Iron Regulatory Mechanism IRE/IRP-like in Two Protozoa of Importance to Human Health, Entamoeba histolytica and Giardia duodenalis
Abstract
1. Introduction
2. Mechanisms of Pathogenicity and Virulence Factors in E. histolytica
3. Mechanisms of Pathogenicity and Virulence Factors in G. duodenalis
4. Iron Regulation in Protozoa
4.1. E. histolytica
4.2. G. duodenalis
4.3. Other Protozoa
5. The IRE/IRP-like Regulatory System in Protozoan

| IREs | Canonical IREs | Non-Canonical IREs |
| Homo sapiens Ferritin IRE: UUCCUGCUUCAACAGUGCUUGGACGGAA [114] | P. falciparum IRE-1: AACUUAUAAAGUUAUAUAAUU [115] | |
| H. sapiens Tfr1 IRE: UAUUUAUCAGUGAGCAGUGCCUCACUAUAAAUG [98] | P. falciparum IRE-2: UUCUUGUUAAGUUGAACAAAA [115] | |
| H. sapiens Ferroportin IRE: AACUUCAGCUACAGUGUUAGCUAAGUU [98] | T. vaginalis cp4: UCGUUCAGGCACAUGAGCAGA [15] | |
| H. sapiens DMT1 IRE: GCCAUCAGAGCCAGUGUGUUUCUAUGGU [114] | T. vaginalis cp12: AACGUAUUUAAUUGAUUGCGAA [15,116] | |
| H. sapiens mACO IRE: UCAUCUUUGUCAGUGCACAAAAUGG [108] | E. histolytica Ehhmbp26: AAUAAAUUGAAUUAAUGUUCUCUUUAUU [16] | |
| H. sapiens eALAS IRE: GUUCGUCCUCAGUGCAGGGCAAC [108] | G. duodenalis pfo: ACCCGAUUGUUUUCGGGU [23] | |
| IRPs | Mammalian IRPs | Suggested IRP-like |
| H. sapiens IRP1 (Cytosolic Aconitase) 889 aa [95] | P. falciparum: PfIRPa 909 aa (47% homology with human IRP1) [94] | |
| T. vaginalis: TvACTN3 1129 aa (No homology with other IRPs) [25] | ||
| H. sapiens IRP2 963 aa [95] | T. vaginalis: HSP70 659 aa (No homology with other IRPs) [116] | |
| T. vaginalis: PSP1 124 aa (No homology with other IRPs) [117] | ||
| G. duodenalis: Translation Initiation Inhibitor 120aa (Shares homology with PSP1 32.5%) [This study] |
6. Conclusions and Perspectives
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Domínguez, M.I. Amebiasis Intestinal y Hepática. Gastroenterol. Latinoam. 2018, 29, 50–53. [Google Scholar]
- Vivancos, V.; González-Alvarez, I.; Bermejo, M.; Gonzalez-Alvarez, M. Giardiasis: Characteristics, Pathogenesis and New Insights About Treatment. Curr. Top. Med. Chem. 2018, 18, 1287–1303. [Google Scholar] [CrossRef] [Scilit]
- Stanley, S.L., Jr. Amoebiasis. Lancet 2003, 361, 1025–1034. [Google Scholar] [CrossRef] [Scilit]
- Gastelum-Martínez, A.; León-Sicairos, C.; Plata-Guzmán, L.; Soto-Castro, L.; León-Sicairos, N.; De La Garza, M. Iron-modulated virulence factors of Entamoeba histolytica. Future Microbiol. 2018, 13, 1329–1341. [Google Scholar] [CrossRef] [Scilit]
- Betanzos, A.; Bañuelos, C.; Orozco, E. Host invasion by pathogenic amoebae: Epithelial disruption by parasite proteins. Genes 2019, 10, 618. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marchat, L.A.; Hernández-de la Cruz, O.N.; Ramírez-Moreno, E.; Silva-Cázares, M.B.; López-Camarillo, C. Proteomics approaches to understand cell biology and virulence of Entamoeba histolytica protozoan parasite. J. Proteom. 2020, 226, 103897. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yaoyu, F.; Xiao, L. Zoonotic potential and molecular epidemiology of Giardia species and giardiasis. Clin. Microbiol. Rev. 2011, 24, 110–140. [Google Scholar] [CrossRef] [Scilit]
- Leung, A.K.C.; Leung, A.A.M.; Wong, A.H.C.; Sergi, C.M.; Kamsites, J.K.M. Giardiasis: An overview. Recent Pat. Inflamm. Allergy Drug Discov. 2019, 13, 134–143. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mastronicola, D.; Falabella, M.; Forte, E.; Testa, F.; Sarti, P.; Giuffrè, A. Antioxidant defense systems in the protozoan pathogen Giardia intestinalis. Mol. Biochem. Parasitol. 2016, 206, 55–66. [Google Scholar] [CrossRef] [Scilit]
- Liu, J.; Ma’ayeh, S.; Peirasmaki, D.; Lundström-Stadelmann, B.; Hellman, L.; Svärd, S.G. Secreted Giardia intestinalis cysteine proteases disrupt intestinal epithelial cell junctional complexes and degrade chemokines. Virulence 2018, 9, 879–894. [Google Scholar] [CrossRef] [Scilit]
- Monajemzadeh, S.M.; Monajemzadeh, M. Comparison of iron and hematological indices in Giardia lamblia infection before and after treatment in 102 children in Ahwaz, Iran. Med. Sci. Monit. 2008, 14, 19–23. [Google Scholar]
- Adam, R.D. Biology of Giardia lamblia. Clin. Microbiol. Rev. 2001, 14, 447–475. [Google Scholar] [CrossRef] [Scilit]
- Aisen, P.; Enns, C.; Wessling-Resnick, M. Chemistry and biology of eukaryotic iron metabolism. Int. J. Biochem. Cell Biol. 2001, 33, 940–959. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Solano-González, E.; Burrola-Barraza, E.; León-Sicairos, C.; Ávila-González, L.; Gutiérrez-Escolano, L.; Ortega-López, J.; Arroyo, R. The trichomonad cysteine proteinase TVCP4 transcript contains an iron-responsive element. FEBS Lett. 2007, 581, 2919–2928. [Google Scholar] [CrossRef] [Scilit]
- Torres-Romero, J.C.; Arroyo, R. Responsiveness of Trichomonas vaginalis to iron concentrations: Evidence for a post-transcriptional iron regulation by an IRE/IRP-like system. Infect. Genet. Evol. 2009, 9, 1065–1074. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Soto-Castro, L.; Plata-Guzmán, L.Y.; Figueroa-Angulo, E.E.; Calla-Choque, J.S.; Reyes-López, M.; De la Garza, M.; León-Sicairos, N.; Garzón-Tiznado, J.A.; Arroyo, R.; León-Sicairos, C. Iron Responsive-like Elements in the parasite Entamoeba histolytica. Microbiology 2019, 165, 366. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, J.; Park, S.J.; Yong, T.S. Effect of iron on adherence and cytotoxicity of Entamoeba histolytica to CHO cell monolayers. Korean J. Parasitol. 2008, 46, 37–40. [Google Scholar] [CrossRef] [Scilit]
- Park, S.J.; Lee, S.M.; Lee, J.; Yong, T.S. Differential gene expression by iron-limitation in Entamoeba histolytica. Mol. Biochem. Parasitol. 2001, 114, 257–260. [Google Scholar] [CrossRef] [Scilit]
- Wassmann, C.; Hellberg, A.; Tannich, E.; Bruchhaus, I. Metronidazole resistance in the protozoan parasite Entamoeba histolytica is associated with increased expression of iron-containing superoxide dismutase and peroxiredoxin and decreased expression of ferredoxin 1 and flavin reductase. J. Biol. Chem. 1999, 274, 26051–26056. [Google Scholar] [CrossRef] [Scilit]
- López-Soto, F.; León-Sicairos, N.; Reyes-López, M.; Serrano-Luna, J.; Ordaz-Pichardo, C.; Piña-Vázquez, C.; Ortiz-Estrada, G.; de la Garza, M. Use and endocytosis of iron-containing proteins by Entamoeba histolytica trophozoites. Infect. Genet. Evol. 2009, 9, 1038–1050. [Google Scholar] [CrossRef] [Scilit]
- Cruz-Castañeda, A.; Hernández-Sánchez, J.; Olivares-Trejo, J.J. Cloning and identification of a gene coding for a 26-kDa hemoglobin-binding protein from Entamoeba histolytica. Biochimie 2009, 91, 383–389. [Google Scholar] [CrossRef] [Scilit]
- Peirasmaki, D.; Ma’ayeh, S.Y.; Xu, F.; Ferella, M.; Campos, S.; Liu, J.; Svärd, S.G. High Cysteine Membrane Proteins (HCMPs) Are Up-Regulated During Giardia-Host Cell Interactions. Front. Genet. 2020, 11, 913. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Plata-Guzmán, L.Y.; Arroyo, R.; León-Sicairos, N.; Canizalez-Román, A.; López-Moreno, H.S.; Chávez-Ontiveros, J.; Garzón-Tiznado, J.A.; León-Sicairos, C. Stem-Loop Structures in Iron-Regulated mRNAs of Giardia duodenalis. Int. J. Environ. Res. Public Health 2023, 20, 3556. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Figueroa-Angulo, E.E.; Calla-Choque, J.S.; Mancilla-Olea, M.I.; Arroyo, R. RNA-Binding Proteins in Trichomonas vaginalis: Atypical Multifunctional Proteins. Biomolecules 2015, 5, 3354–3395. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Calla-Choque, J.S.; Figueroa-Angulo, E.E.; Ávila-González, L.; Arroyo, R. α-Actinin TvACTN3 of Trichomonas vaginalis is an RNA-binding protein that could participate in its posttranscriptional iron regulatory mechanism. Biomed. Res. Int. 2014, 2014, 424767. [Google Scholar] [CrossRef] [Scilit]
- González-Rivas, E.; Nieves-Ramírez, M.; Magaña, U.; Morán, P.; Rojas-Velázquez, L.; Hernández, E.; Serrano-Vázquez, A.; Partida, O.; Pérez-Juárez, H.; Ximénez, C. Differential Pathogenic Gene Expression of E. histolytica in Patients with Different Clinical Forms of Amoebiasis. Microorganisms 2020, 8, 1556. [Google Scholar] [CrossRef] [Scilit]
- Aguirre-García, M.; Gutiérrez-Kobeh, L.; López-Vancell, R. Entamoeba histolytica: Adhesins and lectins in the trophozoite surface. Molecules 2015, 20, 2802–2815. [Google Scholar] [CrossRef] [Scilit]
- Tachibana, H.; Cheng, X.J.; Masuda, G.; Horiki, N.; Takeuchi, T. Evaluation of recombinant fragments of Entamoeba histolytica Gal/GalNAc lectin intermediate subunit for serodiagnosis of amebiasis. J. Clin. Microbiol. 2004, 42, 1069–1074. [Google Scholar] [CrossRef] [Scilit]
- Ankri, S.; Padilla-Vaca, F.; Stolarsky, T.; Koole, L.; Katz, U.; Mirelman, D. Antisense inhibition of expression of the light subunit (35 kDa) of the Gal/GalNac lectin complex inhibits Entamoeba histolytica virulence. Mol. Microbiol. 1999, 33, 327–337. [Google Scholar] [CrossRef] [Scilit]
- Marie, C.; Petri, W.A. Regulation of virulence of Entamoeba histolytica. Annu. Rev. Microbiol. 2014, 68, 493–520. [Google Scholar] [CrossRef] [Scilit]
- García-Rivera, G.; Rodríguez, M.A.; Ocádiz, R.; Martínez-López, M.C.; Arroyo, R.; González-Robles, A.; Orozco, E. Entamoeba histolytica: A novel cysteine protease and an adhesin form the 112 kDa surface protein. Mol. Microbiol. 1999, 33, 556–568. [Google Scholar] [CrossRef] [Scilit]
- Betanzos, A.; Zanatta, D.; Bañuelos, C.; Hernández-Nava, E.; Cuellar, P.; Orozco, E. Epithelial Cells Expressing EhADH, An Entamoeba histolytica Adhesin, Exhibit Increased Tight Junction Proteins. Front. Cell. Infect. Microbiol. 2018, 8, 340. [Google Scholar] [CrossRef] [Scilit]
- Guzmán-Téllez, P.; Martínez-Castillo, M.; Flores-Huerta, N.; Rosales-Morgan, G.; Pacheco-Yépez, J.; la Garza, M.; Serrano-Luna, J.; Shibayama, M. Lectins as virulence factors in Entamoeba histolytica and free-living amoebae. Future Microbiol. 2020, 15, 919–936. [Google Scholar] [CrossRef] [Scilit]
- Ralston, K.S.; Petri, W.A., Jr. Tissue destruction and invasion by Entamoeba histolytica. Trends. Parasitol. 2011, 27, 254–263. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ahn, C.S.; Kim, J.G.; Shin, M.H.; Lee, Y.A.; Kong, Y. Comparison of Secretome Profile of Pathogenic and Non-Pathogenic Entamoeba histolytica. Proteomics 2018, 18, e1700341. [Google Scholar] [CrossRef] [Scilit]
- Yanagawa, Y.; Singh, U. Diversity and Plasticity of Virulent Characteristics of Entamoeba histolytica. Trop. Med. Infect. Dis. 2023, 8, 255. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nagaraja, S.; Ankri, S. Utilization of Different Omic Approaches to Unravel Stress Response Mechanisms in the Parasite Entamoeba histolytica. Front. Cell. Infect. Microbiol. 2018, 8, 19. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Akbar, M.A.; Chatterjee, N.S.; Sen, P.; Debnath, A.; Pal, A.; Bera, T.; Das, P. Genes induced by a high-oxygen environment in Entamoeba histolytica. Mol. Biochem. Parasitol. 2004, 133, 187–196. [Google Scholar] [CrossRef] [Scilit]
- Guillén, N. Pathogenicity and virulence of Entamoeba histolytica, the agent of amoebiasis. Virulence 2023, 14, 2158656. [Google Scholar] [CrossRef] [Scilit]
- Singh, A.; Banerjee, T. Host-parasite interactions in infections due to Entamoeba histolytica: A tale of known and unknown. Trop. Parasitol. 2022, 12, 69–77. [Google Scholar] [CrossRef] [Scilit]
- Ghosh, S.; Padalia, J.; Moonah, S. Tissue Destruction Caused by Entamoeba histolytica Parasite: Cell Death, Inflammation, Invasion, and the Gut Microbiome. Curr. Clin. Microbiol. Rep. 2019, 6, 51–57. [Google Scholar] [CrossRef] [Scilit]
- Dixon, B.R. Giardia duodenalis in humans and animals—Transmission and disease. Res. Vet. Sci. 2021, 135, 283–289. [Google Scholar] [CrossRef] [Scilit]
- Ankarklev, J.; Jerlström-Hultqvist, J.; Ringqvist, E.; Troell, K.; Svärd, S.G. Behind the smile: Cell biology and disease mechanisms of Giardia species. Nat. Rev. Microbiol. 2010, 8, 413–422. [Google Scholar] [CrossRef] [Scilit]
- Nosala, C.; Hagen, K.D.; Dawson, S.C. ‘Disc-o-Fever’: Getting Down with Giardia’s Groovy Microtubule Organelle. Trends Cell Biol. 2018, 28, 99–112. [Google Scholar] [PubMed]
- Brown, J.R.; Schwartz, C.L.; Heumann, J.M.; Dawson, S.C.; Hoenger, A. A detailed look at the cytoskeletal architecture of the Giardia lamblia ventral disc. J. Struct. Biol. 2016, 194, 38–48. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hagen, K.D.; McInally, S.G.; Hilton, N.D.; Dawson, S.C. Microtubule organelles in Giardia. Adv. Parasitol. 2020, 107, 25–96. [Google Scholar]
- Jenkins, M.C.; O’Brien, C.N.; Murphy, C.; Schwarz, R.; Miska, K.; Rosenthal, B.; Trout, J.M. Antibodies to the Ventral Disc Protein δ-giardin Prevent in Vitro Binding of Giardia lamblia Trophozoites. J. Parasitol. 2009, 95, 895–899. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Weiland, M.E.L.; Palm, J.E.D.; Griffiths, W.J.; McCaffery, J.M.; Svärd, S.G. Characterization of alpha-1 giardin: An immunodominant Giardia lamblia annexin with glycosaminoglycan-binding activity. Int. J. Parasitol. 2003, 33, 1341–1351. [Google Scholar]
- Ortega-Pierres, G.; Argüello-García, R.; Laredo-Cisneros, M.S.; Fonseca-Linán, R.; Gómez-Mondragón, M.; Inzunza-Arroyo, R.; Flores-Benítez, D.; Raya-Sandino, A.; Chavez-Munguía, B.; VenturaGallegos, J.L.; et al. Giardipain-1, a protease secreted by Giardia duodenalis trophozoites, causes junctional, barrier and apoptotic damage in epithelial cell monolayers. Int. J. Parasitol. 2018, 48, 621–639. [Google Scholar] [CrossRef] [Scilit]
- Gutiérrez, L.; Bartelt, L. Current Understanding of Giardia lamblia and Pathogenesis of Stunting and Cognitive Deficits in Children from Low- and Middle-Income Countries. Curr. Trop. Med. Rep. 2024, 11, 28–39. [Google Scholar] [CrossRef] [Scilit]
- Emery, S.J.; Mirzaei, M.; Vuong, D.; Pascovici, D.; Chick, J.M.; Lacey, E.; Haynes, P.A. Induction of virulence factors in Giardia duodenalis independent of host attachment. Sci. Rep. 2016, 6, 20765. [Google Scholar] [CrossRef] [Scilit]
- Ma’ayeh, S.Y.; Liu, J.; Peirasmaki, D.; Hörnaeus, K.; Bergström-Lind, S.; Grabherr, M.; Bergquist, J.; Svärd, S.G. Characterization of the Giardia intestinalis secretome during interaction with human intestinal epithelial cells: The impact on host cells. PLoS Negl. Trop. Dis. 2017, 11, e0006120. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gavinho, B.; Sabatke, B.; Feijoli, V.; Rossi, I.V.; da Silva, J.M.; Evans-Osses, I.; Palmisano, G.; Lange, S.; Ramirez, M.I. Peptidylarginine Deiminase Inhibition Abolishes the Production of Large Extracellular Vesicles from Giardia intestinalis, Affecting Host-Pathogen Interactions by Hindering Adhesion to Host Cells. Front. Cell. Infect. Microbiol. 2020, 10, 417. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Adam, R.D. Giardia duodenalis: Biology and Pathogenesis. Clin. Microbiol. Rev. 2021, 34, e0002419. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Prucca, C.G.; Slavin, I.; Quiroga, R.; Elías, E.V.; Rivero, F.D.; Saura, A.; Carranza, P.G.; Luján, H.D. Antigenic variation in Giardia lamblia is regulated by RNA interference. Nature 2008, 456, 750–754. [Google Scholar] [CrossRef] [Scilit]
- Tekwani, B.L.; Mehlotra, R.K. Molecular basis of defense against oxidative stress in Entamoeba histolytica and Giardia lamblia. Microbes Infect. 1999, 5, 385–394. [Google Scholar] [CrossRef] [Scilit]
- Raj, D.; Ghosh, E.; Mukherjee, A.K.; Nozaki, T.; Ganguly, S. Differential gene expression in Giardia lamblia under oxidative stress: Significance in eukaryotic evolution. Gene 2014, 535, 131–139. [Google Scholar] [CrossRef] [Scilit]
- Argüello-García, R.; Cruz-Soto, M.; González-Trejo, R.; Paz-Maldonado, L.M.T.; Bazán-Tejeda, M.L.; Mendoza-Hernández, G.; Ortega-Pierres, G. An antioxidant response is involved in resistance of Giardia duodenalis to albendazole. Front. Microbiol. 2015, 6, 286. [Google Scholar] [CrossRef] [Scilit]
- Raj, D.; Chowdhury, P.; Sarkar, R.; Saito-Nakano, Y.; Okamoto, K.; Dutta, S.; Nozaki, T.; Ganguly, S. Pyruvate Protects Giardia Trophozoites from Cysteine-Ascorbate Deprived Medium Induced Cytotoxicity. Korean J. Parasitol. 2018, 56, 1–9. [Google Scholar] [CrossRef] [Scilit]
- Xu, F.; Jex, A.; Svärd, S.G. A chromosome-scale reference genome for Giardia intestinalis WB. Sci. Data 2020, 7, 38. [Google Scholar] [CrossRef] [Scilit]
- Álvarez-Sánchez, M.E.; Ávila-González, L.; Becerril-García, C.; Fattel-Facenda, L.V.; Ortega-López, J.; Arroyo, R. A novel cysteine proteinase (CP65) of Trichomonas vaginalis involved in cytotoxicity. Microb. Pathog. 2000, 28, 193–202. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hernández-Gutiérrez, R.; Ortega-López, J.; Arroyo, R. A 39-kDa cysteine proteinase CP39 from Trichomonas vaginalis, which is negatively affected by iron may be involved in trichomonal cytotoxicity. J. Eukaryot. Microbiol. 2003, 50, 696–698. [Google Scholar] [CrossRef] [Scilit]
- Sommer, U.; Costello, C.E.; Hayes, G.R.; Beach, D.H.; Gilbert, R.O.; Lucas, J.J.; Singh, B.N. Identification of Trichomonas vaginalis cysteine proteases that induce apoptosis in human vaginal epithelial cells. J. Biol. Chem. 2005, 280, 23853–23860. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Figueroa-Angulo, E.E.; Rendón-Gandarilla, F.J.; Puente-Rivera, J.; Calla-Choque, J.S.; Cárdenas-Guerra, R.E.; Ortega-López, J.; Quintas-Granados, L.I.; Álvarez-Sánchez, M.E.; Arroyo, R. The effects of environmental factors on the virulence of Trichomonas vaginalis. Microbes Infect. 2012, 14, 1411–1427. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- MacFarlane, R.C.; Singh, U. Identification of an Entamoeba histolytica serine-, threonine-, and isoleucine-rich protein with roles in adhesion and cytotoxicity. Eukaryot. Cell 2007, 6, 2139–2146. [Google Scholar] [CrossRef] [Scilit]
- Xun, Y.; Tremouilhac, P.; Carraher, C.; Gelhaus, C.; Ozawa, K.; Otting, G.; Dixon, N.E.; Leippe, M.; Grötzinger, J.; Dingley, A.J.; et al. Cell-free synthesis and combinatorial selective 15N-labeling of the cytotoxic protein amoebapore A from Entamoeba histolytica. Protein Expr. Purif. 2009, 68, 22–27. [Google Scholar] [CrossRef] [Scilit]
- Kato, K.; Yahata, K.; Gopal Dhoubhadel, B.; Fujii, Y.; Tachibana, H. Novel hemagglutinating, hemolytic and cytotoxic activities of the intermediate subunit of Entamoeba histolytica lectin. Sci. Rep. 2015, 5, 13901. [Google Scholar] [CrossRef] [Scilit]
- Sánchez, V.; Serrano-Luna, J.; Ramírez-Moreno, E.; Tsutsumi, V.; Shibayama, M. Entamoeba histolytica: Overexpression of the gal/galnac lectin, ehcp2 and ehcp5 genes in an in vivo model of amebiasis. Parasitol. Int. 2016, 65, 665–667. [Google Scholar] [CrossRef] [Scilit]
- Ortega-Pierres, M.G.; Argüello-García, R. Giardia duodenalis: Role of secreted molecules as virulent factors in the cytotoxic effect on epithelial cells. Adv. Parasitol. 2019, 106, 129–169. [Google Scholar]
- Seyoum, Y.; Baye, K.; Humblot, C. Iron homeostasis in host and gut bacteria—A complex interrelationship. Gut Microbes 2021, 13, 1874855. [Google Scholar] [CrossRef] [Scilit]
- Mach, J.; Sutak, R. Iron in parasitic protists—From uptake to storage and where we can interfere. Metallomics 2020, 12, 1335–1347. [Google Scholar] [CrossRef] [Scilit]
- Arroyo, R.; Ochoa, T.; Tai, J.H.; de la Garza, M. Iron and Parasites. Biomed. Res. Int. 2015, 2015, 291672. [Google Scholar] [CrossRef] [Scilit]
- Miller, H.W.; Tam, T.S.Y.; Ralston, K.S. Entamoeba histolytica Develops Resistance to Complement Deposition and Lysis after Acquisition of Human Complement-Regulatory Proteins through Trogocytosis. mBio 2022, 13, e0316321. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Danquah, I.; Gahutu, J.B.; Ignatius, R.; Musemakweri, A.; Mockenhaupt, F.P. Reduced prevalence of Giardia duodenalis in iron-deficient Rwandan children. Trop. Med. Int. Health 2014, 19, 563–567. [Google Scholar] [CrossRef] [Scilit]
- Gil, F.F.; Ventura, L.L.A.; Fonseca, J.F.; Saniago, H.C.; Busatti, H.; Santos, J.F.G.; Gomes, M.A. Hematological profile in natural progression of giardiasis: Kinetics of experimental infection in gerbils. J. Infect. Dev. Ctries. 2018, 12, 492–498. [Google Scholar] [CrossRef] [Scilit]
- Javed, I.N.; Tajammal, R.; Ijaz, S.H.; Ahmad, N.; Mahmood, S. “Tear Drops in the Duodenum”: Uncommon Cause of Iron Deficiency Anemia in Adults. Cureus 2019, 11, e5532. [Google Scholar] [CrossRef] [Scilit]
- Solaymani-Mohammadi, S.; Singer, S.M. Giardia duodenalis: The double-edged sword of immune responses in giardiasis. Exp. Parasitol. 2010, 126, 292–297. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bénéré, E.; Van Assche, T.; Cos, P.; Maes, L. Intrinsic susceptibility of Giardia duodenalis assemblage subtypes AI, AII, B and EIII for nitric oxide under axenic culture conditions. Parasitol. Res. 2012, 110, 1315–1319. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Magne, D.; Favennec, L.; Chochillon, C.; Gorenflot, A.; Meillet, D.; Kapel, N.; Raichvarg, D.; Savel, J.; Gobert, J.G. Role of cytoskeleton and surface lectins in Giardia duodenalis attachment to Caco2 cells. Parasitol. Res. 1991, 77, 659–662. [Google Scholar] [CrossRef] [Scilit]
- Ringqvist, E.; Palm, J.E.; Skarin, H.; Hehl, A.B.; Weiland, M.; Davids, B.J.; Reiner, D.S.; Griffiths, W.J.; Eckmann, L.; Gillin, F.D.; et al. Release of metabolic enzymes by Giardia in response to interaction with intestinal epithelial cells. Mol. Biochem. Parasitol. 2008, 159, 85–91. [Google Scholar] [CrossRef] [Scilit]
- Dubourg, A.; Xia, D.; Winpenny, J.P.; Al Naimi, S.; Bouzid, M.; Sexton, D.W.; Wastling, J.M.; Hunter, P.R.; Tyler, K.M. Giardia secretome highlights secreted tenascins as a key component of pathogenesis. Gigascience 2018, 7, giy003. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ringqvist, E.; Avesson, L.; Söderbom, F.; Svärd, S.G. Transcriptional changes in Giardia during host-parasite interactions. Int. J. Parasitol. 2011, 41, 277–285. [Google Scholar] [CrossRef] [Scilit]
- Fernández-Martín, K.G.; Alvarez-Sánchez, M.E.; Arana-Argáez, V.E.; Alvarez-Sánchez, L.C.; Lara-Riegos, J.C.; Torres-Romero, J.C. Genome-wide identification, in silico characterization and expression analysis of ZIP-like genes from Trichomonas vaginalis in response to Zinc and Iron. Biometals 2017, 30, 663–675. [Google Scholar] [CrossRef] [Scilit]
- Verma, K.; Saito-Nakano, Y.; Nozaki, T.; Datta, S. Insights into endosomal maturation of human holo-transferrin in the enteric parasite Entamoeba histolytica: Essential roles of Rab7A and Rab5 in biogenesis of giant early endocytic vacuoles. Cell Microbiol. 2015, 17, 1779–1796. [Google Scholar] [CrossRef] [Scilit]
- Rivera-Rivas, L.A.; Lorenzo-Benito, S.; Sánchez-Rodríguez, D.B.; Miranda-Ozuna, J.F.; Euceda-Padilla, E.A.; Ortega-López, J.; Chávez-Munguía, B.; Lagunes-Guillén, A.; Velázquez-Valassi, B.; Jasso-Villazul, L.; et al. The effect of iron on Trichomonas vaginalis TvCP2: A cysteine proteinase found in vaginal secretions of trichomoniasis patients. Parasitology 2020, 147, 760–774. [Google Scholar] [CrossRef] [Scilit]
- Cheng, W.H.; Huang, K.Y.; Ong, S.C.; Ku, F.M.; Huang, P.J.; Lee, C.C.; Yeh, Y.M.; Lin, R.; Chiu, C.H.; Tang, P. Protein cysteine S-nitrosylation provides reducing power by enhancing lactate dehydrogenase activity in Trichomonas vaginalis under iron deficiency. Parasit. Vectors 2020, 13, 477. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cheng, W.H.; Huang, P.J.; Lee, C.C.; Yeh, Y.M.; Ong, S.C.; Lin, R.; Ku, F.M.; Chiu, C.H.; Tang, P. Metabolomics analysis reveals changes related to pseudocyst formation induced by iron depletion in Trichomonas vaginalis. Parasit. Vectors 2023, 16, 226. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Arroyo, R.; Cárdenas-Guerra, R.E.; Figueroa-Angulo, E.E.; Puente-Rivera, J.; Zamudio-Prieto, O.; Ortega-López, J. Trichomonas vaginalis Cysteine Proteinases: Iron Response in Gene Expression and Proteolytic Activity. Biomed. Res. Int. 2015, 2015, 946787. [Google Scholar] [CrossRef] [Scilit]
- Tsai, C.D.; Liu, H.W.; Tai, J.H. Characterization of an iron-responsive promoter in the protozoan pathogen Trichomonas vaginalis. J. Biol. Chem. 2002, 277, 5153–5162. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lehker, M.W.; Alderete, J.F. Iron regulates growth of Trichomonas vaginalis and the expression of immunogenic trichomonad proteins. Mol. Microbiol. 1992, 6, 123–132. [Google Scholar] [CrossRef] [Scilit]
- Wunderlich, J.; Kotov, V.; Votborg-Novél, L.; Ntalla, C.; Geffken, M.; Peine, S.; Portugal, S.; Strauss, J. Iron transport pathways in the human malaria parasite Plasmodium falciparum revealed by RNA-sequencing. Front. Cell. Infect. Microbiol. 2024, 14, 1480076. [Google Scholar] [CrossRef] [Scilit]
- Clark, M.A.; Goheen, M.M.; Cerami, C. Influence of host iron status on Plasmodium falciparum infection. Front. Pharmacol. 2014, 5, 84. [Google Scholar] [CrossRef] [Scilit]
- Clark, M.; Fisher, N.C.; Kasthuri, R.; Cerami Hand, C. Parasite maturation and host serum iron influence the labile iron pool of erythrocyte stage Plasmodium falciparum. Br. J. Haematol. 2013, 161, 262–269. [Google Scholar] [CrossRef] [Scilit]
- Loyevsky, M.; LaVaute, T.; Allerson, C.R.; Stearman, R.; Kassim, O.O.; Cooperman, S.; Gordeuk, V.R.; Rouault, T.A. An IRP-like protein from Plasmodium falciparum binds to a mammalian iron-responsive element. Blood 2001, 98, 2555–2562. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pantopoulos, K. Iron metabolism and the IRE/IRP regulatory system: An update. Ann. N. Y. Acad. Sci. 2004, 1012, 1–13. [Google Scholar] [CrossRef] [Scilit]
- Pérez, G.; Vittori, D.; Pregi, N.; Garbossa, G.; Nesse, A. Homeostasis del hierro. Mecanismos de absorción, captación celular y regulación. Acta Bioquímica Clínica Latinoam. 2005, 39, 301–314. [Google Scholar]
- Tandara, L.; Salamunic, I. Iron metabolism: Current facts and future directions. Biochem. Med. 2012, 22, 311–328. [Google Scholar]
- Wilkinson, N.; Pantopoulos, K. The IRP/IRE system in vivo: Insights from mouse models. Front. Pharmacol. 2014, 5, 176. [Google Scholar] [CrossRef] [Scilit]
- Volz, K. The functional duality of iron regulatory protein 1. Curr. Opin. Struct. Biol. 2008, 18, 106–111. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hentze, M.W.; Muckenthaler, M.U.; Andrews, N.C. Balancing Acts: Molecular control of mammalian iron metabolism. Cell 2004, 117, 285–297. [Google Scholar] [CrossRef] [Scilit]
- Rouault, T.A. The role of iron regulatory proteins in mammalian iron homeostasis and disease. Nat. Chem. Biol. 2006, 2, 406–414. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- De Domenico, D.; McVey Ward, D.; Kaplan, J. Regulation of iron acquisition and storage: Consequences for iron-linked disorders. Nat. Rev. Mol. Cell Biol. 2008, 9, 72–81. [Google Scholar] [CrossRef] [Scilit]
- Muckenthaler, M.U.; Galy, B.; Hentze, M.W. Systemic iron homeostasis and the iron-responsive element/iron-regulatory protein (IRE/IRP) regulatory network. Annu. Rev. Nutr. 2008, 28, 197–213. [Google Scholar] [CrossRef] [Scilit]
- Ke, Y.; Wu, J.; Leibold, E.A.; Walden, W.E.; Theil, E.C. Loops and bulge/loops in iron-responsive element isoforms influence iron regulatory protein binding. Fine-tuning of mRNA regulation? J. Biol. Chem. 1998, 273, 23637–23640. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Butt, J.; Kim, H.Y.; Basilion, J.P.; Cohen, S.; Iwai, K.; Philpott, C.C.; Altschul, S.; Klausner, R.D.; Rouault, T.A. Differences in the RNA bindings sites of iron regulatory proteins and potential target diversity. Proc. Natl. Acad. Sci. USA 1996, 9, 4345–4349. [Google Scholar] [CrossRef] [Scilit]
- Senoura, T.; Kobayashi, T.; An, G.; Nakanishi, H.; Nishizawa, N.K. Defects in the rice aconitase-encoding OsACO1 gene alter iron homeostasis. Plant Mol. Biol. 2020, 104, 629–645. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liang, G. Iron uptake, signaling, and sensing in plants. Plant Commun. 2022, 3, 100349. [Google Scholar] [CrossRef] [Scilit]
- Volz, K. Conservation in the Iron Responsive Element Family. Genes 2021, 12, 1365. [Google Scholar] [CrossRef] [Scilit]
- Zuker, M. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 2003, 31, 3406–3415. [Google Scholar] [CrossRef] [Scilit]
- Weiland, M.E.; McArthur, A.G.; Morrison, H.G.; Sogin, M.L.; Svärd, S.G. Annexin-like alpha giardins: A new cytoskeletal gene family in Giardia lamblia. Int. J. Parasitol. 2005, 35, 617–626. [Google Scholar] [CrossRef] [Scilit]
- Tolba, M.E.; Kobayashi, S.; Imada, M.; Suzuki, Y.; Sugano, S. Giardia lamblia transcriptome analysis using TSS-Seq and RNA-Seq. PLoS ONE 2013, 8, e76184. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Franzén, O.; Jerlström-Hultqvist, J.; Einarsson, E.; Ankarklev, J.; Ferella, M.; Andersson, B.; Svärd, S.G. Transcriptome profiling of Giardia intestinalis using strand-specific RNA-seq. PLoS Comput. Biol. 2013, 9, e1003000. [Google Scholar] [CrossRef] [Scilit]
- Bilodeau, D.Y.; Sheridan, R.M.; Balan, B.; Jex, A.R.; Rissland, O.S. Precise gene models using long-read sequencing reveal a unique poly(A) signal in Giardia lamblia. RNA 2022, 28, 668–682. [Google Scholar] [CrossRef] [Scilit]
- Piccinelli, P.; Samuelsson, T. Evolution of the Iron-Responsive Element. RNA 2007, 13, 952–966. [Google Scholar] [CrossRef] [Scilit]
- Loyevsky, M.; Mompoint, F.; Yikilmaz, E.; Altschul, S.F.; Madden, T.; Wootton, J.C.; Kurantsin-Mills, J.; Kassim, O.O.; Gordeuk, V.R.; Rouault, T.A. Expression of a recombinant IRP-like Plasmodium falciparum protein that specifically binds putative plasmodial IREs. Mol. Biochem. Parasitol. 2003, 126, 231–238. [Google Scholar] [CrossRef] [Scilit]
- León-Sicairos, C.R.; Figueroa-Angulo, E.E.; Calla-Choque, J.S.; Arroyo, R. The Non-Canonical Iron-Responsive Element of IRE-tvcp12 Hairpin Structure at the 3′-UTR of Trichomonas vaginalis TvCP12 mRNA That Binds TvHSP70 and TvACTN-3 Can Regulate mRNA Stability and Amount of Protein. Pathogens 2023, 12, 586. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Millán-Pacheco, C.; Arreola, R.; Villalobos-Osnaya, A.; Garza-Ramos, G.; Serratos, I.N.; Díaz-Vilchis, A.; Rudiño-Piñera, E.; Alvarez-Sanchez, M.E. A Putative New Role of Tv-PSP1 Recognizes IRE and ERE Hairpin Structures from Trichomonas vaginalis. Pathogens 2023, 12, 79. [Google Scholar] [CrossRef] [Scilit]
- Moafinejad, S.N.; de Aquino, B.R.H.; Boniecki, M.J.; Pandaranadar Jeyeram, I.P.N.; Nikolaev, G.; Magnus, M.; Farsani, M.A.; Badepally, N.G.; Wirecki, T.K.; Stefaniak, F.; et al. SimRNAweb v2.0: A web server for RNA folding simulations and 3D structure modeling, with optional restraints and enhanced analysis of folding trajectories. Nucleic Acids Res. 2024, 52, W368–W373. [Google Scholar] [CrossRef] [Scilit]
- Magnus, M.; Boniecki, M.J.; Dawson, W.; Bujnicki, J.M. SimRNAweb: A web server for RNA 3D structure modeling with optional restraints. Nucleic Acids Res. 2016, 44, W315–W319. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Boniecki, M.J.; Lach, G.; Dawson, W.K.; Tomala, K.; Lukasz, P.; Soltysinski, T.; Rother, K.M.; Bujnicki, J.M. SimRNA: A coarse-grained method for RNA folding simulations and 3D structure prediction. Nucleic Acids Res. 2016, 44, e63. [Google Scholar] [CrossRef] [Scilit]
- Jones, G.; Jindal, A.; Ghani, U.; Kotelnikov, S.; Egbert, M.; Hashemi, N.; Vajda, S.; Padhorny, D.; Kozakov, D. Elucidation of protein function using computational docking and hotspot analysis by ClusPro and FTMap. Acta Crystallogr. D Struct. Biol. 2022, 78, 690–697. [Google Scholar] [CrossRef] [Scilit]
- Desta, I.T.; Porter, K.A.; Xia, B.; Kozakov, D.; Vajda, S. Performance and Its Limits in Rigid Body Protein-Protein Docking. Structure 2020, 28, 1071–1081. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vajda, S.; Yueh, C.; Beglov, D.; Bohnuud, T.; Mottarella, S.E.; Xia, B.; Hall, D.R.; Kozakov, D. New additions to the ClusPro server motivated by CAPRI. Proteins Struct. Funct. Bioinform. 2017, 85, 435–444. [Google Scholar] [CrossRef] [Scilit]
- Kozakov, D.; Hall, D.R.; Xia, B.; Porter, K.A.; Padhorny, D.; Yueh, C.; Beglov, D.; Vajda, S. The ClusPro web server for protein-protein docking. Nat. Protoc. 2017, 12, 255–278. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kozakov, D.; Beglov, D.; Bohnuud, T.; Mottarella, S.; Xia, B.; Hall, D.R.; Vajda, S. How good is automated protein docking? Proteins Struct. Funct. Bioinform. 2013, 81, 2159–2166. [Google Scholar] [CrossRef] [Scilit]
- Zheng, W.; Wuyun, Q.; Li, Y.; Liu, Q.; Zhou, X.; Peng, C.; Zhu, Y.; Freddolino, L.; Zhang, Y. Deep-learning-based single-domain and multidomain protein structure prediction with D-I-TASSER. Nat. Biotechnol. 2025. Epub ahead of print. [Google Scholar] [CrossRef] [Scilit]
- Zhou, X.; Zheng, W.; Li, Y.; Pearce, R.; Zhang, C.; Bell, E.W.; Zhang, G.; Zhang, Y. I-TASSER-MTD: A deep-learning-based platform for multi-domain protein structure and function prediction. Nat. Protoc. 2022, 17, 2326–2353. [Google Scholar] [CrossRef] [Scilit]
- Zheng, W.; Zhang, C.; Li, Y.; Pearce, R.; Bell, E.W.; Zhang, Y. Folding non-homology proteins by coupling deep-learning contact maps with I-TASSER assembly simulations. Cell Rep. Methods 2021, 1, 100014. [Google Scholar] [CrossRef] [Scilit]
- Humphrey, W.; Dalke, A.; Schulten, K. VMD: Visual Molecular Dynamics. J. Mol. Graph. 1996, 14, 33–38. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Laskowski, R.A.; Jablonska, J.; Pravda, L.; Varekova, R.S.; Thornton, J.M. PDBsum: Structural summaries of PDB entries. Protein Sci. 2018, 27, 169–173. [Google Scholar]
- Wada, A.; Umeki, Y.; Annoura, T.; Saito-Nakano, Y. In Vitro and In Vivo Antiamebic Activity of Iron-Targeting Polypyridine Compounds against Enteric Protozoan Parasite Entamoeba histolytica. ACS Infect. Dis. 2022, 8, 457–462. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aguilar-Diaz, H.; Canizalez-Román, A.; Nepomuceno-Mejia, T.; Gallardo-Vera, F.; Hornelas-Orozco, Y.; Nazmi, K.; Bolscher, J.G.; Carrero, J.C.; Leon-Sicairos, C.; Leon-Sicairos, N. Parasiticidal effect of synthetic bovine lactoferrin peptides on the enteric parasite Giardia intestinalis. Biochem. Cell Biol. 2017, 95, 82–90. [Google Scholar] [CrossRef] [Scilit]
- Hoffmann, A.; Grubwieser, P.; Bumann, D.; Haschka, D.; Weiss, G. Tackling microbial iron homeostasis: Novel antimicrobial strategies. Trends Pharmacol. Sci. 2025, 46, 1004–1017. [Google Scholar] [CrossRef] [Scilit] [PubMed]



| Used Probe (NCBI) | Homolog Sequence from GiardiaDB | Accession Number (GiardiaDB) | Identity (%) |
|---|---|---|---|
| PFO E. histolytica (EAL51636.2) | Pyruvate-flavodoxin oxidoreductase | GL50803_0017063 | 38.4682 |
| PFO E. histolytica (EAL51636.2) | Pyruvate-flavodoxin oxidoreductase | GL50803_00114609 | 26.2478 |
| EhCP1 (Q01957.1) | Cathepsin L | GL50803_0014983 | 20.9524 |
| EhCP1 (Q01957.1) | Cathepsin L | GL50803_0016380 | 23.1746 |
| EhCP1 (Q01957.1) | Cathepsin B | GL50803_0014019 | 19 |
| EhCP1 (Q01957.1) | Cathepsin B | GL50803_0016160 | 20.6081 |
| EhCP1 (Q01957.1) | Cathepsin B | GL50803_0016779 | 17.4497 |
| EhCP1 (Q01957.1) | Cathepsin B | GL50803_0016468 | 17.7049 |
| EhCP2 (Q01958.1) | Cathepsin L | GL50803_0014983 | 22.8571 |
| EhCP2 (Q01958.1) | Cathepsin L | GL50803_0016380 | 22.8571 |
| EhCP2 (Q01958.1) | Cathepsin B | GL50803_0014019 | 19.6667 |
| EhCP2 (Q01958.1) | Cathepsin B | GL50803_0016779 | 18.1208 |
| EhCP2 (Q01958.1) | Cathepsin B | GL50803_0016160 | 18.5811 |
| EhCP2 (Q01958.1) | Cathepsin B | GL50803_0016468 | 18.6885 |
| EhCP5 (CAA62835.1) | Cathepsin L | GL50803_0014983 | 22.0126 |
| EhCP5 (CAA62835.1) | Cathepsin L | GL50803_0016380 | 22.6415 |
| EhCP5 (CAA62835.1) | Cathepsin B | GL50803_0014019 | 20.6667 |
| EhCP5 (CAA62835.1) | Cathepsin B | GL50803_0016779 | 18.4564 |
| EhCP5 (CAA62835.1) | Cathepsin B | GL50803_0016468 | 18.3607 |
| EhCP5 (CAA62835.1) | Cathepsin B | GL50803_0010217 | 19.1419 |
| AP65 T. vaginalis (AAA87406.1) | Malate dehydrogenase | GL50803_0014285 | 29.8025 |
| PFO T. vaginalis (AAA85495.1) | Pyruvate-flavodoxin oxidoreductase | GL50803_0017063 | 36.3872 |
| PFO T. vaginalis (AAA85495.1) | Pyruvate-flavodoxin oxidoreductase | GL50803_00114609 | 28.7813 |
| Used Probe (NCBI) | Homolog Sequence from GiardiaDB | Access Number (GiardiaDB) | Identity (%) |
|---|---|---|---|
| TvCP4 (AAV98582.1) | Cathepsin B | GL50803_0014019 | 20.3333 |
| TvCP4 (AAV98582.1) | Cathepsin B | GL50803_0016779 | 18.7919 |
| TvCP4 (AAV98582.1) | Cathepsin B | GL50803_0016160 | 18.9189 |
| TvCP4 (AAV98582.1) | Cathepsin B | GL50803_0010217 | 18.4818 |
| TvCP4 (AAV98582.1) | Cathepsin B | GL50803_0016468 | 18.3607 |
| TvCP4 (AAV98582.1) | Cathepsin L | GL50803_0014983 | 21.9672 |
| TvCP4 (AAV98582.1) | Cathepsin L | GL50803_0016380 | 22.623 |
| TvCP12 (AAS38515.1) | Cysteine protease | GL50803_00113656 | 20.5479 |
| TvCP30 (CAA54437.1) | Cathepsin L | GL50803_0014983 | 20.8633 |
| TvCP30 (CAA54437.1) | Cathepsin L | GL50803_0016380 | 18.705 |
| TvCP39 (ABX56032.1) | Cathepsin B | GL50803_0016779 | 19.1275 |
| TvCP39 (ABX56032.1) | Cathepsin B | GL50803_0016160 | 18.5811 |
| TvCP65 (AAS38514.1) | Cathepsin B | GL50803_0010217 | 19.4175 |
| TvCP65 (AAS38514.1) | Cathepsin B | GL50803_0015564 | 18.932 |
| TvCP65 (AAS38514.1) | Cathepsin L | GL50803_0014983 | 22.8155 |
| TvCP65 (AAS38514.1) | Cathepsin L | GL50803_0016380 | 22.8155 |
| EhCP1 (AAA29090.1) | Cathepsin B | GL50803_0016160 | 20.6081 |
| EhCP1 (AAA29090.1) | Cysteine protease | GL50803_00113656 | 21.9048 |
| EhCP2 (AAA29091.1) | Cathepsin B | GL50803_0014019 | 19.6667 |
| EhCP2 (AAA29091.1) | Cathepsin B | GL50803_0016468 | 18.6885 |
| EhCP2 (AAA29091.1) | Cysteine protease | GL50803_00113656 | 21.2698 |
| EhCP5 (CAA62835.1) | Cathepsin B | GL50803_0014019 | 20.6667 |
| EhCP5 (CAA62835.1) | Cathepsin B | GL50803_0016779 | 18.4564 |
| EhCP5 (CAA62835.1) | Cathepsin B | GL50803_0010217 | 19.1419 |
| EhCP5 (CAA62835.1) | Cathepsin B | GL50803_0016468 | 18.3607 |
| EhCP5 (CAA62835.1) | Cathepsin L | GL50803_003099 | 20.4403 |
| EhCP5 (CAA62835.1) | Cathepsin L | GL50803_0014983 | 22.0126 |
| EhCP5 (CAA62835.1) | Cathepsin L | GL50803_0016380 | 22.6415 |
| T. vaginalis Protein | G. duodenalis Protein | Identity (%) |
|---|---|---|
| TvHSP70 [25] | GL50803_0088765 Cytosolic heat shock protein 70 | 55.0835 |
| GL50803_0017121 Bip | 46.3746 | |
| GL50803_0014581 Chaperone protein DnaK HSP70 | 30.625 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
León-Beltrán, J.G.; Montaño, S.; Arroyo, R.; Estrada-Ramírez, D.; León-Sicairos, N.; Canizalez-Román, A.; Sánchez-González, M.A.; Garzón-Tiznado, J.A.; León-Sicairos, C. Iron Regulatory Mechanism IRE/IRP-like in Two Protozoa of Importance to Human Health, Entamoeba histolytica and Giardia duodenalis. Pathogens 2026, 15, 57. https://doi.org/10.3390/pathogens15010057
León-Beltrán JG, Montaño S, Arroyo R, Estrada-Ramírez D, León-Sicairos N, Canizalez-Román A, Sánchez-González MA, Garzón-Tiznado JA, León-Sicairos C. Iron Regulatory Mechanism IRE/IRP-like in Two Protozoa of Importance to Human Health, Entamoeba histolytica and Giardia duodenalis. Pathogens. 2026; 15(1):57. https://doi.org/10.3390/pathogens15010057
Chicago/Turabian StyleLeón-Beltrán, Jesús Gabriel, Sarita Montaño, Rossana Arroyo, Daniela Estrada-Ramírez, Nidia León-Sicairos, Adrián Canizalez-Román, María Angélica Sánchez-González, José Antonio Garzón-Tiznado, and Claudia León-Sicairos. 2026. "Iron Regulatory Mechanism IRE/IRP-like in Two Protozoa of Importance to Human Health, Entamoeba histolytica and Giardia duodenalis" Pathogens 15, no. 1: 57. https://doi.org/10.3390/pathogens15010057
APA StyleLeón-Beltrán, J. G., Montaño, S., Arroyo, R., Estrada-Ramírez, D., León-Sicairos, N., Canizalez-Román, A., Sánchez-González, M. A., Garzón-Tiznado, J. A., & León-Sicairos, C. (2026). Iron Regulatory Mechanism IRE/IRP-like in Two Protozoa of Importance to Human Health, Entamoeba histolytica and Giardia duodenalis. Pathogens, 15(1), 57. https://doi.org/10.3390/pathogens15010057

