Next Article in Journal
Mycobacterium tuberculosis Modulates the Expansion of Terminally Exhausted CD4+ and CD8+ T-Cells in Individuals with HIV-TB Co-Infection
Previous Article in Journal
Re-Evaluation of a Hyperendemic Focus of Metastrongyloid Lungworm Infections in Gastropod Intermediate Hosts in Southern Germany
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Pathogens
Volume 14
Issue 8
10.3390/pathogens14080801
pathogens-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Characterising the Associated Virome and Microbiota of Asian Citrus Psyllid (Diaphorina citri) in Samoa

by
Kayvan Etebari
1,*,
Angelika M. Tugaga
2,
Gayatri Divekar
1,
Olo Aleni Uelese
2,
Sharydia S. A. Tusa
2,
Ellis Vaega
2,
Helmy Sasulu
2,
Loia Uini
2,
Yuanhang Ren
1,3 and
Michael J. Furlong
4
1
School of Agriculture and Food Sustainability, The University of Queensland, Brisbane 4072, Australia
2
Scientific Research Organisation of Samoa (SROS), Apia P.O. Box 6597, Samoa
3
Key Laboratory of Coarse Cereal Processing of Ministry of Agriculture and Rural Affairs, Chengdu University, Chengdu 610106, China
4
School of the Environment, The University of Queensland, Brisbane 4072, Australia
*
Author to whom correspondence should be addressed.
Pathogens 2025, 14(8), 801; https://doi.org/10.3390/pathogens14080801
Submission received: 8 July 2025 / Revised: 6 August 2025 / Accepted: 8 August 2025 / Published: 10 August 2025
(This article belongs to the Section Viral Pathogens)
Browse Figures
Versions Notes

Abstract

The Asian citrus psyllid (Diaphorina citri) is an economically important pest of citrus as it is a vector of the bacterium (Candidatus Liberibacter asiaticus, CLas) that causes huanglongbing disease (HLB). Understanding the virome of D. citri is important for uncovering factors that influence vector competence, to support biosecurity surveillance, and to identify candidate agents for biological control. Previous studies have identified several D. citri-associated viruses from various geographical populations of this pest. To further investigate virus diversity in this pest, high-throughput sequencing was used to analyse D. citri populations from the Samoan islands of Upolu and Savai’i. Eleven novel viruses from the Yadokariviridae, Botourmiaviridae, Nodaviridae, Mymonaviridae, Partitiviridae, Totiviridae, and Polymycoviridae were identified as well as some that corresponded to unclassified groups. In addition, microbiome analysis revealed the presence of several endosymbiotic microorganisms, including Wolbachia, as well as some plant pathogenic fungi, including Botrytis cinerea. However, the causative agent of HLB disease (CLas) was not detected in the RNA-Seq data. These findings highlight the complex and diverse microbiota associated with D. citri and suggest potential interactions and dynamics between microorganisms and psyllid-associated viruses. Further research is needed to understand the ecological significance of these discoveries, and whether the novel viruses play a role in regulating field populations of the psyllid.

Graphical Abstract

1. Introduction

The Asian citrus psyllid (ACP, Diaphorina citri) is an extremely important vector of Candidatus Liberibacter asiaticus (CLas), the pathogen that causes huanglongbing (HLB), also known as citrus greening disease. HLB is one of the most serious diseases affecting citrus plants worldwide. HLB disrupts plant physiology by blocking phloem transport, causing chlorosis, root decline, and reduced photosynthesis, ultimately leading to tree decline. It has a significant negative economic impact on the citrus sector, particularly in major producing countries such as the United States, Brazil, and China. Globally, HLB is estimated to cause over 4.5 billion USD in economic losses annually [1,2,3,4]. Although HLB is not currently present in Australia, its occurrence in neighbouring countries and the presence of the vector pose a significant biosecurity threat to the Australian citrus industry. Therefore, understanding and managing the spread, dispersal, and population dynamics of D. citri is essential for effective HLB disease management and biosecurity surveillance in the region.
Historically, management efforts against ACP have relied primarily on chemical insecticides and antibiotics; however, these have shown limited long-term efficacy, with increasing reports of insecticide resistance in ACP populations and inconsistent disease suppression, particularly under field conditions [5]. For example, resistance to neonicotinoids and pyrethroids has been documented in ACP populations in regions such as Florida and Brazil, significantly reducing control effectiveness [6,7]. In addition, the extensive use of chemical controls has contributed to environmental contamination and has had detrimental effects on non-target and beneficial organisms within citrus orchard. The constraints of chemical control have generated interest in developing more sustainable, environmentally friendly approaches to managing D. citri populations and reducing the transmission of HLB.
As a result, research has expanded beyond traditional biological control to investigate the potential of various microorganisms that can alter D. citri fitness and interfere with disease transmission. This includes the use of entomopathogenic fungi, bacteria, viruses, and protozoa, which have shown promise in weakening vector populations or altering their capacity to spread the pathogen. For instance, a study in China has demonstrated that endosymbiotic viruses isolated from D. citri can significantly reduce egg production in female psyllids, thereby limiting population growth [8].
Building on this, metagenomic analysis has revealed the diversity and abundance of both DNA and RNA viruses in insects, shedding light on the viral communities associated with vectors like D. citri. Several viruses have been identified in D. citri, and these can be grouped based on their genome types: DNA viruses such as Diaphorina citri densovirus (DcDV) and densovirus-like sequences and RNA viruses including reovirus (DcRV), bunyavirus (DcBV), flavi-like virus (DcFLV), associated C virus (DcACV), and picorna-like viruses (DcPLV). In addition, several unclassified positive-sense single-stranded RNA viruses have also been discovered, but their taxonomic placement remains unresolved, and their biological roles in D. citri are still unknown. [9,10].
Due to their high adaptability to insect hosts, psyllid-specific viruses have the potential to interfere with the transmission of insect-borne pathogens responsible for diseases such as HLB, citrus tristeza, and citrus yellow vein disease [11]. However, recent findings indicate a more complex interaction. For example, the presence of DcFLV has been shown to enhance the transmission of CLas by both nymphs and adults. DcFLV appears to modulate various cellular and physiological processes in D. citri in a life stage-dependent manner, promoting CLas acquisition during the nymphal stage and facilitating transmission in adults. In nymphs, DcFLV suppresses defence and autophagy genes and may enhance viral movement via vesicular transport, facilitating higher CLas acquisition. In adults, DcFLV induces ER stress and immune responses, leading to cell damage and reduced CLas acquisition, but prolonged infection may still support transmission by increasing bacterial titre. These findings suggest that D. citri individuals infected with DcFLV may be more efficient vectors of CLas compared to virus-free counterparts [10].
In addition to influencing pathogen transmission, these viruses can alter host traits and physiological processes. For example, virus-induced gene silencing (VIGS) can be used to target specific insect RNAs, or some viruses may stimulate host immune responses against other pathogens [12,13]. Despite these advances, the diversity of unidentified viruses in psyllid populations and the mechanisms by which D. citri-associated viruses influence host physiology and pathogen transmission remain poorly understood. Further research is needed to characterise these interactions and their implications for disease ecology and pest management. Identifying virus-specific gene targets involved in immune modulation, or determining how co-infection alters vector competence and pathogen load, can inform disease ecology and pest management strategies.
In this study, we employed an RNA-Seq approach to investigate the diversity of viruses in D. citri collected from the two Samoan islands, Upolu and Savai’i, between 2019 and 2022. Samoa was selected for this study due to the widespread presence of D. citri and the current absence of HLB, providing a valuable setting to characterise the baseline virome and microbiota. This research primarily strengthens Samoa’s preparedness by establishing foundational knowledge to support early detection, future surveillance, and pest management strategies. It also contributes to regional citrus biosecurity efforts in neighbouring countries such as Australia and New Zealand.
The near-complete genomes of eleven novel viruses were identified, along with traces of several bacterial species and some plant-pathogenic fungi in different psyllid populations. Genomic profiling of insect vectors, or Vector-Enabled Metagenomics (VEM) survey, offers a powerful biosecurity tool for D. citri surveillance by enabling the early detection of diverse and potentially emergent plant viruses carried by the vector, even before symptoms appear in crops [14,15,16]. This proactive approach enhances our capacity to monitor viral threats and manage plant disease risks more effectively
The findings will highlight the presence of a complex and diverse microbial community associated with D. citri, including insect-specific viruses and potential endosymbiotic bacteria. While the functional roles of these microorganisms remain to be explored, their detection provides a foundational resource for future studies on microbe-insect-pathogen interactions and their possible applications in managing psyllid populations and limiting the spread of HLB disease.

2. Materials and Methods

2.1. Survey and Insect Collection

Diaphorina citri adult were collected from various locations across the islands of Upolu (21 sites) and Savai’i (20 sites) in Samoa between 2019 and 2022. Approximately 437 adult psyllids were randomly sampled from multiple trees by using an insect aspirator (Supplementary Figure S1). Adult psyllids from each sampling site were preserved in ethanol or an RNA stabilization reagent (RNAprotect®, QIAGEN Cat No.: 76104) for downstream DNA and RNA extraction and sequencing. RNAprotect was used for transcriptomic analysis, while ethanol-preserved samples were retained for DNA-based assessments or backup purposes.

2.2. Conventional PCR Approach for Host Identification and Pathogen Detection

DNA from 287 samples was extracted by DNeasy Blood and Tissue Kits for DNA Isolation (QIAGEN Cat No.: 69504). DNA quantity and quality were assessed using a NanoDrop spectrophotometer. All extracted samples were screened for the presence of CLas by using polymerase chain reaction (PCR) targeting the 16S rRNA gene, a conserved region commonly used in bacterial identification and known for its specificity in detecting CLas [17]. All PCRs were run in duplicate with positive and negative controls to ensure proper amplification, reproducibility, and absence of contamination. To screen for the presence of bacteria in the samples, we used primers considered diagnostic for CLas. The primer sequences were HLB75F (5′–CGCGTATGCAATACGAGCGGCA–3′) and HLB177T R (5′–GCCTCGCGACTTCGCAACCCAT–3′) [17].

2.3. RNA Extraction and Sequencing

A total of 150 adult D. citri collected from Upolu and Savai’i in 2022 was divided into three groups for RNA-Seq analysis. One group consisted of samples from Savai’i, while the other two groups comprised samples collected from the northern and southern regions of Upolu. Savai’i (SAV) was treated as a single group because the sampling sites on this island were in close proximity to each other, limiting spatial variability. In contrast, Upolu has a wider geographic spread with more dispersed citrus trees, so it was divided into northern (UPO1) and southern (UPO2) regions to better reflect potential regional differences in virome and microbiota composition.
Adult insects were transferred into QIAzol lysis reagent, and total RNA was extracted following the manufacturer’s protocol (QIAGEN; Cat No.: 79306). Briefly, insects were homogenised in QIAzol and incubated at room temperature, and phase separation was achieved by adding chloroform and centrifugation. The aqueous phase was transferred, and RNA was precipitated using isopropanol, washed with 75% ethanol, and air-dried. The RNA pellet was finally resuspended in RNase-free water for downstream applications.
The RNA samples were treated with DNase I for 1 h at 37 °C. Concentrations were measured using a spectrophotometer, and integrity was confirmed by electrophoresis on a 1% (w/v) agarose gel. After verifying RNA quality, total RNA from three pooled groups (SAV, UPO1, and UPO2) was submitted to the Novogene sequencing facility in Hong Kong for library preparation (following eukaryotic ribosomal RNA depletion) and strand-specific total RNA sequencing on the NovaSeq platform. The eukaryote ribosomal RNA was removed using a VAHTS Total RNA-seq (HMR) Library Prep Kit for Illumina.

