidence of the circulation of five bacteria from the genus of Rickettsia in four genera of ticks (Rhipicephalus, Hyalomma, Dermacentor, and Ixodes), collected from wild and domestic animals mainly reared in Northern Corsica.
In the present study, five tick species were collected, namely, R. bursa, H. marginatum, I. ricinus, D. marginatus, and R. sanguineus s.l. Rhipicephalus ticks were the most abundant species collected in this study. The diversity and seasonal pattern of ticks observed in this study, though collected not over 12 months and on selected animals kept under various conditions, is consistent with that reported previously for Corsica [8,9] and other Mediterranean countries [10,11,12]. In this study, overall, the low infestation rate observed in sheep with respect to cattle could be due to the short collection period and to a low density of tick populations usually reported in pastures where livestock had grazed with respect to undisturbed fallow lands [13].
In the present study, R. bursa was the tick species most frequently collected in cattle and sheep, with a peak of activity observed in the summer. This typical Mediterranean species is well established in the whole of Corsica [8,9]. In this study overall, almost 50% of R. bursa tick pools, mainly collected from cattle and sheep, were positive for Rickettsia spp. Interestingly, Candidatus Ri. barbariae DNA was exclusively detected in tick pools of R. bursa removed from sheep (100% of sequenced tick pools) and mostly in cattle (76%). Our detection of Candidatus Ri. barbariae in R. bursa collected from domestic animals reinforces its presence in Corsica ([8], pp. 606–613) and highlights the possible role played by R. bursa ticks in the natural maintenance of this bacterium. To understand better the role of R. bursa in the maintaining of Candidatus Ri. barbariae, ticks should be collected from nature. Candidatus Ri. barbariae is a presumed new species of the genus Rickettsia genetically characterized for the first time in R. turanicus from Sardinia [14], a Mediterranean island separated from Corsica by 10 km of sea. The presence of this bacterium has also been reported in several Rhipicephalus spp. in Portugal, Italy, France, Algeria, Cyprus, Israel, Cameroon, Lebanon [12,15,16,17,18,19], and in Hyalomma ticks in the West Bank [20]. The pathogenic role of Candidatus R. barbariae remains unknown for humans and animals, although it has been identified in an R. bursa tick removed from a woman in Greece [21].
Hyalomma marginatum was the second main tick species collected from cattle in the northern region of Corsica. This tick species was almost exclusively collected from cattle (99%). One H. marginatum was collected from a wild boar. Rickettsia spp. DNA was detected in more than 80% of H. marginatum pools collected from cattle sampling in Northern Corsica. Hyalomma marginatum ticks were exclusively infected with the human pathogen Ri. aeschlimanii, regardless of the host species (cattle or wild boars). In Corsica, cattle are reared outside all year round and acaricide treatments are rarely performed, increasing the opportunity of a wide circulation of this pathogen in Corsica. Such a high infection rate is consistent with the previously reported rate of infection of Hyalomma by Ri. aeschlimanii (>50% and >70%) in Corsica [8,22], in Croatia (64%) [23], and in Germany (50%) [24]. Rickettsia aeschlimanii may be spread through migratory birds from Africa, and it was detected in Hyalomma ticks collected from barn swallows (Hirundo rustica) in Corsica [25]. The first human case of infection was described in a patient who developed symptoms after returning from Morocco [26].
Even if wild boars and cattle share the same environment in Corsica [9], dominant tick species collected in the present study from these animals differed. In the present study, we confirmed that D. marginatus was the main tick species collected from wild boars, confirming the host preference previously reported. This tick species was not observed in cattle investigated in this study.
In the present study, most specimens of D. marginatus were collected during winter because the adults are active within a temperature range of 4–16 °C [27]. More than half of the pools of D. marginatus collected were positive for Rickettsia spp. Sequence analyses revealed for the first time the presence of Ri. slovaca DNA in D. marginatus ticks collected from wild boars in Corsica. This bacterium was previously detected in D. marginatus collected by flagging in Corsica and in other regions of the northern Mediterranean area. Rickettsia slovaca was identified in D. marginatum ticks collected on swine and wild boars in Sardinia [28]. Overall, these results suggested that the role of D. marginatus is important for the maintenance of Ri. slovaca. In Corsica, recreational hunting of wild boars could provide an ideal environment for the transmission of Ri. slovaca between wild boars, humans, and companion animals (e.g., hunting dogs). At present, the D. marginatus tick is recognized as the main vector and reservoir for Ri. slovaca in Mediterranean areas, including southern Europe and North Africa [1]. This human pathogen has been detected in almost half of D. marginatus ticks collected from rodents in the northern Apennines (Italy) and by flagging in Kazakhstan [29,30]. Rickettsia slovaca is associated with a syndrome characterized by neck lymphadenopathy following tick bites [6]. Human infection with Ri. slovaca has been described in several European countries, including France [31]. We also reported for the first time the detection of Ri. slovaca DNA in one D. marginatus collected from a cat.
In this study, R. sanguineus s.l. ticks were exclusively collected from dogs. We reported the detection of Ri. massiliae DNA in one pool of R. sanguineus s.l. collected from a dog. Rhipicephalus sanguineus s.l. is the likely reservoir of Ri. massiliae, with transovarian passage rates up to 100%. Rickettsia massiliae was reported from a specimen of R. turanicus collected from a dog in Corsica [32] and has been putatively linked to mild to moderately severe illnesses in dogs in California [33]. Rickettsia massiliae is recognized as a pathogenic Rickettsia causing spotted fever in humans [1].
In the present study, I. ricinus, mainly collected during autumn, was sporadic and represented almost 2% of all ticks sampled. The DNA of Ri. slovaca was detected in pools of I. ricinus ticks collected from wild boars. We report for the first time the detection in Corsica of Ri. monacensis DNA in one pool of I. ricinus ticks collected from one dog. Rickettsia monacensis, an emerging human pathogen of the SFG Rickettsiae family, has been previously detected in I. ricinus collected from dogs in Spain [34] and in dog blood samples from the Maio Islands [35].
This study has some limitations. Finding the DNA of human and veterinary pathogens in feeding ticks is only a marker of the community of tick-transmitted pathogens circulating in the target territory [36]. Ticks were mostly analyzed in pooled samples and not individually. Working with pools can lead to underestimation of the infection rate, which must be interpreted with caution.
The ticks were mostly collected in a municipal slaughterhouse in Northern Corsica. We have no data about the southern part of the island. Moreover, ticks from cattle, wild boars, and dogs were collected from several locations while the sheep were only from one farm.

4. Methods

4.1. Study Area and Ticks

Ticks were manually collected at several sites in Corsica (Figure 3) as follows: (i) in May 2017 from sheep (n = 500) bred in one farm located at the edge of the largest lagoon in Corsica, the Biguglia Nature Reserve; (ii) in July–August 2017 and July–December 2018 from cattle (n = 140 and n = 241, respectively) in the Ponte-Leccia slaughterhouse, and (iii) from wild boars (n = 119) during the 2018 hunting season (August 2018–January 2019). In July–August 2017, ticks were sampled from 13 dogs and one cat that presented at three veterinary clinics for a variety of reasons and not specifically for symptoms related to tick infestation.
Ticks were collected from sheep during milking mainly around the perineum and udder. The farmer declared he had never treated sheep against ectoparasites. The breeding system was extensive; thus, the sheep live in open pastures.
During each visit to the slaughterhouse, the whole skin of slaughtered animals was inspected, and ticks were collected manually. The national cattle identification system, which uses ear tags, allowed the origin of the animals to be tracked and the farm owners to be identified. One to 20 ticks were collected from each infested animal.

4.2. Morphologic Identification of Ticks at the Species Level

Ticks were identified at species level using a pictorial guide [37]. Specific attention was brought to Ixodes ticks to identify I. inopinatus [38].

4.3. DNA Extraction

Ticks were washed once in 70% ethanol for 5 min and then twice in distilled water for 1 min each time. Following species identification, ticks were analyzed individually or using monospecific pools consisting of two to six ticks according to developmental stage (nymphs, not engorged females, and male adults) and host. Individual or pools of ticks were crushed in phosphate-buffered saline using TissueLyser II (Qiagen, Hilden, Germany) at 5500 rpm for 20 s. DNA extraction was performed using QIAcube HT (Qiagen) and a QIAamp cador Pathogen Mini Kit according to the manufacturer’s instructions. DNA was eluted in 150 μL of buffer and stored at −20 °C. For each polymerase chain reaction (PCR) reaction, the template DNA was at a final amount of <200 ng.

4.4. Molecular Identification of Ticks at the Species Level

Morphological identification of ticks was confirmed using PCR amplification and sequencing of mitochondrial 16S rDNA [39] (Table 5).

4.5. PCR Detection of Rickettsia

The rPCR assays for Rickettsia spp. were performed using the primers and probes previously described for the amplification of the citrate synthase gene (gltA) (Table 5) [42]. Reactions were performed on a 96-well Applied Biosystems™ QuantStudio™ 3 Real-Time PCR System using QuantiFast Pathogen + Internal Control Kits (Qiagen). Internal and negative controls were included in each run.
Positive samples detected using rPCR were then analyzed using conventional PCR using primers that amplified the 850-bp fragment of the gltA gene common to the Rickettsia genus [40,41] and primers to amplify the 532-bp fragment of the 190-kDa outer membrane protein (ompA) gene specific to the SFG Rickettsiae [43] (Table 5). The reactions were carried out using an Applied Biosystems GeneAmp PCR System 9700 (Applied Biosystems, Courtaboeuf, France). The PCR products were separated on 2% agarose gels in tris-acetate-ethylenediaminetetraacetic acid (TAE buffer) and were visualized under ultraviolet light after staining with ethidium bromide. A 100-bp DNA ladder was used as a standard marker.
Strong positive samples were purified and directly sequenced using an Applied Biosystems model 3730XL (Fisher Scientific S. A. S., Illkirch-Graffenstaden, France). The newly generated sequences were aligned using Mega X [44]. All sequences were assembled and compared with similar sequences retrieved from the GenBank nucleotide database using BLASTn [45]. Phylogenetic analyses were inferred using the maximum-likelihood method implemented in the Mega X program [44].

4.6. Statistical Analysis

Infection rates for pooled ticks were calculated using the MLE method with 95% CI for unequal pool sizes and expressed as the MLE of infection rate per 100 ticks. MLE calculations are based on the number of pools, pool sizes (number of individuals per pool), and the number of positive pools [46].
The rates of infection or of tick infestation were compared using Fisher’s exact test (p < 0.05). The analysis was performed using the R statistical platform (version 3.1.2) [47].

5. Conclusions

In conclusion, our results contribute to a better knowledge about SFG Rickettsiae in Corsica and provide a useful contribution to understanding their epidemiology. This study reports the first evidence of the circulation of five species of the Rickettsia genus in Corsican ticks representing four genera, namely, Rhipicephalus, Hyalomma, Dermacentor, and Ixodes, that were collected from wild and domestic animals. We highlighted the exclusive detection of Candidatus Ri. barbariae in R. bursa collected from sheep and the wide circulation of the human pathogen Ri. aeschlimanii in H. marginatum collected from cattle. Moreover, the high percentage of D. marginatus with positive detection to Ri. slovaca in wild animals indicates a wide distribution of this human pathogen in Corsica. This study reports evidence for the first time that Ri. monacensis, a human pathogen, could circulate in ticks collected from dogs in Corsica. Implications for human health of the circulation of these two pathogens merits further investigation and should be taken into account by physicians seeing patients with unexplained febrile illness.

6. Declarations

6.1. Ethics Approval and Consent to Participate

The inspected cattle were slaughtered for human consumption. Living sheep were examined with the assistance of their owner. Companion animals were examined by veterinarians with the agreement of the owners. The wild boars collected were legally hunted during the hunting season.

6.2. Availability of Data and Materials

The GenBank accession numbers obtained in this study were MK608560-MK608588; MK608594-MK608637; MK608656-MK608660; MK624992-MK624999; MK652441-MK652442 for gltA gene (n = 91) and MK608589-MK608593; MK608638-MK608655; MK618727-MK618732; MK609661; MK600862; MK608661-MK608662 and MK618727-MK618732 for ompA gene (n = 33). For tick identification (16S rDNA) the GenBank accession numbers obtained were: MK620874–MK620878 (Dermacantor marginatus), MK620873 (R. bursa), MH663977 for (H. marginatum) MK620872 (I. ricinus) and MK761069-MK761072 (R. sanguineus s.l.). All other relevant data are included in the article.

Author Contributions

V.C. and A.F. conceived and designed the study and critically revised the manuscript. V.C., N.V., and O.M. performed the experiments and analyzed the data. R.C., F.C., and X.d.L. contributed to writing the manuscript. All authors read and approved the final manuscript.

Funding

This work was supported by the Corsican Territorial Collectivity and the University of Corsica.

Acknowledgments

We are grateful to the staff of the slaughterhouse at Ponte-Leccia for their help in collecting ticks from cattle and hunters and practicing veterinarians for collecting ticks from wild boars and companion animals respectively.

Conflicts of Interest

The authors declare that they have no competing interests.

Abbreviations

DEBONELDermacantor-borne necrosis lymphadenopathy
gltAcitrate synthase
MLEmaximum likelihood estimation
MSFMediterranean spotted fever
ompAouter membrane proteins A
PCRpolymerase chain reaction
SFGspotted fever group
TIBOLAtick-borne lymphadenopathy

References

  1. Parola, P.; Paddock, C.D.; Socolovschi, C.; Labruna, M.B.; Mediannikov, O.; Kernif, T.; Abdad, M.Y.; Stenos, J.; Bitam, I.; Fournier, P.E.; et al. Update on tick-borne rickettsioses around the world: A geographic approach. Clin. Microbiol. Rev. 2013, 26, 657–702. [Google Scholar] [CrossRef]
  2. Merhej, V.; Angelakis, E.; Socolovschi, C.; Raoult, D. Rickettsial evolution in the light of comparative genomics. Biol. Rev. Camb. Philos. Soc. 2011, 86, 379–405. [Google Scholar] [CrossRef]
  3. Thu, M.J.; Qiu, Y.; Matsuno, K.; Kajihara, M.; Mori-Kajihara, A.; Omori, R.; Monma, N.; Chiba, K.; Seto, J.; Gokuden, M.; et al. Diversity of spotted fever group rickettsiae and their association with host ticks in Japan. Sci. Rep. 2019, 9, 1500. [Google Scholar] [CrossRef]
  4. Merhej, V.; Angelakis, E.; Socolovschi, C.; Raoult, D. Genotyping, evolution and epidemiological findings of Rickettsia species. Infect. Genet. Evol. 2014, 25, 122–137. [Google Scholar] [CrossRef]
  5. Hornok, S.; Csorgo, T.; de la Fuente, J.; Gyuranecz, M.; Privigyei, C.; Meli, M.L.; Kreizinger, Z.; Gonczi, E.; Fernandez de Mera, I.G.; Hofmann-Lehmann, R. Synanthropic birds associated with high prevalence of tick-borne rickettsiae and with the first detection of Rickettsia aeschlimannii in Hungary. Vector Borne Zoonotic Dis. 2013, 13, 77–83. [Google Scholar] [CrossRef]
  6. Ibarra, V.; Oteo, J.A.; Portillo, A.; Santibanez, S.; Blanco, J.R.; Metola, L.; Eiros, J.M.; Perez-Martinez, L.; Sanz, M. Rickettsia slovaca infection: DEBONEL/TIBOLA. Ann. N. Y. Acad. Sci. 2006, 1078, 206–214. [Google Scholar] [CrossRef]
  7. Parola, P.; Rovery, C.; Rolain, J.M.; Brouqui, P.; Davoust, B.; Raoult, D. Rickettsia slovaca and R. raoultii in tick-borne Rickettsioses. Emerg. Infect. Dis. 2009, 15, 1105–1108. [Google Scholar] [CrossRef]
  8. Cicculli, V.; Capai, L.; Quilichini, Y.; Masse, S.; Fernandez-Alvarez, A.; Minodier, L.; Bompard, P.; Charrel, R.; Falchi, A. Molecular investigation of tick-borne pathogens in ixodid ticks infesting domestic animals (cattle and sheep) and small rodents (black rats) of Corsica, France. Ticks Tick Borne Dis. 2019, 10, 606–610. [Google Scholar] [CrossRef]
  9. Grech-Angelini, S.; Stachurski, F.; Lancelot, R.; Boissier, J.; Allienne, J.F.; Marco, S.; Maestrini, O.; Uilenberg, G. Ticks (Acari: Ixodidae) infesting cattle and some other domestic and wild hosts on the French Mediterranean island of Corsica. Parasit. Vectors 2016, 9, 582. [Google Scholar] [CrossRef]
  10. Chisu, V.; Leulmi, H.; Masala, G.; Piredda, M.; Foxi, C.; Parola, P. Detection of Rickettsia hoogstraalii, Rickettsia helvetica, Rickettsia massiliae, Rickettsia slovaca and Rickettsia aeschlimannii in ticks from Sardinia, Italy. Ticks Tick Borne Dis. 2017, 8, 347–352. [Google Scholar] [CrossRef]
  11. Belkahia, H.; Ben Said, M.; Ghribi, R.; Selmi, R.; Ben Asker, A.; Yahiaoui, M.; Bousrih, M.; Daaloul-Jedidi, M.; Messadi, L. Molecular detection, genotyping and phylogeny of Anaplasma spp. in Rhipicephalus ticks from Tunisia. Acta Trop. 2019, 191, 38–49. [Google Scholar] [CrossRef]
  12. Pereira, A.; Parreira, R.; Cotao, A.J.; Nunes, M.; Vieira, M.L.; Azevedo, F.; Campino, L.; Maia, C. Tick-borne bacteria and protozoa detected in ticks collected from domestic animals and wildlife in central and southern Portugal. Ticks Tick Borne Dis. 2018, 9, 225–234. [Google Scholar] [CrossRef]
  13. Mierzejewska, E.J.; Alsarraf, M.; Behnke, J.M.; Bajer, A. The effect of changes in agricultural practices on the density of Dermacentor reticulatus ticks. Vet. Parasitol. 2015, 211, 259–265. [Google Scholar] [CrossRef]
  14. Mura, A.; Masala, G.; Tola, S.; Satta, G.; Fois, F.; Piras, P.; Rolain, J.M.; Raoult, D.; Parola, P. First direct detection of rickettsial pathogens and a new rickettsia, ‘Candidatus Rickettsia barbariae’, in ticks from Sardinia, Italy. Clin. Microbiol. Infect. 2008, 14, 1028–1033. [Google Scholar]
  15. Socolovschi, C.; Reynaud, P.; Kernif, T.; Raoult, D.; Parola, P. Rickettsiae of spotted fever group, Borrelia valaisiana, and Coxiella burnetii in ticks on passerine birds and mammals from the Camargue in the south of France. Ticks Tick Borne Dis. 2012, 3, 355–360. [Google Scholar] [CrossRef]
  16. Chochlakis, D.; Ioannou, I.; Sandalakis, V.; Dimitriou, T.; Kassinis, N.; Papadopoulos, B.; Tselentis, Y.; Psaroulaki, A. Spotted fever group Rickettsiae in ticks in Cyprus. Microb. Ecol. 2012, 63, 314–323. [Google Scholar] [CrossRef]
  17. Vanegas, A.; Keller, C.; Kruger, A.; Manchang, T.K.; Hagen, R.M.; Frickmann, H.; Veit, A.; Achukwi, M.D.; Krucken, J.; Poppert, S. Molecular detection of spotted fever group rickettsiae in ticks from Cameroon. Ticks Tick Borne Dis. 2018, 9, 1049–1056. [Google Scholar] [CrossRef]
  18. Abdelkadir, K.; Palomar, A.M.; Portillo, A.; Oteo, J.A.; Ait-Oudhia, K.; Khelef, D. Presence of Rickettsia aeschlimannii, ‘Candidatus Rickettsia barbariae’ and Coxiella burnetii in ticks from livestock in Northwestern Algeria. Ticks Tick Borne Dis. 2019, 10, 924–928. [Google Scholar] [CrossRef]
  19. Fernandez de Mera, I.G.; Blanda, V.; Torina, A.; Dabaja, M.F.; El Romeh, A.; Cabezas-Cruz, A.; de la Fuente, J. Identification and molecular characterization of spotted fever group rickettsiae in ticks collected from farm ruminants in Lebanon. Ticks Tick Borne Dis. 2018, 9, 104–108. [Google Scholar] [CrossRef]
  20. Ereqat, S.; Nasereddin, A.; Al-Jawabreh, A.; Azmi, K.; Harrus, S.; Mumcuoglu, K.; Apanaskevich, D.; Abdeen, Z. Molecular Detection and Identification of Spotted Fever Group Rickettsiae in Ticks Collected from the West Bank, Palestinian Territories. PLoS Negl. Trop. Dis. 2016, 10, e0004348. [Google Scholar] [CrossRef] [PubMed]
  21. Papa, A.; Xanthopoulou, K.; Kotriotsiou, T.; Papaioakim, M.; Sotiraki, S.; Chaligiannis, I.; Maltezos, E. Rickettsia species in human-parasitizing ticks in Greece. Trans. R. Soc. Trop. Med. Hyg. 2016, 110, 299–304. [Google Scholar] [CrossRef] [PubMed]
  22. Matsumoto, K.; Parola, P.; Brouqui, P.; Raoult, D. Rickettsia aeschlimannii in Hyalomma ticks from Corsica. Eur. J. Clin. Microbiol. Infect. Dis. 2004, 23, 732–734. [Google Scholar] [CrossRef] [PubMed]
  23. Punda-Polic, V.; Petrovec, M.; Trilar, T.; Duh, D.; Bradaric, N.; Klismanic, Z.; Avsic-Zupanc, T. Detection and identification of spotted fever group rickettsiae in ticks collected in southern Croatia. Exp. Appl. Acarol. 2002, 28, 169–176. [Google Scholar] [CrossRef] [PubMed]
  24. Chitimia-Dobler, L.; Schaper, S.; Riess, R.; Bitterwolf, K.; Frangoulidis, D.; Bestehorn, M.; Springer, A.; Oehme, R.; Drehmann, M.; Lindau, A.; et al. Imported Hyalomma ticks in Germany in 2018. Parasit. Vectors 2019, 12, 134. [Google Scholar] [CrossRef] [PubMed]
  25. Parola, P.; Paddock, C.D.; Raoult, D. Tick-borne rickettsioses around the world: Emerging diseases challenging old concepts. Clin. Microbiol. Rev. 2005, 18, 719–756. [Google Scholar] [CrossRef] [PubMed]
  26. Raoult, D.; Fournier, P.E.; Abboud, P.; Caron, F. First documented human Rickettsia aeschlimannii infection. Emerg. Infect. Dis. 2002, 8, 748–749. [Google Scholar] [CrossRef] [PubMed]
  27. Rukhkian, M. Vertical migrations of hungry imagoes of the tick Dermacentor marginatus. Parazitologiia 1987, 21, 680–683. [Google Scholar]
  28. Masala, G.; Chisu, V.; Satta, G.; Socolovschi, C.; Raoult, D.; Parola, P. Rickettsia slovaca from Dermacentor marginatus ticks in Sardinia, Italy. Ticks Tick Borne Dis. 2012, 3, 393–395. [Google Scholar] [CrossRef]
  29. Martello, E.; Mannelli, A.; Grego, E.; Ceballos, L.A.; Ragagli, C.; Stella, M.C.; Tomassone, L. Borrelia burgdorferi sensu lato and spotted fever group rickettsiae in small rodents and attached ticks in the Northern Apennines, Italy. Ticks Tick Borne Dis. 2019, 10, 862–867. [Google Scholar] [CrossRef]
  30. Turebekov, N.; Abdiyeva, K.; Yegemberdiyeva, R.; Dmitrovsky, A.; Yeraliyeva, L.; Shapiyeva, Z.; Amirbekov, A.; Oradova, A.; Kachiyeva, Z.; Ziyadina, L.; et al. Prevalence of Rickettsia species in ticks including identification of unknown species in two regions in Kazakhstan. Parasit. Vectors 2019, 12, 197. [Google Scholar] [CrossRef] [PubMed]
  31. Raoult, D.; Lakos, A.; Fenollar, F.; Beytout, J.; Brouqui, P.; Fournier, P.E. Spotless rickettsiosis caused by Rickettsia slovaca and associated with Dermacentor ticks. Clin. Infect. Dis. 2002, 34, 1331–1336. [Google Scholar] [CrossRef] [PubMed]
  32. Matsumoto, K.; Ogawa, M.; Brouqui, P.; Raoult, D.; Parola, P. Transmission of Rickettsia massiliae in the tick, Rhipicephalus turanicus. Med. Vet. Entomol. 2005, 19, 263–270. [Google Scholar] [CrossRef] [PubMed]
  33. Beeler, E.; Abramowicz, K.F.; Zambrano, M.L.; Sturgeon, M.M.; Khalaf, N.; Hu, R.; Dasch, G.A.; Eremeeva, M.E. A focus of dogs and Rickettsia massiliae-infected Rhipicephalus sanguineus in California. Am. J. Trop. Med. Hyg. 2011, 84, 244–249. [Google Scholar] [CrossRef] [PubMed]
  34. Estrada-Pena, A.; Roura, X.; Sainz, A.; Miro, G.; Solano-Gallego, L. Species of ticks and carried pathogens in owned dogs in Spain: Results of a one-year national survey. Ticks Tick Borne Dis. 2017, 8, 443–452. [Google Scholar] [CrossRef] [PubMed]
  35. Lauzi, S.; Maia, J.P.; Epis, S.; Marcos, R.; Pereira, C.; Luzzago, C.; Santos, M.; Puente-Payo, P.; Giordano, A.; Pajoro, M.; et al. Molecular detection of Anaplasma platys, Ehrlichia canis, Hepatozoon canis and Rickettsia monacensis in dogs from Maio Island of Cape Verde archipelago. Ticks Tick Borne Dis. 2016, 7, 964–969. [Google Scholar] [CrossRef] [PubMed]
  36. Estrada-Pena, A.; Gray, J.S.; Kahl, O.; Lane, R.S.; Nijhof, A.M. Research on the ecology of ticks and tick-borne pathogens—Methodological principles and caveats. Front. Cell. Infect. Microbiol. 2013, 3, 29. [Google Scholar] [CrossRef]
  37. Estrada-Pena, A.; Bouattour, A.; Camicas, J.L.; Walker, A.R. Ticks of Veterinary and Medical Importance: The Mediterranean Basin; A guide of identification of species; University of Zaragoza Press, Zaragoza, Ed.; University of Zaragoza Press: Zaragoza, Spain, 2004. [Google Scholar]
  38. Estrada-Pena, A.; Nava, S.; Petney, T. Description of all the stages of Ixodes inopinatus n. sp. (Acari: Ixodidae). Ticks Tick Borne Dis. 2014, 5, 734–743. [Google Scholar] [CrossRef]
  39. Black, W.C.T.; Piesman, J. Phylogeny of hard-and soft-tick taxa (Acari: Ixodida) based on mitochondrial 16S rDNA sequences. Proc. Natl. Acad. Sci. USA 1994, 91, 10034–10038. [Google Scholar] [CrossRef]
  40. Roux, V.; Rydkina, E.; Eremeeva, M.; Raoult, D. Citrate synthase gene comparison, a new tool for phylogenetic analysis, and its application for the rickettsiae. Int. J. Syst. Bacteriol. 1997, 47, 252–261. [Google Scholar] [CrossRef]
  41. Mediannikov, O.Y.; Sidelnikov, Y.; Ivanov, L.; Mokretsova, E.; Fournier, P.E.; Tarasevich, I.; Raoult, D. Acute tick-borne rickettsiosis caused by Rickettsia heilongjiangensis in Russian Far East. Emerg. Infect. Dis. 2004, 10, 810–817. [Google Scholar] [CrossRef] [PubMed]
  42. Labruna, M.B.; Whitworth, T.; Horta, M.C.; Bouyer, D.H.; McBride, J.W.; Pinter, A.; Popov, V.; Gennari, S.M.; Walker, D.H. Rickettsia species infecting Amblyomma cooperi ticks from an area in the state of Sao Paulo, Brazil, where Brazilian spotted fever is endemic. J. Clin. Microbiol. 2004, 42, 90–98. [Google Scholar] [CrossRef] [PubMed]
  43. Regnery, R.L.; Spruill, C.L.; Plikaytis, B.D. Genotypic identification of rickettsiae and estimation of intraspecies sequence divergence for portions of two rickettsial genes. J. Bacteriol. 1991, 173, 1576–1589. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  44. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [PubMed]
  45. Altschul, S.F.; Madden, T.L.; Schaffer, A.A.; Zhang, J.; Zhang, Z.; Miller, W.; Lipman, D.J. Gapped BLAST and PSI-BLAST: A new generation of protein database search programs. Nucleic Acids Res. 1997, 25, 3389–3402. [Google Scholar] [CrossRef] [PubMed]
  46. Biggerstaff, B. PooledInfRate software. Vector Borne Zoonotic Dis. 2005, 5, 420–421. [Google Scholar] [CrossRef] [PubMed]
  47. Team, R.D.C. A Language and Environment for Statistical Computing (R Foundation for Statistical Computing, Vienna, 2012); R Foundation for Statistical Computing: Vienna, Austria, 2015. [Google Scholar]
Figure 1. (a) Seasonal distribution of ticks collected from cattle (May–August 2017 and July–December 2018); (b) Seasonal distribution of ticks collected from wild boars (August 2018–January 2019).
Figure 1. (a) Seasonal distribution of ticks collected from cattle (May–August 2017 and July–December 2018); (b) Seasonal distribution of ticks collected from wild boars (August 2018–January 2019).
Pathogens 08 00138 g001aPathogens 08 00138 g001b
Figure 2. (A) A phylogenetic tree of spotted fever-group Rickettsine based on the gltA gene sequences. The analysis was performed using a maximum-likelihood method with the Kimura 2-parameter model. This analysis involved 27 nucleotide sequences. A II ambiguous positions were removed for each sequence pair. There were a total of 744 positions in the final dataset. The sequences detected in this study are indicated in red. The simlified tick phylogeny consisting of four species is indicated on the top right. The colored boxes indicate the presence of Rickettsia DNA in each tick species. (B) A phylogenetic tree of spotted-fever group Rickettsiae based on the ompA gene sequences. The analysis was performed using a maximum-likelihood method with the Kimura 2-parameter model. This analysis involved 18 nucleotide sequences. All ambiguous positions were removed for each sequence pair. There were a total of 493 positions in the final dataset. The sequences detected in this study are indicated in red. The simplified tick phylogeny consisting of four species is indicated on the top right. The colored boxes indicate the presence of Rickettsia DNA in each tick species.
Figure 2. (A) A phylogenetic tree of spotted fever-group Rickettsine based on the gltA gene sequences. The analysis was performed using a maximum-likelihood method with the Kimura 2-parameter model. This analysis involved 27 nucleotide sequences. A II ambiguous positions were removed for each sequence pair. There were a total of 744 positions in the final dataset. The sequences detected in this study are indicated in red. The simlified tick phylogeny consisting of four species is indicated on the top right. The colored boxes indicate the presence of Rickettsia DNA in each tick species. (B) A phylogenetic tree of spotted-fever group Rickettsiae based on the ompA gene sequences. The analysis was performed using a maximum-likelihood method with the Kimura 2-parameter model. This analysis involved 18 nucleotide sequences. All ambiguous positions were removed for each sequence pair. There were a total of 493 positions in the final dataset. The sequences detected in this study are indicated in red. The simplified tick phylogeny consisting of four species is indicated on the top right. The colored boxes indicate the presence of Rickettsia DNA in each tick species.
Pathogens 08 00138 g002aPathogens 08 00138 g002b
Figure 3. Map of Corsica, France, indicating the tick collection sites and the animal species. GPS coordinates: Cattle: Oletta (42°38′00″ N, 9°21′22″ E), Filicetu (42°32′40″ N, 8°56′09″ E), Corti (42°18′23″ N, 9°09′05″ E), Nessa (42°33′04″ N, 8°56′57″ E), Portivechju (41°35′30″ N, 9°16′49″ E), Omessa (42°22′16″ N, 9°12′39″ E), Lama (42°34′39″ N, 9°10′22″ E), Monticellu (42°37′05″ N, 8°57′16″ E), Lucciana (42°32′48″ N, 9°25′05″ E), Calinzana (42°30′31″ N, 8°51′21″ E), Lentu (42°31′22″ N, 9°16′57″ E), San lurenzu (42°23′06″ N, 9°17′28″ E), San Martinu di lota (42°43′26″ N, 9°27′21″ E), Casamaccioli (42°19′06″ N, 9°00′07″ E), Patrimoniu (42°41′54″ N, 9°21′44″ E), Olmeta-di-tuda (42°36′44″ N, 9°21′16″ E), Farinole (42°43′58″ N, 9°21′58″ E), Penta-Acquatella (42°27′55″ N, 9°21′49″ E), Zilia (42°31′52″ N, 8°54′06″ E), Castellu di rustinu (42°27′52″ N, 9°18′56″ E), Pietralba (42°32′51″ N, 9°11′11″ E), Santa-Reparata-di-Balagna (42°36′16″ N, 8°55′45″ E), Cateri (42°34′21″ N, 8°53′33″ E), Ruglianu (42°57′25″ N, 9°25′08″ E), Filicetu (42°32′40″ N, 8°56′09″ E), Ascu (42°27′16″ N, 9°01′59″ E), Corscia (42°21′20″ N, 9°02′36″ E), Vilone Ornetu (42°24′06″ N, 9°28′18″ E), Furiani (42°39′32″ N, 9°24′54″ E), Monte grossu (42°30′06″ N, 8°55′22″ E), Tallone (42°13′55″ N, 9°24′53″ E). Wild boars: Chiatra (42°17′34″ N, 9°28′34″ E), Tralonca (42°20′39″ N, 9°12′26″ E), Quercitellu (42°25′37″ N, 9°21′02″ E), Bustanicu (42°19′24″ N, 9°18′03″ E), Favalellu (42°17′43″ N, 9°16′20″ E), Venzolasca (42°29′06″ N, 9°27′26″ E), Sermanu (42°18′54″ N, 9°16′06″ E), Palasca (42°35′24″ N, 9°02′36″ E), Pianellu (42°17′26″ N, 9°21′39″ E), Cagnanu (42°52′34″ N, 9°25′50″ E), Santa-Lucia-di-Mercuriu (42°19′37″ N, 9°13′18″ E), Aleria (42°06′53″ N, 9°30′48″ E), Mazzola (42°18′05″ N, 9°18′40″ E). Dogs: Biguglia (42°37′41″ N, 9°25′14″ E), Casanova (42°15′19″ N, 9°10′30″ E), Castellu di Rustinu (42°27′52″ N, 9°18′56″ E), Ponte-Leccia (42°26′10″ N, 9°18′01″ E), Palneca 41°58′14″ N, 9°10′26″ E). Cat: Muru (42°32′47″ N, 8°54′54″ E). Sheep: Biguglia (42°37′41″ N, 9°25′14″ E).
Figure 3. Map of Corsica, France, indicating the tick collection sites and the animal species. GPS coordinates: Cattle: Oletta (42°38′00″ N, 9°21′22″ E), Filicetu (42°32′40″ N, 8°56′09″ E), Corti (42°18′23″ N, 9°09′05″ E), Nessa (42°33′04″ N, 8°56′57″ E), Portivechju (41°35′30″ N, 9°16′49″ E), Omessa (42°22′16″ N, 9°12′39″ E), Lama (42°34′39″ N, 9°10′22″ E), Monticellu (42°37′05″ N, 8°57′16″ E), Lucciana (42°32′48″ N, 9°25′05″ E), Calinzana (42°30′31″ N, 8°51′21″ E), Lentu (42°31′22″ N, 9°16′57″ E), San lurenzu (42°23′06″ N, 9°17′28″ E), San Martinu di lota (42°43′26″ N, 9°27′21″ E), Casamaccioli (42°19′06″ N, 9°00′07″ E), Patrimoniu (42°41′54″ N, 9°21′44″ E), Olmeta-di-tuda (42°36′44″ N, 9°21′16″ E), Farinole (42°43′58″ N, 9°21′58″ E), Penta-Acquatella (42°27′55″ N, 9°21′49″ E), Zilia (42°31′52″ N, 8°54′06″ E), Castellu di rustinu (42°27′52″ N, 9°18′56″ E), Pietralba (42°32′51″ N, 9°11′11″ E), Santa-Reparata-di-Balagna (42°36′16″ N, 8°55′45″ E), Cateri (42°34′21″ N, 8°53′33″ E), Ruglianu (42°57′25″ N, 9°25′08″ E), Filicetu (42°32′40″ N, 8°56′09″ E), Ascu (42°27′16″ N, 9°01′59″ E), Corscia (42°21′20″ N, 9°02′36″ E), Vilone Ornetu (42°24′06″ N, 9°28′18″ E), Furiani (42°39′32″ N, 9°24′54″ E), Monte grossu (42°30′06″ N, 8°55′22″ E), Tallone (42°13′55″ N, 9°24′53″ E). Wild boars: Chiatra (42°17′34″ N, 9°28′34″ E), Tralonca (42°20′39″ N, 9°12′26″ E), Quercitellu (42°25′37″ N, 9°21′02″ E), Bustanicu (42°19′24″ N, 9°18′03″ E), Favalellu (42°17′43″ N, 9°16′20″ E), Venzolasca (42°29′06″ N, 9°27′26″ E), Sermanu (42°18′54″ N, 9°16′06″ E), Palasca (42°35′24″ N, 9°02′36″ E), Pianellu (42°17′26″ N, 9°21′39″ E), Cagnanu (42°52′34″ N, 9°25′50″ E), Santa-Lucia-di-Mercuriu (42°19′37″ N, 9°13′18″ E), Aleria (42°06′53″ N, 9°30′48″ E), Mazzola (42°18′05″ N, 9°18′40″ E). Dogs: Biguglia (42°37′41″ N, 9°25′14″ E), Casanova (42°15′19″ N, 9°10′30″ E), Castellu di Rustinu (42°27′52″ N, 9°18′56″ E), Ponte-Leccia (42°26′10″ N, 9°18′01″ E), Palneca 41°58′14″ N, 9°10′26″ E). Cat: Muru (42°32′47″ N, 8°54′54″ E). Sheep: Biguglia (42°37′41″ N, 9°25′14″ E).
Pathogens 08 00138 g003
Table 1. Total tick species collected from hosts sampled.
Table 1. Total tick species collected from hosts sampled.
Host (n of Hosts Inspected; Infestation Rate (%))Tick Speciesn Ticks (%)Male n (%)Female n (%)Nymph n (%)
Cattle (n = 381; 37.7%)R. bursa608 (73.0)350 (57.6)225 (37.0)33 (5.4)
H. marginatum216 (25.8)163 (75.4)53 (24.6)0 (0.0)
I. ricinus10 (1.2)3 (3.0)7 (7.0)0 (0.0)
Total834516 (62.0) 285 (34.0)33 (4.0)
Sheep (n = 500; 2.0%)R. bursa10 (100)10 (100.0)00
Total1010
Wild boars (n = 119; 38.6%)D. marginatus223 (91.0)144 (64.5)79 (35.5)0 (0.0)
I. ricinus13 (5.3)1 (8.0)12 (92.0)0 (0.0)
R. bursa8 (3.3)1 (12.5)7 (87.5)0 (0.0)
H. marginatum1 (0.4)0 (0.0)1 (100)0 (0.0)
Total245146 (60.0)99 (40.0)0 (0.0)
Dogs (n = 13 * §) R. sanguineus s.l.24 (89.0)2 (8.3)14 (58.3)8(33.3)
I. ricinus3 (11.0)03 (100)0
Total272 (7.4)17 (63.0)8 (29.6)
Cat (n = 1 * §)D. marginatus1 (100)001(100)
Total (n = 1014)All species1117674 (60.4)401 (35.8)42 (3.8)
* Tick collected by veterinarian. § infestation rate not estimable.
Table 2. Distribution of detected Rickettsia spp. in the tick species collected from cattle in 2017 (May–August 2017) and 2018 (July–December 2018) surveillance periods.
Table 2. Distribution of detected Rickettsia spp. in the tick species collected from cattle in 2017 (May–August 2017) and 2018 (July–December 2018) surveillance periods.
Number of Individual Ticks or Ticks per Pool (n)Number of Pools with n TicksPositive Rickettsia spp. n s(%)
2017 (July–August)H. marginatumR. bursaI. ricinusTotalH.marginatumR.bursaI. ricinusTotal
1151913511 (73)6 (32)0 (0)17 (49)
213902211 (85)1 (11)0 (0)12 (55)
3660124 (67)1 (17) 0 (0)5 (42)
417081 (100)3 (43)0 (0)4 (50)
518091 (100)5 (63)0 (0)6 (67)
62190211 (50)8 (42)0 (0)9 (43)
Total pools3868110729 (76)24 (35)0 (0)53 (50)
MLE (95% CI) 50.5% (37.0–64.4)12.2% (8.1–17.4)020.7% (16.0–26.1)
2018 (July–December)H. marginatumR. bursaI. ricinusTotalH. marginatumR. bursaI. ricinusTotal
1251213824 (96)5 (42)0 (0)29 (76)
2971175 (55)5 (71)0 (0)10 (62)
314812313 (93)4 (50)1 (100)18 (78)
45150204 (80)7 (46)0 (0)11 (55)
55140195 (100)10 (66)0 (0)15 (79)
61300311 (100)20 (64)0 (0)21 (68)
Total pools5986314852 (88)51 (58)1 (33)104 (70)
MLE (95% CI) 65.3% (52.8–77.3)20.1% (15.3–25.6)2.8% (0.1–11.9)30.7% (25.6–36.2)
2017 and 2018H. marginatumR. bursaI. ricinusTotalH. marginatumR. bursaI. ricinusTotal
1403127335 (87)11 (35)0 (0)46 (63)
2221613916 (73)6 (37)0 (0)22 (56)
3201413517 (85)5 (36)1 (100)23 (66)
46220285 (83)10 (45)0 (0)15 (53)
56220286 (100)15 (68)0 (0)21 (75)
63490522(67)28 (56)0 (0)30 (58)
Total pools97154425581 (83)75 (48)1 (25)157 (61)
MLE (95% CI) 58% (49.4–67.9)16.6% (13.3–20.4)2.7% (0.1–11.6)26.3% (22.7–30.1)
Table 3. Distribution of detected Rickettsia spp. in the tick species collected from wild boars (August 2018–January 2019).
Table 3. Distribution of detected Rickettsia spp. in the tick species collected from wild boars (August 2018–January 2019).
Number of Individual Ticks or Ticks per Pool (n)Number of Pools with n Ticks Positive Rickettsia spp. n (%)
D. marginatusI. ricinusR. bursaH. marginatumTotalD. marginatusI. ricinusR. bursaH. marginatumTotal
115131208 (53)1 (100)2 (67)1 (100)12 (60)
210210137 (70)1 (50)1(100)0 (0)9 (62)
311010127 (64)0 (0)1(100)0 (0)8 (67)
411200138 (73)0 (0)0 (0)0 (0)8 (62)
5900093 (34)0 (0)0 (0)0 (0)3 (33)
611000116 (56)0 (0)0 (0)0 (0)6 (55)
Total pools675517839 (58)2 (40)4 (80)1 (100)46 (59)
MLE (95% CI) 23.0% (16.9–30.0)4.9% (0.0–14.4)10.9% (3.5–23.7)2.4% (0.0–10.2)24.4% (18.5–31.1)
Table 4. The spotted-fever group Rickettsiae identified in tick species collected from different hosts.
Table 4. The spotted-fever group Rickettsiae identified in tick species collected from different hosts.
HostTick SpeciesNo. of Pools Positive for RickettsiaeNo of gltA Sequences No of ompA SequencesIdentified Rickettsia Species
2017
CattleH. marginatum29245Ri.aeschlimanii
R. bursa2452Candidatus Ri. barbariae
SheepR. bursa221Candidatus Ri. barbariae
DogsR.sanguineuss.l.111Ri. massiliae
I. ricinus111Ri. monacensis
CatD. marginatus110Ri. slovaca
Total pools 2017 583410
2018
CattleH. marginatum523113Ri.aeschlimanii
R. bursa51145Ri. aeschlimanii; Candidatus Ri. barbariae
I. ricinus110Ri.aeschlimanii
Wild boarsD. marginatus3963Ri. slovaca
I. ricinus220Ri. slovaca
R. bursa422Ri. slovaca
H. marginatum110Ri.aeschlimanii
Total pools 2018 1505723
Total pools 20172018 2089133Ri. aeschlimanii; Candidatus Ri. barbariae; Ri. massiliae; Ri. monacensis; Ri. slovaca
Table 5. Primers and probes used in this study.
Table 5. Primers and probes used in this study.
SpeciesTargetNameSequenceAnnealing Temperature (°C)References
rPCR
Rickettsia spp.gltARspp-FGAGAGAAAATTATATCCAAATGTTGAT60
Rspp-RAGGGTCTTCGTGCATTTCTT
Rspp-PCATTGTGCCATCCAGCCTACGGT
Conventional PCR (Sequencing)
Rickettsia spp.gltACS2DATGACCAATGAAAATAATAAT54[40,41]
CSEndRCTTATACTCTCTATGTACA
409DCCTATGGCTATTATGCTTGC54
1258RATTGCAAAAAGTACAGTGAACA
ompARr190.70pATGGCGAATATTTCTCCAAAA48
Rr190.602nAGTGCAGCATTCGCTCCCCCT
Ticks16S rDNA16S + 1CTGCTCAATGATTTTTTAAATTGCTGTGG48 and 54[39]
16S1CCGGTCTGAACTCAGATCAAGT

Share and Cite

MDPI and ACS Style

Cicculli, V.; Maestrini, O.; Casabianca, F.; Villechenaud, N.; Charrel, R.; de Lamballerie, X.; Falchi, A. Molecular Detection of Spotted-Fever Group Rickettsiae in Ticks Collected from Domestic and Wild Animals in Corsica, France. Pathogens 2019, 8, 138. https://doi.org/10.3390/pathogens8030138

AMA Style

Cicculli V, Maestrini O, Casabianca F, Villechenaud N, Charrel R, de Lamballerie X, Falchi A. Molecular Detection of Spotted-Fever Group Rickettsiae in Ticks Collected from Domestic and Wild Animals in Corsica, France. Pathogens. 2019; 8(3):138. https://doi.org/10.3390/pathogens8030138

Chicago/Turabian Style

Cicculli, Vincent, Oscar Maestrini, Francois Casabianca, Natacha Villechenaud, Remi Charrel, Xavier de Lamballerie, and Alessandra Falchi. 2019. "Molecular Detection of Spotted-Fever Group Rickettsiae in Ticks Collected from Domestic and Wild Animals in Corsica, France" Pathogens 8, no. 3: 138. https://doi.org/10.3390/pathogens8030138

APA Style

Cicculli, V., Maestrini, O., Casabianca, F., Villechenaud, N., Charrel, R., de Lamballerie, X., & Falchi, A. (2019). Molecular Detection of Spotted-Fever Group Rickettsiae in Ticks Collected from Domestic and Wild Animals in Corsica, France. Pathogens, 8(3), 138. https://doi.org/10.3390/pathogens8030138

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop