First Detection and Molecular Identification of Rhabditis (Rhabditella) axei from the Chinese Red Panda (Ailurus styani)
Abstract
1. Introduction
2. Methods
2.1. Sample Collection
2.2. Nematode Isolation and Enrichment
2.3. DNA Amplification and Sequencing
2.4. Phylogenetic Analysis
3. Results
3.1. Morphological Features
3.2. Molecular Detection
3.3. Phylogenetic Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Li, Z.; Gao, X. Medical Parasites; The People’s Health Press: Beijing, China, 2012; pp. 354–355. [Google Scholar]
- Sciandra, C.; Amoriello, S.; Degli, I.; Nicotera, V.; Barbieri, F.; Mazza, G.; Torrini, G.; Roversi, P.F.; Strangi, A. First report of Rhabditis (Rhabditella) axei with the invasive palm borer Paysandisia archon. J. Nematol. 2024, 56, 20240005. [Google Scholar] [CrossRef]
- He, Y.; Jiang, H. Three human cases of urinary tract infection with Rhabditis. J. Parasitol. Parasit. Dis. 1985, 3, 206–208. [Google Scholar]
- Huang, Z. A case report of intestinal infection with Rhabditis axei. J. Med. Anim. Control. 2000, 12, 637–638. [Google Scholar]
- Liu, L.; He, L.; Liu, H.; Zhang, X. A case of renal failure complicated with Rhabditis axei infection. Lab. Med. 2010, 25, 501–502. [Google Scholar]
- Hu, Y.; Thapa, A.; Fan, H.; Ma, T.; Wu, Q.; Ma, S.; Zhang, D.; Wang, B.; Li, M.; Yan, L.; et al. Genomic evidence for two phylogenetic species and long-term population bottlenecks in red pandas. Sci. Adv. 2020, 6, 5751. [Google Scholar] [CrossRef]
- Wei, F.; Thapa, A.; Hu, Y.; Zhang, Z. Red pandas in the wild in China. In Red Panda, 2nd ed.; Glatston, A.R., Ed.; Academic Press: Beijing, China, 2021; pp. 393–411. [Google Scholar]
- Yu, H.; Chen, Z.; Yang, G.; Yan, Y.; Cui, P. Development of parasitic diseases in lesser panda. China J. Anim. Health Insp. 2015, 32, 52–56, 92. [Google Scholar]
- Liu, S.; Li, Y.; Zhang, D.; Su, X.; Yue, C.; Ayala, J.E.; Yan, X.; Hou, R.; Li, L.; Xie, Y.; et al. Mortality analysis of captive red panda cubs within Chengdu, China. BMC Vet. Res. 2022, 18, 68. [Google Scholar] [CrossRef]
- Ayala, J.E.; Wu, K.J.; Yang, K.X.; Xie, Y.; Liu, S.R.; Zhang, L. Management, husbandry and veterinary medicine of red pandas living ex situ in China using the Chengdu Research Base of Giant Panda Breeding as a model. In Red Panda, 2nd ed.; Glatston, A.R., Ed.; Academic Press: Beijing, China, 2021; pp. 271–288. [Google Scholar]
- Liu, S.; Li, Y.; Yue, C.; Qi, D.; Hou, R.; Lan, J. Research progress and prospect on diseases of captive red pandas. Sichuan J. Zool. 2024, 43, 565–576. [Google Scholar] [CrossRef]
- Yang, G.; Zhang, Z. Parasitic Diseases of Wildlife; Science Press: Beijing, China, 2013; pp. 12–16. [Google Scholar]
- Holterman, M.; van der Wurff, A.; van den Elsen, S.; van Megen, H.; Bongers, T.; Holovachov, O.; Bakker, J.; Helder, J. Phylum-wide analysis of SSU rDNA reveals deep phylogenetic relationships among nematodes and accelerated evolution toward crown clades. Mol. Biol. Evol. 2006, 23, 1792–1800. [Google Scholar] [CrossRef]
- Foucher, A.; Wilson, M. Development of a polymerase chain reaction-based denaturing gradient gel electrophoresis technique to study nematode species biodiversity using the 18s rDNA gene. Mol. Biol. Evol. 2002, 2, 45–48. [Google Scholar] [CrossRef]
- Vrain, C.; Wakarchuk, A.; Lévesque, C.; Hamilton, I. Intraspecific rDNA restriction fragment length polymorphism in the Xiphinema americanum group. Fundam. Appl. Nematol. 1992, 15, 563–573. [Google Scholar]
- Skoracka, A.; Rector, B.; Kuczyński, L.; Szydło, W.; Hein, G.; French, R. Global spread of wheat curl mite by its most polyphagous and pestiferous lineages. Ann. Appl. Biol. 2015, 165, 222–235. [Google Scholar] [CrossRef]
- Nguyen, B.; Tesfamariam, M.; Gozel, U.; Gaugler, R.; Adams, J. Steinernema yirgalemense n. sp. (Rhabditida: Steinernematidae) from Ethiopia. Nematology 2004, 6, 839–856. [Google Scholar] [CrossRef]
- De Ley, P.; De Ley, T.; Morris, K.; Abebe, E.; MundoOcampo, M.; Yoder, M.; Heras, J.; Waumann, D.; Rocha-Olivares, A.; Burr, A.J.; et al. An integrated approach to fast and informative morphological vouchering of nematodes for applications in molecular barcoding. Philos. Trans. R Soc. B Biol. Sci. 2005, 360, 1945–1958. [Google Scholar] [CrossRef]
- Levine, D.; Birch, L.; Dolowy, C.; McKinney, E. Rhabditis axei, a pseudoparasitic nematode of the dog. J. Am. Vet. Med. Assoc. 1963, 142, 1404–1406. [Google Scholar]
- Azazy, M.; Gawady, M.; Nada, S. The occurrence of Rhabditis (Rhabditella) axei in the faeces of a chicken in Egypt. J. Helminthol. 1988, 62, 219–220. [Google Scholar] [CrossRef]
- Goldsmid, M. Rhabditis (Rhabditella) axei in the urine of an African in Rhodesia. J. Helminthol. 1967, 41, 305–308. [Google Scholar] [CrossRef]
- Trejo-Meléndez, V.J.; Ibarra-Rendón, J.; Contreras-Garduño, J. The evolution of entomopathogeny in nematodes. Ecol. Evol. 2024, 14, e10966. [Google Scholar] [CrossRef]
- Chen, H.; Liu, Y.; Chen, Y.; Qiu, L. A case report of Strongyloides stercoralis infection. Chin. J. Nosocomiol. 2019, 29, 2529–2532. [Google Scholar]
- Lan, J.; Fu, Y.; Yang, Z.; Zhang, Z.; Wang, C.; Luo, L.; Liu, L.; Gu, X.; Wang, S.; Peng, X.; et al. Treatment and prevention of natural heartworm (Diroflaria immitis) infections in red pandas (Ailurus fulgens) with selamectin and ivermectin. Parasitol. Int. 2012, 61, 372–374. [Google Scholar] [CrossRef]
- Chen, X. Modern Parasitology; People’s Military Medical Press: Beijing, China, 2002; p. 524. [Google Scholar]
- Fitch, H.; Bugaj-gaweda, B.; Emmons, W. 18S ribosomal RNA gene phylogeny for some Rhabditidae related to Caenorhabditis. Mol. Biol. Evol. 1995, 12, 346–358. [Google Scholar] [CrossRef][Green Version]
- Qing, X.; Karlicki, M.; Guo, F.; Karnkowska, A.; Li, H. Soil nematode community profiling using reference-free mito-metagenomics. Soil Biol. Biochem. 2024, 199, 109613. [Google Scholar] [CrossRef]
- Půža, V.; Machado, R.A.R. Systematics and phylogeny of the entomopathogenic nematobacterial complexes Steinernema-Xenorhabdus and Heterorhabditis-Photorhabdus. Zool. Lett. 2024, 10, 13. [Google Scholar] [CrossRef] [PubMed]
- Šlapeta, J.; Vande Velde, F.; Martínez-Valladares, M.; Canton, C.; Claerebout, E.; Gilleard, S. Towards precision parasite management for livestock gastrointestinal nematodes in 2030. Trends Parasitol. 2024, 40, 886–895. [Google Scholar] [CrossRef] [PubMed]




| Primers | Direction | Sequence (5′-3′) | Tm (°C) | rRNA Gene | Reference |
|---|---|---|---|---|---|
| 988F | F | CTCAAAGATTAAGCCATGC | 45 | 18S | [13] |
| 1912R | R | TTTACGGTCAGAACTAGGG | 45 | 18S | [13] |
| 1813F | F | CTGCGTGAGAGGTGAAAT | 45 | 18S | [13] |
| 2646R | R | GCTACCTTGTTACGACTTTT | 45 | 18S | [13] |
| nem1 | F | GCAAGTCTGGTGCCAGCAGC | 55 | 18S, ITS | [14] |
| nem2 | R | CCGTGTTGAGTCAAATTAAG | 55 | 18S, ITS | [14] |
| 18S-F | F | TTGATTACGTCCCTGCCCTTT | 55 | ITS | [15] |
| 28Srev430 | R | CAACTTTCCCTCACGGTACTTGT | 55 | ITS | [16] |
| D2F | F | CCTTAGTAACGGCGAGTGAAA | 55 | ITS, 28S | [17] |
| D3B | R | TCGGAAGGAACCAGCTACTA | 55 | ITS, 28S | [18] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yue, C.; Yang, W.; Qi, D.; Yang, M.; Ayala, J.E.; Zhou, Y.; Chen, C.; Su, X.; Hou, R.; Liu, S. First Detection and Molecular Identification of Rhabditis (Rhabditella) axei from the Chinese Red Panda (Ailurus styani). Pathogens 2025, 14, 783. https://doi.org/10.3390/pathogens14080783
Yue C, Yang W, Qi D, Yang M, Ayala JE, Zhou Y, Chen C, Su X, Hou R, Liu S. First Detection and Molecular Identification of Rhabditis (Rhabditella) axei from the Chinese Red Panda (Ailurus styani). Pathogens. 2025; 14(8):783. https://doi.org/10.3390/pathogens14080783
Chicago/Turabian StyleYue, Chanjuan, Wanjing Yang, Dunwu Qi, Mei Yang, James Edward Ayala, Yanshan Zhou, Chao Chen, Xiaoyan Su, Rong Hou, and Songrui Liu. 2025. "First Detection and Molecular Identification of Rhabditis (Rhabditella) axei from the Chinese Red Panda (Ailurus styani)" Pathogens 14, no. 8: 783. https://doi.org/10.3390/pathogens14080783
APA StyleYue, C., Yang, W., Qi, D., Yang, M., Ayala, J. E., Zhou, Y., Chen, C., Su, X., Hou, R., & Liu, S. (2025). First Detection and Molecular Identification of Rhabditis (Rhabditella) axei from the Chinese Red Panda (Ailurus styani). Pathogens, 14(8), 783. https://doi.org/10.3390/pathogens14080783