2.4. Bioinformatics Analysis and Virus Discovery

The CLC Genomics Workbench version 21.0.5 and OmicsBox 3.0.25 were used for bioinformatics analyses. All sequencing libraries were trimmed to remove residual adapter or vector sequences. Reads with a quality score below 0.05 and those containing more than two ambiguous nucleotides were excluded from further analysis. Quality filtering resulted in minimal read loss, with 0.83% for UPO1, 0.99% for UPO2, and 1.57% for SAV libraries. The majority of high-quality reads were retained, with an average read length of 148 base pairs used for downstream analysis. All trimmed reads were mapped to the D. citri genome (GCA_000475195.1) to remove host-related sequences. The unmapped reads were retained for downstream analysis in our virus discovery pipelines or microbiome study by Kraken2 tools in OmicsBox. We used meta-SPAdes [18] with automatic k-mer size for de novo assembly in the metagenomic mode after removing rRNA with SortMeRNA [19]. We also used another de novo assembly approach in CLC (word size 25, bubble size 50, and minimum contig length 300 bp) to process these data and verify the best assembly outcomes. The contigs were corrected by mapping all reads against the assembled sequences (min. length fraction, maximum mismatch, insertion, and deletion cost of 0.8, 2, 3, and 3 respectively). Assemblies were compared based on N50, total contig length, and contig count > 1 kb. Meta-SPAdes outperformed CLC and was selected for downstream analysis.
For virus discovery, assembled contigs were initially compared to locally curated NCBI viral genome and protein databases (downloaded December 2024) using BLASTn and BLASTx, applying a stringent e-value cutoff of 1 × 10−10 to enhance sensitivity and reduce false positives. Contigs with viral hits were further validated using BLASTx against the non-redundant protein sequences (nr V5) database via OmicsBox to confirm viral origin and eliminate spurious matches. To detect highly divergent viruses, we also performed domain-based searches by comparing the assembled contigs against the Conserved Domain Database (CDD) version 3.14 and Pfam v32 with an expected value threshold of 1 × 10−3. Sequences with positive hits to virus polymerase (RNA-dependent RNA polymerase (RdRP) domain: cd01699) were retained. Viral contigs were further validated by cross-checking ORF integrity and alignment with known viral genomes across both assemblies.
To explore the microbial community of ACP, the paired-end total RNA reads were used as input in Kraken 2, which is a taxonomic sequence classifier that assigns taxonomic labels to short reads [20]. We applied a Kraken confidence filter of 0.05 and a minimum hit group of 5 for a k-mers-based querying against the RefSeq WGS database (version 2024–11) database including archaea, bacteria, fungi, protozoa, and viruses. This database maps each k-mer to the lowest common ancestor (LCA) across genomes in the taxonomic tree. To reduce false positives and laboratory artifacts, raw reads were first mapped against known contaminants, including the host insect genome and PhiX, using Bowtie2. Only unaligned reads were retained for microbial profiling. The set of LCA taxa that correspond to the k-mers in a read are then analyzed to create a single taxonomic label for the read [21].

2.5. Phylogenetic Analysis of Identified Viruses

The deduced amino acid sequences of predicted ORF regions or RdRP of newly identified viruses were used to calculate their phylogenetic relationship with other members of each respective family. Closely related viruses were identified through BLASTp analysis against the NCBI non-redundant protein database (nr V5). Viral protein sequences with ≥30% amino acid identity and ≥50% query coverage were downloaded and used for downstream phylogenetic analysis and comparison.
Multiple amino acid sequence alignments were generated using MUSCLE. Phylogenetic trees were inferred using the IQ-TREE web server (ModelFinder v2.1) to identify the best-fit substitution model based on Bayesian Information Criterion (BIC). We used the JTT+G model with discretised gamma rate distribution (four categories), a gamma shape parameter of 1.0, and 1000 bootstrap replicates. Appropriate outgroups were selected for each phylogenetic tree.

3. Results and Discussion

High-throughput sequencing of the D. citri RNA samples from Savai’i (SAV), northern Upolu (UP01), and southern Upolu (UP02) generated 90,858,236; 98,811,204; and 121,917,432 raw reads for each sample, respectively. On average, 80–85% of reads mapped to the D. citri genome and were excluded from downstream viral analysis. Assembly using MetaSPAdes produced an average of 44,382 scaffolds longer than 500 base pairs. These assembled sequences were then queried against the NCBI database using BLAST, revealing similarity to a range of insect-specific and plant viruses present in the gut samples from all these populations. Several novel viral sequences (summarised in Table 1 and Table 2) were identified. However, due to the lack of definitive evidence confirming D. citri as the host organism, we refer to them as Diaphorina citri-associated viruses.

3.1. Single-Stranded Positive-Sense RNA Viruses

3.1.1. Hypoviridae

We identified a new member of Hypoviridae from D. citri samples collected from Samoa and tentatively named it Diaphorina citri-associated hypovirus 1 (DcHV1). This sequence is accessible with NCBI GenBank accession number of PV821379. Members of this family are capsid-less viruses with positive-sense RNA genomes of 7.3–18.3 kb that possess either a single large open reading frame (ORF) or two ORFs [22]. The complete genome sequence consisted of a single positive-stranded RNA genome of 11,431 nucleotides and included one open reading frame with 3468 amino acids and a predicted molecular weight of 394.437 kDa (Table 1). We detected four major domains including DNA/RNA polymerase, P-loop containing nucleoside triphosphate hydrolase, Helicase superfamily (ATP-binding domain), and a protein domain of unknown function (DUF3525) on this viral sequence (Table 2). The new virus (DcHV1) was exclusively detected in D. citri samples obtained from the northern region of Upolo, with no evidence of its presence found in any other areas. Based on multiple alignments of the deduced amino acid sequences of their predicted polyproteins, phylogenetic analysis showed that DcHV1 and Wuhan insect virus 14, which is an unclassified hypovirus identified in fleas and ants through meta-transcriptomics, were placed under the Alphahypovirus clade along with other hypoviruses isolated from fungi (Figure 1A).
DcHV1 exhibited the highest level of sequence similarity at the amino acid level with Chuzhou tick virus 1 (UYL95331.1), which was previously detected in the Asian monitor lizard tick (Amblyomma varanense). The recently identified viral genome exhibited amino acid sequence identities of 57.73% and 57.11% with Wuhan insect virus 14 and Apis hypovirus 1, respectively. Additionally, it shared 57.29% sequence identity with Fusarium sacchari hypovirus 1, which was identified in Fusarium sacchari strain FJ-FZ06. This strain is known to be a causative agent of sugarcane Pokkah Boeng disease in China [23]. Filamentous fungi from both the ascomycetous and basidiomycetous groups have been found to harbor hypovirids. These hypovirids replicate within lipid vesicles derived from the host’s Golgi body and contain double-stranded RNA (dsRNA) as their replicative form [22]. One well-studied member of the Hypoviridae is Cryphonectria hypovirus 1 (CHV1/EP713), which has proven to be an effective biological control agent against the chestnut blight pathogen Cryphonectria parasitica [24]. There have been recent reports of members of this family in arthropods [25]. However, additional experimental validations are required to confirm these arthropods as true hosts.

3.1.2. Yadokariviridae

The Yadokariviridae is currently the sole family in the order Yadokarivirales, which was established in 2021 [26]. This family comprises two genera, Alphayadokarivirus and Betayadokarivirus, and consists of non-segmented positive-sense (+) RNA viruses without a capsid. These recently proposed family members are all fungal viruses, with genome sizes ranging from 3.6 to 6.3 kb and encoding either one or two open reading frames. We identified a single-segment genome sequence of a putative virus (GenBank accession number: PV821380) from the newly established family Yadokariviridae and tentatively named it Diaphorina citri-associated yadokarivirus 1 (DcYv1). The RNA genome consists of 3828 nucleotides, including one open reading frame with 984 amino acids and a predicted molecular weight of 113.104 kDa with an isoelectric point of 9.79 (Table 1). BLASTp searches revealed that the deduced amino acid sequence of its predicted ORF has the highest shared identity (58.68%) with the polyprotein Aspergillus homomorphus yadokarivirus 1 (AZT88626.1), which has previously been reported from the USA [27]. The complete polyprotein of this novel virus also showed around 57% shared identity with 92% coverage with RdRp of Aspergillus foetidus slow virus 2. The RNA-dependent RNA polymerase (RdRP) of yadokarivirids exhibits similarities to various groups of positive-strand RNA viruses within the phylum Pisuviricota. Although yadokarivirids are distantly related to calicivirids that infect animals in the order Picornavirales, they differ in terms of genome organization. We only identified a major domain of RNA-directed RNA polymerase (C-terminal domain) on the viral polyprotein. This viral genome sequence was assembled from 15,746 reads and has only been identified in samples collected from the north of Upolo (Table 2). The maximum likelihood phylogeny analysis placed this novel virus within the Alphayadokarivirus group, alongside other fungal viruses from this family (Figure 1B).
Yadokariviridae viruses have been discovered in various ascomycetous fungi and environmental samples worldwide [27]. It has been observed that all known yadokarivirids coexist with diverse dsRNA viruses within a single host fungus, indicating a potential partnership [26]. However, during our investigation, we only identified one contig exhibiting sequence similarity to known yadoka-like viruses. While each yadokarivirid demonstrates species-level specificity with its partner, as a whole, yadokarivirids have the ability to associate with diverse dsRNA viruses from two families, one genus that has yet to be assigned to a family, and two additional unclassified groups within the Ghabrivirales order. To the best of our knowledge, there are no reports of this virus infecting insects or other arthropods, and it is more likely that we identified DcYv1 in some fungi-infected D. citri. Nonetheless, further research is necessary to comprehensively understand the diversity, ecology, and biological significance of Yadokariviridae.

3.1.3. Botourmiaviridae

The family Botourmiaviridae includes mono- or multi-segmented viruses with positive-sense RNA genomes that mainly infect plants and fungi. It consists of twelve genera, among which Ourmiavirus is notable as it represents plant viruses with non-enveloped bacilliform virions composed of a single coat protein. Additionally, Botoulivirus, Magoulivirus, and Scleroulivirus are the primary genera known for infecting fungi. These viruses have genomes ranging in size from 2 to 5 kb, containing a single open reading frame [28]. Recently several new members of this family have been identified in metagenomic analyses of insect and tick viriomes [29,30]. We identified two viral sequences similar to previously reported viruses from Botourmiaviridae and tentatively named them Diaphorina citri-associated ourmia-like viruses 1 and 2 (DcOv1 and 2) mainly from Savai’i. Each RNA genome consists of 1739 (DcOv1) and 1134 (DcOv2) nucleotides, including one open reading frame with 495 and 375 amino acids, respectively. The newly identified sequences were deposited in the NCBI GenBank under the accession numbers of PV821381 and PV821382.
The DNA/RNA polymerase superfamily domain has been detected on the DcOv1 sequence, while no conserved domain has been identified on DcOv2. The deduced amino acid sequence of DcOv1 shows 50.51% shared identity with Tianjin Botou tick virus 4, which was recently reported from Haemaphysalis longicornis ticks in China. Moreover, DcOv1 clusters with other members of this family, including Fusarium solani ourmia-like virus 1, a fungal virus, with 47.76% shared identity. DcOv2 displayed a 53% sequence similarity to another recently identified virus found in the same tick species (H. longicornis). Furthermore, DcOv2 exhibited significant similarity to other ourmia-like viruses isolated from the grape powdery mildew fungus (Erysiphe necator). These related viruses include Erysiphe necator-associated ourmia-like virus 16, 109, 82, 91, and 74, which all are assigned to the genus Ourmiavirus (Figure 2).
Leviviridae-like viruses, including Botourmiaviridae, Narnaviridae, and Mitoviridae, share close evolutionary relationships and have diverged from Lenarviricota, the direct descendant of bacteriophages. Recent studies have identified additional members of these virus families in invertebrates such as insects and ticks [30]. It has been proposed that horizontal virus transfer among different hosts, including plants, fungi, and invertebrates, played a significant role in shaping the evolutionary pathway of Lenarviricota [31]. Recently, a meta-analysis revealed the discovery of two new members of the Botourmiaviridae family from publicly available RNA-Seq data of a cockroach (Loboptera decipiens) and a euonymus scale insect (Unaspis euonymi) [29]. Furthermore, approximately 25% of the total newly identified viruses in a recent metavirome analysis of 31 tick species were classified under Botourmiaviridae, with reads associated with this viral family being highly abundant across most examined tick genera [30].

3.1.4. Other ssRNA (+) Viruses

We identified a 1650 nt viral sequence with a single open reading frame, which contains C-terminal and catalytic domains of RdRP in the family Nodaviridae of positive-sense single-stranded RNA viruses. The Nodaviridae contains two genera that infect insects (Alphanodavirus) or fish (Betanodavirus). An important example of a virus from this family is the Nodamura virus, which was initially isolated from Culex tritaeniorhynchus mosquitoes in Japan [32]. Interestingly, despite possessing a conserved Nodaviridae RdRp domain, this newly identified virus associated with D. citri does not exhibit any similarity to other members of this family. Instead, a BLASTx analysis revealed its similarity to Penicillium vanoranjei-associated RNA virus 1, along with other virga-like and unclassified viruses. However, the phylogenetic analysis did not associate it with any other defined genus in the Virgaviridae family but rather grouped it with some other unclassified virga-like viruses that were previously reported from fungi (Figure 3A).
The Virgaviridae family includes plant viruses characterized by their rod-shaped virions and a single-stranded RNA genome. Within this family, the typical member is the Tobacco mosaic virus, which belongs to the Tobamovirus genus. Currently, there are seven approved genera with approximately 60 species classified under this family. The genome size of these viruses ranges from 6.3 to 13 kilobases (kb) of positive-sense RNA [33]. In the Tobamovirus genus, the genome is non-segmented, while in other genera, it is multipartite, with segments separately encapsidated in two or three components. In recent metagenomic studies, numerous novel insect-associated viruses closely related to members of this family have been reported [34,35]. There is also a possibility that this sequence has become integrated into the insect genome, justifying its classification as an endogenous viral element (EVE). In a previous study, several viral-like fragments exhibiting similarity to virga-like viruses were annotated as EVEs in neotropical Mansoniini mosquito species [36]. In our study, the viral fragment identified was smaller than the expected size range for members of the Virgaviridae family, and only a limited number of reads corresponding to this virus were detected in a single sequenced sample from individuals collected on Savai’i. This sequence (DcV1) has been submitted to NCBI GenBank under the accession number PV821383 (Table 2).
We also identified several small narna-like viruses in D. citri transcriptome data (DcNV1-DcNV10). The newly identified sequences were deposited in the NCBI GenBank under the accession numbers PV821384 to PV821393 (Figure 3B). The members of the family Narnaviridae do not encode capsid proteins, and their genomes are a single positive-strand RNA molecule ranging from about 2.3 to 3.6 kb [37]. This family includes two genera, Narnavirus and Mitovirus, whose members have a similar genome organization but differ in their subcellular localization, and they have been found in cytosol and mitochondria, respectively [37]. The DcNV3 possesses the longest viral genome, spanning 3552 nucleotides (nt), and exhibits a significantly larger assembly coverage (1126.5×). This particular narnavirus was consistently detected across all RNA-Seq libraries from both Samoan islands. Notably, a large number of reads corresponding to DcNV9 were observed in all geographic samples. In contrast, other members of this virus family were only detected in samples collected from the northern region of Upolu (Table 2).
Although the members of the Narnaviridae family have traditionally been identified as associated with plant, fungi, and protozoa [38,39,40,41], several recent studies have found many narna-like viruses in invertebrates including insects [42,43]. As ACP can potentially carry a variety of fungi and bacteria, we can assume that DcNV possibly replicates in insect-associated yeast or insect endosymbiont microbiota. However, a recent study showed that a novel narnavirus (CxNV1) can replicate in a Culex tarsalis cell line that is free from any fungal or bacterial contamination [42]. Another recent study identified several members of Narnaviridae in ectoparasitic fleas (Spilopsyllus cuniculi and Xenopsylla cunicularis) and their associated vertebrate host, the European rabbit (Oryctolagus cuniculus) [43]. Narnaviruses have a single ORF that encodes viral RNA-dependent RNA polymerase; however, another ORF has been determined on the minus strand of the closely related narnavirus in Culex (CxNV1) with no homology to other known viral proteins [42]. In some of these novel narna-like viruses, we also identified a smaller ORF in the negative strand of the viral genome, which can perhaps facilitate viral infection in insects.
Splipalmiviruses are recently classified viruses that have a distinct characteristic of splitting the RdRp palm domain into two proteins [44]. They are similar to yeast narnaviruses and belong to the phylum Lenarviricota and the kingdom Orthornavirae. The genome is comprised of multi-segmented, positive-sense, single-stranded RNA [45]. We identified four RNA segments of a novel Splipalmivirus, temporarily named Diaphorina citri-associated splipalmivirus (DcSV1). The corresponding sequences are available in the NCBI GenBank under accession codes PV821394–PV821397. The majority of the segments were isolated from the D. citri population collected in northern Upolo, with only three read counts in the southern Upolo sample and none isolated from the Savai’i sample. RNA1 and RNA2 segments of DcSV1 had genome lengths of 2164 and 2273 nucleotides, respectively. The RNA3 segment was 1459 nucleotides long, while the RNA 4 segment was significantly shorter with only 533 nucleotides. Two of the segments, RNA2 and RNA4, showed a single open reading frame, while RNA1 had two open reading frames. RNA3 had the most ORFs with four ORFs. No identifiable domains were observed for the novel DcSV1. The BLASTp search of the RNA1 segment of the novel virus showed sequence similarity of 70.10% with RNA-dependent RNA polymerase of Cryphonectria naterciae splipalmivirus 1 (BCX55509.1). The RNA 2 and RNA 3 segments also showed maximum sequence identity with hypothetical proteins of this same virus. In the phylogenetic analysis, the ML tree also showed close grouping of segments 1, 2, and 3 with Cryphonectria naterciae splipalmivirus 1 (Figure 4). As this is a fungal virus, it suggests that D. citri is not the primary host of the novel DcSV1.

3.2. Single-Stranded Negative-Sense RNA

3.2.1. Mymonaviridae

We identified a member of the mymona-like virus in all three RNA-seq libraries, with an average assembly coverage of 92.17x. The putative viral sequence, spanning 9708 nucleotides, was assembled from 9730 Illumina short reads. This viral sequence showed the highest abundance in the D. citri population in northern Upolo, with 5353 reads, and a lower density in the sample collected from Savai’i, with 1261 reads. We provisionally named this virus Diaphorina citri-associated mymona-like virus 1 (DcMv1), and the sequence has been submitted to NCBI GenBank under the accession number PV821398. The DcMv1 genome contains five major non-overlapping open reading frames, which encode proteins referred to as p I (415 aa), NP (269 aa), p III (290 aa), p IV (143 aa), and L (1910 aa) protein. In our analysis of the viral genome sequence, we identified two significant domains: the Mononegavirales RNA-directed RNA polymerase catalytic domain and the Mononegavirales mRNA-capping domain V (Table 2). These domains play crucial roles in the replication and transcription of the viral RNA. The discovery of DcMv1 and the characterization of its genome provide valuable insights into the genetic composition and diversity of mymona-like viruses.
The L protein of DcMv1 exhibits a sequence identity of 57.60% with 26% coverage of Leptosphaeria biglobosa negative single-stranded RNA virus 4 (Table 1). This particular virus was identified through a metagenomic study of environmental samples in China. In addition, closely related viruses have been discovered in various invertebrate samples. Hubei rhabdo-like virus 4 (YP_009336595.1) was previously detected in a mixture of arthropod samples in China, Kiln Barn virus (YP_010797581.1) was isolated from Drosophila suzukii in the UK, and Jimsystermes virus (YP_010800904.1) was found in Australian termites (Occasitermes sp.). The L protein of DcMv1 shares sequence identities of 30.94%, 31.26%, and 29.38% with these viruses, respectively. Based on our phylogenetic analysis and examination of the genome structure, it is suggested that DcMv1 potentially belongs to the genera Hubramonavirus and is distinct from other members of the Mymonaviridae family (Figure 5A).
In this study, the newly discovered virus DcMv1was identified belonging to Mymonaviridae, a family of negative-strand RNA viruses within the order Mononegavirales, with fungi serving as their natural hosts. While mymonavirids typically infect filamentous fungi, there have been a few instances where they have been identified in association with insects, oomycetes, or plants [46]. In the previous meta-analysis conducted by Wu et al. (2020), it was observed that the mononega-like viruses were the predominant single-stranded RNA (ssRNA) viruses identified, being present in over 15% of the sampled insect species [29]. These findings highlight the high prevalence and importance of mononega-like viruses within insect populations. These viruses are characterized by the production of filamentous, enveloped virions containing a single molecule of linear RNA, typically measuring around 10 kilobases in length. Within the Mymonaviridae family, there are nine genera and nearly 50 known species. One well-studied virus in this family is Sclerotinia sclerotiorum negative-stranded RNA virus 1, which exhibits distinctive genomic features such as the absence of a poly(A) tail at the 3′-terminus and an uncapped 5′-terminus. Further investigation is required to assess the impact of DcMv1 on the D. citri population and its role in the ecology and dynamics of viral infections within this species. While this family is primarily known for infecting fungi, the identification of other members of this family in arthropods, detection of DcMv1 in all three D. citri RNA-Seq libraries, and with its high coverage raise the possibility that these viruses may also infect insects. In some cases, insects can serve as vectors for fungal viruses, facilitating their distribution. Previous reports have indicated that fungal viruses, such as Sclerotinia sclerotiorum hypovirulence-associated DNA virus 1, can be transmitted through insect vectors, expanding our understanding of the transmission mechanisms of fungal viruses beyond traditional routes [47]. This highlights the need for comprehensive studies to explore the potential role of insects as vectors for the dissemination of mycoviruses, including DcMv1.

3.2.2. Discoviridae

We have discovered a new member of the recently proposed Discoviridae family (Figure 5B). The member of this family, a negative-sense bunyavirus-like RNA virus, was originally identified in Penicillium roseopurpureum during a virome study of fungi associated with the sea cucumber Holothuria poli [48]. Based on the genome organization and phylogenetic analysis of the viral RdRp, it is evident that this virus shares similarities with bunyaviruses but may not fit precisely within the established taxa or specific subgroups of the bunyavirus family. Therefore, in 2021, the proposal was made to establish a new genus called Orthodiscovirus within the newly proposed family, Discoviridae [49]. This virus consists of three monocistronic genome segments, which encode different components: a RdRp (RNA1), a non-structural protein (Ns; RNA2), and a nucleocapsid (Nc; RNA3). Among these segments, the longest one (DcDv-L) is 6556 nucleotides long and encodes a single open reading frame consisting of 2131 amino acids. The other two segments, M and S, are shorter in length, with 1221 and 1054 nucleotides, respectively, and each encodes a polyprotein. The newly identified sequences were deposited in the NCBI GenBank under the accession numbers of PV821414, PV821415, and PV821416. The bunyaviral RdRp domain has been detected within the L segment of this particular virus. The deduced amino acid sequence of the L segment of this newly identified virus shows 57% sequence similarity (99% query coverage) with Penicillium discovirus. This virus also showed about 50% similarity to a few other tick viruses that were recently reported from China and the USA, such as Zhangzhou tick virus 1 (host: Rhipicephalus sanguineus), Ixodes scapularis-associated virus-5, and Guyuan tick virus 1 (host: Haemaphysalis japonica).

3.3. Double-Stranded RNA Viruses

3.3.1. Partitiviridae

We identified seven bi-segmented partitiviruses associated with D. citri. They were tentatively named DcPV1 to DcPV7, and their newly identified sequences were deposited in the NCBI GenBank under the accession numbers of PV821400–PV821413 (Table 1). The Partitiviridae consists of small, isometric, non-enveloped viruses with bi-segmented dsRNA genomes ranging from 3 to 4.8 kbp. [50]. The largest partiti-like virus associated with D. citri is DcPV1 which has 2312 nt and 2196 nt in segments 1 and 2, respectively. Most of these novel viruses were identified in samples from northern Upolu. A Mononegavirales RdRp catalytic domain was detected on the first segment of DcPV1. Its deduced amino acid sequence showed high similarity to the coat protein of human blood-associated partitivirus and was classified under the Betapartitivirus clade by maximum-likelihood phylogenetic analysis. Two other Diaphorina citri-associated partitiviruses (DcPV2 and DcPV3) were found to share homology with two other fungal viruses, Leptosphaeria biglobosa partitivirus 1 and Lasiodiplodia ziziphi partitivirus 1, respectively, and are more likely members of the Alphapartitivirus genus based on their phylogenetic relationship with other known members of this genus (Figure 6A). DcPV7, which shares homology with Cordyceps chanhua partitivirus, grouped with other members of Gammapartitivirus genera. Other newly identified Diaphorina citri-associated partitiviruses made a distinct clade with many other unclassified members of Partitiviridae, which are newly reported form other arthropods and fungi.
Within the Partitiviridae, there are five distinct genera, each exhibiting a preference for specific hosts: plants or fungi for the Alphapartitivirus and Betapartitivirus genera, fungi for the Gammapartitivirus genus, plants for the Deltapartitivirus genus, and protozoa for the Cryspovirus genus. The transmission of partitiviruses occurs intracellularly through various means, but no natural vectors have been identified for these viruses. Currently, there are 45 species assigned to the five partitivirus genera, with an additional 15 species that have yet to be assigned to a specific genus [50]. Similar to many other group viruses, metagenomic surveys have revealed that partitivirus-like sequences are also commonly associated with arthropods and other invertebrates. One arthropod-associated partitivirus, Galbut virus, is prevalent in wild populations of Drosophila melanogaster. Vertical transmission of this virus from either infected females or infected males is similar to Verdadero virus, another recently discovered partiti-like virus in a laboratory colony of Aedes aegypti mosquitoes [51]. Recently, three non-segmented parititi-like viruses were also identified in omnivorous insects such as the ant beetle (Thanasimus formicarius), the shore beetle (Haliplus fluviatilis), and a Collembola (Tetrodontophora bielanensis) [29]. It was previously thought that members of the Partitiviridae possessed two genomic segments. However, the identification of the capsid-encoded segment within these newly discovered insect-associated virus groups including DcPVs might change our understanding of this family. It appears that insects harbor a significantly diverse community of partitiviruses, which could potentially serve as primary reservoirs and/or transmission vectors for partitiviruses found in plants or fungi.

3.3.2. Totiviridae

The Totiviridae are non-enveloped, double-stranded positive sense RNA viruses with icosahedral virions, which consist of a single capsid protein [52]. This is the first report of a toti-like virus in ACP, which we have tentatively named Diaphorina citri-associated toti-like virus (DcTv1). The complete genome sequence of this novel virus (GenBank accession number: PV821399) consists of two open reading frames within a single segment of 5039 bp (Figure 6B) with a 62.4% G + C content. The genome has 281 and 48 nucleotides in its 5′ and 3′ UTR, respectively. The first ORF is 2331 nt, produces 777 amino acids (aa), and shares 65.6% aa sequence identity (query coverage, 87%) with the coat protein of Erysiphe necator-associated totivirus 1, which was identified in Italy through a study of mycovirome associated with the plant pathogenic fungus Erysiphe necator. This ORF also showed 39.7% aa sequence similarity with 79% query coverage to Hangzhou totivirus 4 (UHK03338.1), which was isolated from zigzag leafhopper (Recilia dorsalis) in China (PRJNA629998). Luoyang Totiv tick virus 4 (UYL95684.1) isolated from the Asian longhorned tick Haemaphysalis longicornis in China had the maximum sequence coverage of 86% (sequence similarity of 58.1%) with the first ORF of this newly identified virus. The second ORF consists of 767 aa and showed the maximum shared sequence identity (59.6%) and coverage (97%) with RNA-dependent RNA polymerase of Erysiphe necator-associated totivirus 1 (QLC27590.1)
Traditionally, fungi and protozoa have been recognised as hosts for viruses from Totiviridae, but recent metagenomic analysis has revealed that they also infect much more advanced hosts. Several unclassified toti-like viruses have been identified from arthropods, fish, worms, and insectivorous bats [53,54,55], and the discovery of DcTv1 may provide further evidence to support their wider host range. However, the disease-causing potential and economic impact of these viruses in agriculture and public health is poorly described.

3.3.3. Polymycoviridae

In this study, we identified the RNA4 segment of a novel double-stranded RNA virus (NCBI access code: PV821417). The RNA4 segment of polymycoviruses is a proline-alanine-serine protein-rich segment [56]. The virus sequence had a length of 1072 nt and a single open reading frame consisting of 318 aa. This segment sequence was obtained from all three location samples of D. citri. We putatively named it Diaphorina citri-associated polymycovirus (DcPMv) belonging to the Polymycoviridae family. Members of the Polymycoviridae family have a viral protein coat and can have either four or eight segments [56]. They have been isolated from various fungal hosts [57,58] and have yet to be identified from insects.
BLASTp results showed maximum alignment score and 56.03% shared identity with the PAS-rich protein region of Alternaria alternata polymycovirus 2 (WEW73497.1), which was isolated from grapevine trunk, but since it is a common pathogen of the A. alternata fungus, this newly discovered virus is likely to be of fungal origin. It also showed 55.65% shared identity with Ustilaginoidea virens polymycovirus 1 (WSP07094.1) and 50.92% shared identity with Setosphaeria turcica polymycovirus 2 (UMZ56990.1). Additionally, it showed 88% query coverage and 50.35% shared identity with Cladosporium cladosporioides virus 1 (YP_009052473.1). It also showed that DcPMv is grouping with these above viruses in the maximum likelihood tree (Figure 7). The lower read count in comparison with other identified novel viruses in this study coupled with the fact that polymycoviruses have primarily fungal hosts indicates that DcPMv is a fungal virus rather than an insect-specific virus.

3.4. Microbiota Diversity and Screening for the CLas

We previously screened 287 D. citri specimens collected in 2019 for CLas. No PCR amplification was observed in any of the samples, indicating the likely absence of the pathogen in the tested population. The positive control confirmed that the PCR assay was successful, ruling out the possibility of technical failure (Figure S2). However, false negative rates are considered high, as the probability of detecting the bacterium can vary depending on the time of year and the physiological age of the host plant, which may influence pathogen titre and detectability [59,60]. Screening a large number of individuals and conducting sequential surveillance throughout the year are therefore recommended [59]. Therefore, although all screened samples showed no evidence of being infected by the bacteria, we cannot entirely confirm that it is absent from Samoa. Further screening would be prudent with a focus on obtaining samples from plants that are more likely to be infected.
To assess the presence or absence of CLas in the Samoan population of D. citri, we also characterised the microbiota composition of the sequenced samples using Kraken2. The microbiome profiles were found to be highly consistent across all three sampling locations, indicating a stable core microbial community within this population (Figure 8). This analysis serves as a preliminary catalogue of putative bacterial taxa, and any interpretations regarding their presence should be treated with caution until validated through targeted wet lab experiments. D. citri harbors a diverse assemblage of microorganisms that play critical roles in its physiology, fitness, and capacity to transmit pathogens such as CLas. This community includes both bacterial endosymbionts and fungal associates, each of which may influence the psyllid’s survival, reproductive success, and vector competence.
The most abundant identified taxa include Ca. Carsonella ruddii, Wolbachia endosymbiont of D. citri, Ca. Profftella armatura, and several other species contributing to the microbiota diversity in these populations (Figure 8 and Supplementary Table S1). Among them, the phylum Proteobacteria was identified as a dominant group of bacteria with 73.3% of the abundance, which is recognised for their diversity and significance in a variety of ecological roles, including symbiotic relationships with arthropods. The primary endosymbiont Wolbachia, belonging to the Alphasproteobacteria class, a common symbiotic bacterium frequently identified in arthropod vectors, was the most prevalent bacterium among them. Wolbachia is known to exert various effects on its hosts, most notably the capacity to control reproduction through processes like cytoplasmic incompatibility (CI). CI helps in maternal transmission of the bacteria, in which only females infected with a particular Wolbachia strain can successfully produce embryos with both infected and uninfected males [61].
Previous studies showed that the Wolbachia in the larvae of the Phyllonorycter blancardella can promote the secretion of cytokinins from leaves, delay leaf senescence, and increase the host’s feeding time on leaves [62]. The improvement of this adaptability is of great significance for insect hosts to survive and reproduce in complex and changing ecological environments. Symbiotic microorganisms can also affect the transmission of pathogenic microorganisms by vector insects, affecting the growth and development of plants and the process of pathogen transmission. Studies have shown that the transmission efficiency of Bergomovirus by tobacco whiteflies infected with the endosymbiotic microorganism Wolbachia is improved [63].
Additionally, two species from the Candidatus genus were identified, C. Carsonella ruddii and C. Profftella armatura. A combination of these species has been previously reported from psyllids, and they are known endosymbionts of D. citri [64,65]. These bacteria contributed to 10–12% and 5–7% of the total bacterial reads, respectively. In particular, C. Carsonella ruddii is involved in the biosynthesis of essential nutrients that the insect host cannot obtain from its diet, while C. Profftella armatura has been associated with the production of defensive compounds like toxins that protect the holobiont [66]. The bacterium Oecophyllibacter saccharovorans exhibited a high read count, particularly in the UPO2 sample from southern Upolu, with over 100,000 reads. This bacterium has been previously associated with the weaver ant, Oecophylla smaragdina [67]. The high abundance of O. saccharovorans in D. citri at this location suggests possible site-specific environmental factors or interactions with other organisms that promote its proliferation.
Although no CLas positive D. citri individuals were detected using conventional PCR, Kraken2 analysis revealed low read counts (approximately 8–16) assigned to CLas across the samples. Given the high total read depth per sample, these low-abundance hits are likely to represent background noise or spurious taxonomic assignments. Moreover, these reads did not align to genomic regions uniquely specific to CLas, further suggesting the possibility of misclassification rather than true presence (Supplementary Table S1).
Beyond bacterial symbionts, fungal organisms were also identified across all three sampling locations. Among these, Botrytis cinerea—a well-known plant pathogen responsible for grey mould disease—was detected specifically in samples from South Upolu (UPO2) and Savai’I (SAV1). The presence of B. cinerea in the microbiome of D citri suggests a potential ecological interaction involving the psyllid, the fungus, and the host plants. While the nature of this association remains uncertain, it may reflect environmental exposure, incidental ingestion, or a more complex tripartite relationship.
During our virome analysis of D. citri, we identified several viral sequences that are more likely to infect fungal hosts than insects. The concurrent detection of diverse fungal taxa in the D. citri microbiome supports the presence of mycoviruses within these samples. Notably, Neurospora crassa, a well-established model organism for studying mycovirus replication [68], was detected at the SAV1 site, comprising 1.84% of the total reads. These findings suggest that some of the newly identified viruses may be associated with fungal species residing in the D. citri gut, rather than the insect itself. Further investigation using small RNA sequencing could help elucidate the complex interactions between these viruses and their potential fungal hosts.
Overall, our results highlight the potential for both fungi and their associated viruses to influence the structure and function of the D. citri microbiome, with possible implications for the insect’s health, ecology, and vectoring capacity. Further research could involve culturing the identified endosymbionts in the laboratory and performing functional assays to determine their roles in the biology of D. citri. This might be further explored by using antibiotic treatments to selectively eliminate specific bacteria and evaluate the resulting effects on the psyllid host’s survival, as well as D. citri reproduction and its ability to transmit plant pathogens. Additionally, studying the mechanisms of vertical transmission would provide insights into how these symbionts are maintained across generations, potentially influencing the evolutionary success of the insect host. Understanding the complex interplay between bacteria, fungi, and viruses within the D. citri microbiome could also lead to new strategies for controlling this pest. This study of D. citri’s microbiome provides a better understanding of the symbiotic relationships that may contribute to the psyllid’s adaptability and effectiveness as a pest, with important implications for pest management strategies in agriculture.

4. Conclusions

The use of insect-specific viruses as biocontrol agents represents a promising and increasingly explored strategy for managing vector-borne plant diseases. Advances in high-throughput sequencing technologies have significantly enhanced our ability to detect and characterize novel viruses; however, our understanding of the geographical viromes of D. citri populations remains limited. Despite the ecological and economic importance of D. citri as a vector of CLas, only a small number of viruses have been thoroughly characterised in this species, and the complexity of their interactions with the insect host and associated plant pathogens is still poorly understood.
Previous studies have identified several viral families in D. citri, including picorna-like, flavi-like, mymonaviruses, and reoviruses, confirming the presence of insect-specific viruses. In contrast, our study did not detect many of these previously reported viruses. Instead, we identified several novel viruses associated with D. citri populations in Samoa, including partitivirus-like and bunyavirus-like viruses not previously reported in this vector. Phylogenetic analysis revealed that these newly identified viruses belong to a diverse range of viral families, including Hypoviridae, Yadokariviridae, Botourmiaviridae, Nodaviridae, Narnaviridae, Discoviridae, Partitiviridae, Totiviridae, Polymycoviridae, and Splipalmiviridae.
Our study expands the known virome diversity of D. citri and highlights potential regional variation in viral communities. However, significant knowledge gaps remain regarding the functional roles of these viruses, their potential for manipulating vector biology, and their broader implications for disease transmission dynamics.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/pathogens14080801/s1, Figure S1: Map of the Samoan Islands showing Upolu (A) and Savai’i (B), with marked sampling sites and survey locations.; Figure S2: PCR detection of Ca. Liberibacter spp. in Asian citrus psyllid samples. Table S1: Taxonomic composition of sequences detected in three samples based on Kraken 2 analysis. Counts represent the number of sequence reads assigned to each taxonomic group in each sample..

Author Contributions

Conceptualization, K.E.; methodology, K.E., A.M.T., G.D., O.A.U., S.S.A.T., E.V., H.S. and L.U.; software, K.E.; formal analysis, K.E. and G.D.; investigation, K.E.; resources, A.M.T., G.D., O.A.U., S.S.A.T., E.V., H.S., L.U. and M.J.F.; data curation, K.E. and G.D.; writing—original draft preparation, K.E. and G.D.; writing—review and editing, K.E., A.M.T., Y.R. and M.J.F.; visualization, K.E. and G.D.; supervision, K.E. All authors have read and agreed to the published version of the manuscript.

Funding

This project was funded by the Australian Centre for International Agricultural Research funding (HORT/2016/185).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Deep sequencing raw data were deposited in the National Centre for Biotechnology Information’s (NCBI’s) Sequence Read Archive (SRA) and are accessible through BioProject series accession number PRJNA1275559.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Das, A.K.; Rao, C.N.; George, A.; Chichghare, S.A. Molecular identification and characterization of the Asian citrus psyllid vector, Diaphorina citri (Hemiptera: Psyllidae) and the transmitted Huanglongbing-associated bacterium, Candidatus Liberibacter asiaticus in India. J. Plant Pathol. 2022, 104, 1097–1110. [Google Scholar] [CrossRef]
  2. Zhang, J.; Liu, Q.; Dai, L.; Zhang, Z.; Wang, Y. Pan-Genome Analysis of Wolbachia, Endosymbiont of Diaphorina citri, Reveals Independent Origin in Asia and North America. Int. J. Mol. Sci. 2024, 25, 4851. [Google Scholar] [CrossRef]
  3. Wang, Y.; Kondo, T.; He, Y.; Zhou, Z.; Lu, J. Genome Sequence Resource of ‘Candidatus Liberibacter asiaticus’ from Diaphorina citri Kuwayama (Hemiptera: Liviidae) in Colombia. Plant Dis. 2021, 105, 193–195. [Google Scholar] [CrossRef]
  4. Abreu, E.F.M.; Lopes, A.C.; Fernandes, A.M.; Silva, S.X.B.; Barbosa, C.J.; Nascimento, A.S.; Laranjeira, F.F.; Andrade, E.C. First Report of HLB Causal Agent in Psyllid in State of Bahia, Brazil. Neotrop. Entomol. 2020, 49, 780–782. [Google Scholar] [CrossRef]
  5. Boina, D.R.; Bloomquist, J.R. Chemical control of the Asian citrus psyllid and of huanglongbing disease in citrus. Pest. Manag. Sci. 2015, 71, 808–823. [Google Scholar] [CrossRef] [PubMed]
  6. Tiwari, S.; Mann, R.S.; Rogers, M.E.; Stelinski, L.L. Insecticide resistance in field populations of Asian citrus psyllid in Florida. Pest. Manag. Sci. 2011, 67, 1258–1268. [Google Scholar] [CrossRef]
  7. Kanga, L.H.; Eason, J.; Haseeb, M.; Qureshi, J.; Stansly, P. Monitoring for Insecticide Resistance in Asian Citrus Psyllid (Hemiptera: Psyllidae) Populations in Florida. J. Econ. Entomol. 2016, 109, 832–836. [Google Scholar] [CrossRef]
  8. ZHANG, Y.; LI, Z.; CHEN, Q. Effect of seven viral endosymbionts on the fecundity of Diaphorina citri. J. Biosaf. 2022, 31, 163–170. [Google Scholar] [CrossRef]
  9. Nouri, S.; Salem, N.; Nigg, J.C.; Falk, B.W. Diverse Array of New Viral Sequences Identified in Worldwide Populations of the Asian Citrus Psyllid (Diaphorina citri) Using Viral Metagenomics. J. Virol. 2016, 90, 2434–2445. [Google Scholar] [CrossRef]
  10. Lin, C.-Y.; Buritica, J.R.; Sarkar, P.; Jassar, O.; Rocha, S.V.; Batuman, O.; Stelinski, L.L.; Levy, A. An insect virus differentially alters gene expression among life stages of an insect vector and enhances bacterial phytopathogen transmission. J. Virol. 2025, 99, e01630-24. [Google Scholar] [CrossRef] [PubMed]
  11. Nouri, S.; Matsumura, E.E.; Kuo, Y.W.; Falk, B.W. Insect-specific viruses: From discovery to potential translational applications. Curr. Opin. Virol. 2018, 33, 33–41. [Google Scholar] [CrossRef] [PubMed]
  12. Killiny, N.; Nehela, Y.; Hajeri, S.; Gowda, S.; Stelinski, L.L. Virus-induced gene silencing simultaneously exploits ‘attract and kill’ traits in plants and insects to manage huanglongbing. Hortic. Res. 2025, 12, uhae311. [Google Scholar] [CrossRef]
  13. Sun, K.; Fu, K.; Hu, T.; Shentu, X.; Yu, X. Leveraging insect viruses and genetic manipulation for sustainable agricultural pest control. Pest. Manag. Sci. 2024, 80, 2515–2527. [Google Scholar] [CrossRef]
  14. Ng, T.F.; Duffy, S.; Polston, J.E.; Bixby, E.; Vallad, G.E.; Breitbart, M. Exploring the diversity of plant DNA viruses and their satellites using vector-enabled metagenomics on whiteflies. PLoS ONE 2011, 6, e19050. [Google Scholar] [CrossRef]
  15. Zhang, J.; Xiao, Y.; Hu, P.; Chen, L.; Deng, X.; Xu, M. Report of Citrus tristeza virus in Diaphorina citri (Hemiotera: Liviidae) insects of different sexes, color morphs, and developmental stages. J. Insect Sci. 2024, 24, 13. [Google Scholar] [CrossRef]
  16. Wu, F.; Huang, M.; Fox, E.G.P.; Huang, J.; Cen, Y.; Deng, X.; Xu, M. Preliminary Report on the Acquisition, Persistence, and Potential Transmission of Citrus tristeza virus by Diaphorina citri. Insects 2021, 12, 735. [Google Scholar] [CrossRef]
  17. Nageswara-Rao, M.; Irey, M.; Garnsey, S.M.; Gowda, S. Candidate gene markers for Candidatus Liberibacter asiaticus for detecting citrus greening disease. J. Biosci. 2013, 38, 229–237. [Google Scholar] [CrossRef]
  18. Nurk, S.; Meleshko, D.; Korobeynikov, A.; Pevzner, P.A. metaSPAdes: A new versatile metagenomic assembler. Genome Res. 2017, 27, 824–834. [Google Scholar] [CrossRef] [PubMed]
  19. Kopylova, E.; Noé, L.; Touzet, H. SortMeRNA: Fast and accurate filtering of ribosomal RNAs in metatranscriptomic data. Bioinformatics 2012, 28, 3211–3217. [Google Scholar] [CrossRef]
  20. Wood, D.E.; Lu, J.; Langmead, B. Improved metagenomic analysis with Kraken 2. Genome Biol. 2019, 20, 257. [Google Scholar] [CrossRef] [PubMed]
  21. Wood, D.E.; Salzberg, S.L. Kraken: Ultrafast metagenomic sequence classification using exact alignments. Genome Biol. 2014, 15, R46. [Google Scholar] [CrossRef]
  22. Suzuki, N.; Ghabrial, S.A.; Kim, K.-H.; Pearson, M.; Marzano, S.-Y.L.; Yaegashi, H.; Xie, J.; Guo, L.; Kondo, H.; Koloniuk, I.; et al. ICTV Virus Taxonomy Profile: Hypoviridae. J. Gen. Virol. 2018, 99, 615–616. [Google Scholar] [CrossRef]
  23. Yao, Z.; Zou, C.; Peng, N.; Zhu, Y.; Bao, Y.; Zhou, Q.; Wu, Q.; Chen, B.; Zhang, M. Virome Identification and Characterization of Fusarium sacchari and F. andiyazi: Causative Agents of Pokkah Boeng Disease in Sugarcane. Front. Microbiol. 2020, 11, 240. [Google Scholar] [CrossRef]
  24. Nuss, D.L. Hypovirulence: Mycoviruses at the fungal-plant interface. Nat. Rev. Microbiol. 2005, 3, 632–642. [Google Scholar] [CrossRef] [PubMed]
  25. Shi, M.; Lin, X.D.; Tian, J.H.; Chen, L.J.; Chen, X.; Li, C.X.; Qin, X.C.; Li, J.; Cao, J.P.; Eden, J.S.; et al. Redefining the invertebrate RNA virosphere. Nature 2016, 540, 539–543. [Google Scholar] [CrossRef] [PubMed]
  26. Sato, Y.; Das, S.; Velasco, L.; Turina, M.; Osaki, H.; Kotta-Loizou, I.; Coutts, R.H.A.; Kondo, H.; Sabanadzovic, S.; Suzuki, N.; et al. ICTV Virus Taxonomy Profile: Yadokariviridae 2023. J. General. Virol. 2023, 104, 001826. [Google Scholar] [CrossRef] [PubMed]
  27. Gilbert, K.B.; Holcomb, E.E.; Allscheid, R.L.; Carrington, J.C. Hiding in plain sight: New virus genomes discovered via a systematic analysis of fungal public transcriptomes. PLoS ONE 2019, 14, e0219207. [Google Scholar] [CrossRef]
  28. Ayllón, M.A.; Turina, M.; Xie, J.; Nerva, L.; Marzano, S.L.; Donaire, L.; Jiang, D.; Consortium, I.R. ICTV Virus Taxonomy Profile: Botourmiaviridae. J. Gen. Virol. 2020, 101, 454–455. [Google Scholar] [CrossRef]
  29. Wu, H.; Pang, R.; Cheng, T.; Xue, L.; Zeng, H.; Lei, T.; Chen, M.; Wu, S.; Ding, Y.; Zhang, J.; et al. Abundant and Diverse RNA Viruses in Insects Revealed by RNA-Seq Analysis: Ecological and Evolutionary Implications. mSystems 2020, 5, 10–1128. [Google Scholar] [CrossRef]
  30. Ni, X.-B.; Cui, X.-M.; Liu, J.-Y.; Ye, R.-Z.; Wu, Y.-Q.; Jiang, J.-F.; Sun, Y.; Wang, Q.; Shum, M.H.-H.; Chang, Q.-C.; et al. Metavirome of 31 tick species provides a compendium of 1,801 RNA virus genomes. Nat. Microbiol. 2023, 8, 162–173. [Google Scholar] [CrossRef]
  31. Marzano, S.-Y.L.; Nelson, B.D.; Ajayi-Oyetunde, O.; Bradley, C.A.; Hughes, T.J.; Hartman, G.L.; Eastburn, D.M.; Domier, L.L. Identification of Diverse Mycoviruses through Metatranscriptomics Characterization of the Viromes of Five Major Fungal Plant Pathogens. J. Virol. 2016, 90, 6846–6863. [Google Scholar] [CrossRef]
  32. Sahul Hameed, A.S.; Ninawe, A.S.; Nakai, T.; Chi, S.C.; Johnson, K.L.; Ictv Report, C. ICTV Virus Taxonomy Profile: Nodaviridae. J. Gen. Virol. 2019, 100, 3–4. [Google Scholar] [CrossRef]
  33. Adams, M.J.; Adkins, S.; Bragard, C.; Gilmer, D.; Li, D.; MacFarlane, S.A.; Wong, S.M.; Melcher, U.; Ratti, C.; Ryu, K.H.; et al. ICTV Virus Taxonomy Profile: Virgaviridae. J. Gen. Virol. 2017, 98, 1999–2000. [Google Scholar] [CrossRef]
  34. Parry, R.; James, M.E.; Asgari, S. Uncovering the Worldwide Diversity and Evolution of the Virome of the Mosquitoes Aedes aegypti and Aedes albopictus. Microorganisms 2021, 9, 1653. [Google Scholar] [CrossRef]
  35. Webster, C.L.; Waldron, F.M.; Robertson, S.; Crowson, D.; Ferrari, G.; Quintana, J.F.; Brouqui, J.M.; Bayne, E.H.; Longdon, B.; Buck, A.H.; et al. The discovery, distribution, and evolution of viruses associated with Drosophila melanogaster. PLoS Biol. 2015, 13, e1002210. [Google Scholar] [CrossRef]
  36. da Silva, A.F.; Dezordi, F.Z.; Machado, L.C.; de Oliveira, R.D.; Qin, S.; Fan, H.; Zhang, X.; Tong, Y.; Silva, M.M.; Loreto, E.L.S.; et al. Metatranscriptomic analysis identifies different viral-like sequences in two neotropical Mansoniini mosquito species. Virus Res. 2021, 301, 198455. [Google Scholar] [CrossRef]
  37. Hillman, B.I.; Cai, G. The family narnaviridae: Simplest of RNA viruses. Adv. Virus Res. 2013, 86, 149–176. [Google Scholar] [CrossRef] [PubMed]
  38. Mardanov, A.V.; Beletsky, A.V.; Tanashchuk, T.N.; Kishkovskaya, S.A.; Ravin, N.V. A novel narnavirus from a Saccharomyces cerevisiae flor strain. Arch. Virol. 2020, 165, 789–791. [Google Scholar] [CrossRef] [PubMed]
  39. Zoll, J.; Verweij, P.E.; Melchers, W.J.G. Discovery and characterization of novel Aspergillus fumigatus mycoviruses. PLoS ONE 2018, 13, e0200511. [Google Scholar] [CrossRef] [PubMed]
  40. Lye, L.F.; Akopyants, N.S.; Dobson, D.E.; Beverley, S.M. A Narnavirus-Like Element from the Trypanosomatid Protozoan Parasite Leptomonas seymouri. Microbiol. Resour. Announc. 2016, 4, 10–1128. [Google Scholar] [CrossRef]
  41. Wright, A.A.; Cross, A.R.; Harper, S.J. A bushel of viruses: Identification of seventeen novel putative viruses by RNA-seq in six apple trees. PLoS ONE 2020, 15, e0227669. [Google Scholar] [CrossRef]
  42. Goertz, G.P.; Miesen, P.; Overheul, G.J.; van Rij, R.P.; van Oers, M.M.; Pijlman, G.P. Mosquito Small RNA Responses to West Nile and Insect-Specific Virus Infections in Aedes and Culex Mosquito Cells. Viruses 2019, 11, 271. [Google Scholar] [CrossRef]
  43. Mahar, J.E.; Shi, M.; Hall, R.N.; Strive, T.; Holmes, E.C. Comparative Analysis of RNA Virome Composition in Rabbits and Associated Ectoparasites. J. Virol. 2020, 94, 10–1128. [Google Scholar] [CrossRef] [PubMed]
  44. Sutela, S.; Forgia, M.; Vainio, E.J.; Chiapello, M.; Daghino, S.; Vallino, M.; Martino, E.; Girlanda, M.; Perotto, S.; Turina, M. The virome from a collection of endomycorrhizal fungi reveals new viral taxa with unprecedented genome organization. Virus Evol. 2020, 6, veaa076. [Google Scholar] [CrossRef] [PubMed]
  45. Kondo, H.; Botella, L.; Suzuki, N. Mycovirus Diversity and Evolution Revealed/Inferred from Recent Studies. Annu. Rev. Phytopathol. 2022, 60, 307–336. [Google Scholar] [CrossRef] [PubMed]
  46. Jiāng, D.; Ayllón, M.A.; Marzano, S.-Y.L.; Kondō, H.; Turina, M.; Consortium, I.R. ICTV Virus Taxonomy Profile: Mymonaviridae 2022. J. Gen. Virol. 2022, 103, 001787. [Google Scholar] [CrossRef] [PubMed]
  47. Liu, S.; Xie, J.; Cheng, J.; Li, B.; Chen, T.; Fu, Y.; Li, G.; Wang, M.; Jin, H.; Wan, H.; et al. Fungal DNA virus infects a mycophagous insect and utilizes it as a transmission vector. Proc. Natl. Acad. Sci. USA 2016, 113, 12803–12808. [Google Scholar] [CrossRef]
  48. Nerva, L.; Forgia, M.; Ciuffo, M.; Chitarra, W.; Chiapello, M.; Vallino, M.; Varese, G.C.; Turina, M. The mycovirome of a fungal collection from the sea cucumber Holothuria polii. Virus Res. 2019, 273, 197737. [Google Scholar] [CrossRef]
  49. Kuhn, J.H.; Adkins, S.; Alkhovsky, S.V.; Avšič-Županc, T.; Ayllón, M.A.; Bahl, J.; Balkema-Buschmann, A.; Ballinger, M.J.; Bandte, M.; Beer, M.; et al. 2022 taxonomic update of phylum Negarnaviricota (Riboviria: Orthornavirae), including the large orders Bunyavirales and Mononegavirales. Arch. Virol. 2022, 167, 2857–2906. [Google Scholar] [CrossRef]
  50. Vainio, E.J.; Chiba, S.; Ghabrial, S.A.; Maiss, E.; Roossinck, M.; Sabanadzovic, S.; Suzuki, N.; Xie, J.; Nibert, M.; Consortium, I.R. ICTV Virus Taxonomy Profile: Partitiviridae. J. Gen. Virol. 2018, 99, 17–18. [Google Scholar] [CrossRef]
  51. Cross, S.T.; Maertens, B.L.; Dunham, T.J.; Rodgers, C.P.; Brehm, A.L.; Miller, M.R.; Williams, A.M.; Foy, B.D.; Stenglein, M.D. Partitiviruses Infecting Drosophila melanogaster and Aedes aegypti Exhibit Efficient Biparental Vertical Transmission. J. Virol. 2020, 94, 10–1128. [Google Scholar] [CrossRef]
  52. King, A.M.Q.; Adams, M.J.; Carstens, E.B.; Lefkowitz, E.J. (Eds.) Family—Totiviridae. In Virus Taxonomy; Elsevier: San Diego, CA, USA, 2012; pp. 639–650. [Google Scholar] [CrossRef]
  53. Zhang, P.; Liu, W.; Cao, M.; Massart, S.; Wang, X. Two novel totiviruses in the white-backed planthopper, Sogatella furcifera. J. Gen. Virol. 2018, 99, 710–716. [Google Scholar] [CrossRef]
  54. Poimala, A.; Vainio, E.J. Complete genome sequence of a novel toti-like virus from the plant-pathogenic oomycete Phytophthora cactorum. Arch. Virol. 2020, 165, 1679–1682. [Google Scholar] [CrossRef]
  55. Sandlund, L.; Mor, S.K.; Singh, V.K.; Padhi, S.K.; Phelps, N.B.D.; Nylund, S.; Mikalsen, A.B. Comparative Molecular Characterization of Novel and Known Piscine Toti-Like Viruses. Viruses 2021, 13, 1063. [Google Scholar] [CrossRef] [PubMed]
  56. Kotta-Loizou, I.; Coutts, R.H.A.; Ictv Report, C. ICTV Virus Taxonomy Profile: Polymycoviridae 2022. J. Gen. Virol. 2022, 103, 001747. [Google Scholar] [CrossRef] [PubMed]
  57. Ma, G.; Wu, C.; Li, Y.; Mi, Y.; Zhou, T.; Zhao, C.; Wu, X. Identification and genomic characterization of a novel polymycovirus from Alternaria alternata causing watermelon leaf blight. Arch. Virol. 2022, 167, 223–227. [Google Scholar] [CrossRef] [PubMed]
  58. Gao, Z.; Zhang, M.; Yu, T.; Wang, X.; Wang, X.; An, H.; Zhang, S.; Liu, M.; Fang, S. Molecular characterization of a novel polymycovirus from the phytopathogenic fungus Setosphaeria turcica. Arch. Virol. 2021, 166, 2315–2319. [Google Scholar] [CrossRef] [PubMed]
  59. Manjunath, K.L.; Halbert, S.E.; Ramadugu, C.; Webb, S.; Lee, R.F. Detection of ‘Candidatus Liberibacter asiaticus’ in Diaphorina citri and its importance in the management of citrus huanglongbing in Florida. Phytopathology 2008, 98, 387–396. [Google Scholar] [CrossRef]
  60. Hong, Y.; Luo, Y.; Yi, J.; He, L.; Dai, L.; Yi, T. Screening nested-PCR primer for ‘Candidatus Liberibacter asiaticus’ associated with citrus Huanglongbing and application in Hunan, China. PLoS ONE 2019, 14, e0212020. [Google Scholar] [CrossRef]
  61. Zug, R.; Hammerstein, P. Bad guys turned nice? A critical assessment of Wolbachia mutualisms in arthropod hosts. Biol. Rev. Camb. Philos. Soc. 2015, 90, 89–111. [Google Scholar] [CrossRef]
  62. Kaiser, W.; Huguet, E.; Casas, J.; Commin, C.; Giron, D. Plant green-island phenotype induced by leaf-miners is mediated by bacterial symbionts. Proc. Biol. Sci. 2010, 277, 2311–2319. [Google Scholar] [CrossRef] [PubMed]
  63. De Barro, P.J.; Liu, S.S.; Boykin, L.M.; Dinsdale, A.B. Bemisia tabaci: A statement of species status. Annu. Rev. Entomol. 2011, 56, 1–19. [Google Scholar] [CrossRef] [PubMed]
  64. Cui, X.; Liu, Y.; Zhang, J.; Hu, P.; Zheng, Z.; Deng, X.; Xu, M. Variation of endosymbiont and citrus tristeza virus (CTV) titers in the Huanglongbing insect vector, Diaphorina citri, on CTV-infected plants. Front. Microbiol. 2023, 14, 1236731. [Google Scholar] [CrossRef]
  65. Ashraf, H.J.; Ramos Aguila, L.C.; Akutse, K.S.; Ilyas, M.; Abbasi, A.; Li, X.; Wang, L. Comparative microbiome analysis of Diaphorina citri and its associated parasitoids Tamarixia radiata and Diaphorencyrtus aligarhensis reveals Wolbachia as a dominant endosymbiont. Environ. Microbiol. 2022, 24, 1638–1652. [Google Scholar] [CrossRef]
  66. Nakabachi, A.; Piel, J.; Malenovský, I.; Hirose, Y. Comparative Genomics Underlines Multiple Roles of Profftella, an Obligate Symbiont of Psyllids: Providing Toxins, Vitamins, and Carotenoids. Genome Biol. Evol. 2020, 12, 1975–1987. [Google Scholar] [CrossRef]
  67. Chua, K.O.; See-Too, W.S.; Tan, J.Y.; Song, S.L.; Yong, H.S.; Yin, W.F.; Chan, K.G. Oecophyllibacter saccharovorans gen. nov. sp. nov., a bacterial symbiont of the weaver ant Oecophylla smaragdina. J. Microbiol. 2020, 58, 988–997. [Google Scholar] [CrossRef]
  68. Honda, S.; Eusebio-Cope, A.; Miyashita, S.; Yokoyama, A.; Aulia, A.; Shahi, S.; Kondo, H.; Suzuki, N. Establishment of Neurospora crassa as a model organism for fungal virology. Nat. Commun. 2020, 11, 5627. [Google Scholar] [CrossRef] [PubMed]
Pathogens 14 00801 g001
Figure 1. Phylogenetic relationships of putative single-stranded positive-sense RNA viruses detected in D. citri. (A) Hypoviridae. (B) Yadokariviridae. Novel viruses identified in this study are indicated with an asterisk (**).
Figure 1. Phylogenetic relationships of putative single-stranded positive-sense RNA viruses detected in D. citri. (A) Hypoviridae. (B) Yadokariviridae. Novel viruses identified in this study are indicated with an asterisk (**).
Pathogens 14 00801 g001
Pathogens 14 00801 g002
Figure 2. Phylogenetic relationships of two putative Botourmiaviridae members detected in D. citri, tentatively named Diaphorina citri-associated ourmia-like viruses 1 and 2 (DcOv1: PV821381 and DcOv2: PV821382). Novel viruses identified in this study are indicated with an asterisk (**).
Figure 2. Phylogenetic relationships of two putative Botourmiaviridae members detected in D. citri, tentatively named Diaphorina citri-associated ourmia-like viruses 1 and 2 (DcOv1: PV821381 and DcOv2: PV821382). Novel viruses identified in this study are indicated with an asterisk (**).
Pathogens 14 00801 g002
Pathogens 14 00801 g003
Figure 3. Phylogenetic relationships of putative single-stranded positive-sense RNA viruses from the families Virgaviridae (A) and Narnaviridae (B) detected in D. citri. Novel viruses identified in this study are indicated with an asterisk (**).
Figure 3. Phylogenetic relationships of putative single-stranded positive-sense RNA viruses from the families Virgaviridae (A) and Narnaviridae (B) detected in D. citri. Novel viruses identified in this study are indicated with an asterisk (**).
Pathogens 14 00801 g003
Pathogens 14 00801 g004
Figure 4. Maximum-likelihood phylogenetic tree of Diaphorina citri-associated splipalmivirus (DcSV1) segments, based on amino acid sequences of predicted ORFs. DcSV1 RNA segments 1–4 are marked with asterisks (**) and cluster with fungal splipalmiviruses, particularly Cryphonectria naterciae splipalmivirus 1, suggesting a likely fungal origin. Colour code: blue—Narnaviruses; pink—Splipalmiviruses; red—viruses identified in this study.
Figure 4. Maximum-likelihood phylogenetic tree of Diaphorina citri-associated splipalmivirus (DcSV1) segments, based on amino acid sequences of predicted ORFs. DcSV1 RNA segments 1–4 are marked with asterisks (**) and cluster with fungal splipalmiviruses, particularly Cryphonectria naterciae splipalmivirus 1, suggesting a likely fungal origin. Colour code: blue—Narnaviruses; pink—Splipalmiviruses; red—viruses identified in this study.
Pathogens 14 00801 g004
Pathogens 14 00801 g005
Figure 5. Maximum-likelihood phylogenetic tree of putative single-stranded negative-sense RNA viruses detected in D. citri. Phylogenetic relationships of Diaphorina citri-associated mymona-like virus 1 with other members of the family Mymonaviridae (A), and Diaphorina citri-associated discovirus segment L with other members of the family Discoviridae (B). Novel viruses identified in this study are marked with asterisks (**).
Figure 5. Maximum-likelihood phylogenetic tree of putative single-stranded negative-sense RNA viruses detected in D. citri. Phylogenetic relationships of Diaphorina citri-associated mymona-like virus 1 with other members of the family Mymonaviridae (A), and Diaphorina citri-associated discovirus segment L with other members of the family Discoviridae (B). Novel viruses identified in this study are marked with asterisks (**).
Pathogens 14 00801 g005
Pathogens 14 00801 g006
Figure 6. Phylogenetic relationships of putative double-stranded RNA viruses from the families Partitiviridae (A) and Totiviridae (B) detected in D. citri. Novel viruses identified in this study are marked with asterisks (**). The tree was constructed using the maximum-likelihood method based on MUSCLE-aligned amino acid sequences of predicted RdRP or ORF regions.
Figure 6. Phylogenetic relationships of putative double-stranded RNA viruses from the families Partitiviridae (A) and Totiviridae (B) detected in D. citri. Novel viruses identified in this study are marked with asterisks (**). The tree was constructed using the maximum-likelihood method based on MUSCLE-aligned amino acid sequences of predicted RdRP or ORF regions.
Pathogens 14 00801 g006
Pathogens 14 00801 g007
Figure 7. Maximum-likelihood phylogenetic tree of Diaphorina citri-associated polymycovirus (DcPMv). The tree is based on the amino acid sequence of the RNA4 segment encoding a PAS-rich protein. DcPMv clusters with fungal polymycoviruses, including Alternaria alternata polymycovirus 2, suggesting a fungal origin. The novel virus identified in this study is marked with an asterisk (**) in red color.
Figure 7. Maximum-likelihood phylogenetic tree of Diaphorina citri-associated polymycovirus (DcPMv). The tree is based on the amino acid sequence of the RNA4 segment encoding a PAS-rich protein. DcPMv clusters with fungal polymycoviruses, including Alternaria alternata polymycovirus 2, suggesting a fungal origin. The novel virus identified in this study is marked with an asterisk (**) in red color.
Pathogens 14 00801 g007
Pathogens 14 00801 g008
Figure 8. Microbiota composition of Diaphorina citri populations from three Samoan locations. Pie charts represent the relative abundance of dominant bacterial taxa identified in D. citri individuals collected from Upolu North, Upolu South, and Savai’i.
Figure 8. Microbiota composition of Diaphorina citri populations from three Samoan locations. Pie charts represent the relative abundance of dominant bacterial taxa identified in D. citri individuals collected from Upolu North, Upolu South, and Savai’i.
Pathogens 14 00801 g008
Table 1. Summary of novel viruses associated with Diaphorina citri. Each virus is listed with its closest related virus based on BLAST analysis and the highest percentage identity at both the protein (nr) and nucleotide (nt) levels.
Table 1. Summary of novel viruses associated with Diaphorina citri. Each virus is listed with its closest related virus based on BLAST analysis and the highest percentage identity at both the protein (nr) and nucleotide (nt) levels.
Diaphorina citri-Associated Virus NameClosely Related VirusAccession CodeGreatest Identity %
Protein
Level (nr)		Greatest Identity %
Nucleotide
Level (nt)
hypovirus 1 Chuzhou tick virus 1UYL9533187.3288.37
yadokarivirus 1 Aspergillus homomorphus yadokarivirus 1AZT8862658.6777.20
mononega-like virus 1 Leptosphaeria biglobosa ss(-)RNA virus 4UYL9450557.7476.69
toti-like virus Erysiphe necator-associated totivirus 1QLC2759166.8392.5
narnavirus 1 Rhizoctonia solani narnavirus 13UIW1388047.05-
narnavirus 2 Plasmopara viticola lesion-associated narnavirus 4QIR3028375.1892.50
narnavirus 3 Plasmopara viticola lesion-associated narnavirus 27QIR3030652.6081.42
narnavirus 4 Botrytis cinerea binarnavirus 2QLF4918449.2597.36
narnavirus 5Erysiphe necator-associated narnavirus 29QJT9376155.6484.31
narnavirus 6 Plasmopara viticola lesion-associated narnavirus 12QIR3029167.7686.79
narnavirus 7 Sclerotinia sclerotiorum narnavirus 4QZE1202540.3990.00
narnavirus 8 Tonghua Narna tick virus 3UYL9539355.1683.13
narnavirus 9 Aspergillus creber narnavirus 1BDB1624932.00-
narnavirus 10 Sclerotinia sclerotiorum narnavirus 1QZE1203540.0997.29
splipalmivirus segment RNA1 Cryphonectria naterciae splipalmivirus 1BCX5550968.2089.74
splipalmivirus segment RNA2 Cryphonectria naterciae splipalmivirus 1BCX5551066.7175.90
splipalmivirus segment RNA3 Cryphonectria naterciae splipalmivirus 1BCX5551160.7885.71
splipalmivirus segment RNA4 Oidiodendron maius splipalmivirus 1UJT3179144.2674.25
partitivirus 1 Segment 1 Human blood-associated partitivirusAWK2347365.4391.11
partitivirus 1 Segment 2 Human blood-associated partitivirusAWK2347275.7086.79
partitivirus 2 Segment 1 Leptosphaeria biglobosa partitivirus 1UYL9449063.3475.25
partitivirus 2 Segment 2 Leptosphaeria biglobosa partitivirus 1UYL9448983.0490.69
partitivirus 3 Segment 1Lichen partiti-like RNA virus 2BCD5638653.1369.48
partitivirus 3 Segment 2 Lasiodiplodia ziziphi partitivirus 1WCD6860570.6688.37
partitivirus 4 Segment 1 Aspergillus flavus partitivirus 1BED9827745.16-
partitivirus 4 Segment 2 Aspergillus flavus partitivirus 1QDE5363480.9079.66
partitivirus 5 Segment 1 Ustilaginoidea virens partitivirus 2YP_00832731371.7780.55
partitivirus 5 Segment 2 Ustilaginoidea virens partitivirus 2YP_00832731279.0183.82
partitivirus 6 Segment 1 Metarhizium brunneum partitivirus 1QHB4987456.7479.66
partitivirus 6 Segment 2 Erysiphe necator-associated partiti-like virus 1QJW7031567.6980.32
partitivirus 7 Segment 1 Cordyceps chanhua partitivirus 1WBW4834569.0388.00
partitivirus 7 Segment 2 Cordyceps chanhua partitivirus 1WBW4834483.9190.24
virga-like virus 1 Penicillium vanoranjei-associated RNA virus 1BDF9766787.0182.49
discovirus L Peribunyaviridae sp.WAK7561364.7880.28
discovirus M Penicillium discovirusYP_01084028644.06-
discovirus S Penicillium discovirusYP_01084028753.50-
polymycovirus segment RNA4 Alternaria alternata polymycovirus 2WEW7349756.6975.23
ourmia-like virus 1 Tianjin Botou tick virus 4UYL9545974.53894.28
ourmia-like virus 2 Narnaviridae sp.WAK7526074.0096.87
A dash (-) indicates that no significant nucleotide identity was found or reported.
Table 2. Genomic features, abundance, and protein domain annotations of novel viruses associated with Diaphorina citri in Samoa.
Table 2. Genomic features, abundance, and protein domain annotations of novel viruses associated with Diaphorina citri in Samoa.
Diaphorina citri-Associated Virus NameVirus LengthAssembly
Coverage		Total Read CountInterPro AccessionInterPro Name
Upolo NUpolo SSavai’i
ss(+)RNA viruses
hypovirus 1 (DcHv1)1143197.57746411IPR027417; IPR021912; IPR014001; IPR043502DNA/RNA polymerase superfamily; P-loop containing nucleoside triphosphate hydrolase; protein of unknown function DUF3525; Helicase superfamily 1/2 (ATP-binding domain)
yadokarivirus 1 (DcYv1)3828612.6915,74621IPR001205; IPR043502RNA-directed RNA polymerase, C-terminal domain; DNA/RNA polymerase
ourmia-like virus 1 (DcOv1)17396.158758IPR043502DNA/RNA polymerase superfamily
ourmia-like virus 2 (DcOv2)13706.9512552--
virga-like virus 1 (DcV1)168511.9928126IPR001788; IPR007094; IPR043502RNA-directed RNA polymerase, C-terminal domain; RNA-directed RNA polymerase, catalytic domain; DNA/RNA polymerase superfamily
narnavirus 1 (DcNv1)2383505.47806610IPR008686; IPR043502RNA-dependent RNA polymerase, mitoviral; DNA/RNA polymerase superfamily
narnavirus 2 (DcNv2)2524893.8315,10122--
narnavirus 3 (DcNv3)35521126.5233,47312,0739510--
narnavirus 4 (DcNv4)2260837.9512,67673IPR008871Totivirus coat
narnavirus 5 (DcNv5)22609.9615020--
narnavirus 6 (DcNv6)3409583.813,33412--
narnavirus 7 (DcNv7)24771439.6723,84401IPR043502DNA/RNA polymerase superfamily
narnavirus 8 (DcNv8)235113.87963127--
narnavirus 9 (DcNv9)15841123.0615,86376266146--
narnavirus 10 (DcNv10)9411738.4910,94100IPR007099RNA-directed RNA polymerase, negative-strand RNA virus
splipalmivirus segment RNA1 (DcSV1)216494.25137010IPR008871Totivirus coat
splipalmivirus segment RNA2 (DcSV2)227376.63116610IPR043502DNA/RNA polymerase superfamily
splipalmivirus segment RNA3 (DcSV3)1459575.82561900--
splipalmivirus segment RNA4 (DcSV4)5332.851100--
ss(-)RNA viruses
mymona-like virus 1 (DcMv1)970892.17535331161261IPR026890; IPR014023Mononegavirales RNA-directed RNA polymerase catalytic domain; mononegavirales mRNA-capping domain V
discovirus L (DcDv-L)655662.4273900IPR007322; IPR007099RNA-dependent RNA polymerase, bunyaviral; RNA-directed RNA polymerase, negative-strand RNA virus
discovirus M (DcDv-M)1221675.19551300--
discovirus S (DcDv-S)1054464.71327721--
dsRNA viruses
partitivirus 1 Segment 1 (DcPv1-S1)2312146.82227151IPR026890;Mononegavirales RNA-directed RNA polymerase catalytic domain
partitivirus 1 Segment 2 (DcPv1-S2)2196138.24203243IPR001205; IPR043502RNA-directed RNA polymerase, C-terminal domain; DNA/RNA polymerase superfamily
partitivirus 2 Segment 1 (DcPv2-S1)180827.67493196118IPR043502DNA/RNA polymerase superfamily
partitivirus 2 Segment 2 (DcPv2-S2)1917120.571549811IPR001205; IPR043502RNA-directed RNA polymerase, C-terminal domain; DNA/RNA polymerase superfamily
partitivirus 3 Segment 1 (DcPv3-S1)173261.7371600IPR008871Totivirus coat
partitivirus 3 Segment 2 (DcPv3-S2)1902140.39178800IPR001205; IPR043502RNA-directed RNA polymerase, C-terminal domain; DNA/RNA polymerase superfamily
partitivirus 4 Segment 1 (DcPv4-S1)133162.3655832--
partitivirus 4 Segment 2 (DcPv4-S2)1735156.1181101IPR001205; IPR007094; IPR043502RNA-directed RNA polymerase, C-terminal domain; RNA-directed RNA polymerase, catalytic domain; DNA/RNA polymerase superfamily
partitivirus 5 Segment 1 (DcPv5-S1)1329168.77150300--
partitivirus 5 Segment 2 (DcPv5-S2)1736387.13450210IPR001205; IPR007094; IPR043502RNA-directed RNA polymerase, C-terminal domain; RNA-directed RNA polymerase, catalytic domain; DNA/RNA polymerase superfamily
partitivirus 6 Segment 1 (DcPv6-S1)1712115131721IPR008871Totivirus coat
partitivirus 6 Segment 2 (DcPv6-S2)1813103.77126100IPR001205; IPR007094; IPR043502RNA-directed RNA polymerase, C-terminal domain; RNA-directed RNA polymerase, catalytic domain; DNA/RNA polymerase superfamily
partitivirus 7 Segment 1 (DcPv7-S1)158175.9780310IPR043502DNA/RNA polymerase superfamily
partitivirus 7 Segment 2 (DcPv7-S2)1752108.23127110IPR043128; IPR001205; IPR007094; IPR043502Reverse transcriptase/Diguanylate cyclase domain; RNA-directed RNA polymerase, C-terminal domain; RNA-directed RNA polymerase, catalytic domain; DNA/RNA polymerase superfamily
toti-like virus (DcTv)503938.36129411IPR008871Totivirus coat
polymycovirus segment RNA4 (DcPMv)107233.2432310683IPR043502DNA/RNA polymerase superfamily
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Etebari, K.; Tugaga, A.M.; Divekar, G.; Uelese, O.A.; Tusa, S.S.A.; Vaega, E.; Sasulu, H.; Uini, L.; Ren, Y.; Furlong, M.J. Characterising the Associated Virome and Microbiota of Asian Citrus Psyllid (Diaphorina citri) in Samoa. Pathogens 2025, 14, 801. https://doi.org/10.3390/pathogens14080801

AMA Style

Etebari K, Tugaga AM, Divekar G, Uelese OA, Tusa SSA, Vaega E, Sasulu H, Uini L, Ren Y, Furlong MJ. Characterising the Associated Virome and Microbiota of Asian Citrus Psyllid (Diaphorina citri) in Samoa. Pathogens. 2025; 14(8):801. https://doi.org/10.3390/pathogens14080801

Chicago/Turabian Style

Etebari, Kayvan, Angelika M. Tugaga, Gayatri Divekar, Olo Aleni Uelese, Sharydia S. A. Tusa, Ellis Vaega, Helmy Sasulu, Loia Uini, Yuanhang Ren, and Michael J. Furlong. 2025. "Characterising the Associated Virome and Microbiota of Asian Citrus Psyllid (Diaphorina citri) in Samoa" Pathogens 14, no. 8: 801. https://doi.org/10.3390/pathogens14080801

APA Style

Etebari, K., Tugaga, A. M., Divekar, G., Uelese, O. A., Tusa, S. S. A., Vaega, E., Sasulu, H., Uini, L., Ren, Y., & Furlong, M. J. (2025). Characterising the Associated Virome and Microbiota of Asian Citrus Psyllid (Diaphorina citri) in Samoa. Pathogens, 14(8), 801. https://doi.org/10.3390/pathogens14080801

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop