Long-Term Surveillance of Food Products of Diverse Origins: A Five-Year Survey of Hepatitis A and Norovirus in Greece, 2019–2024
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.2. Categorization of Food Samples
2.3. Virus Concentration and Extraction
2.4. One Step RT-PCR for HAV, NoV GI and GII
2.5. Validation of Analytical Procedures
2.6. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Pavoni, E.; Bertasi, B.; Galuppini, E.; Mangeri, L.; Meletti, F.; Tilola, M.; Carta, V.; Todeschi, S.; Losio, M.-N. Detection of Hepatitis A Virus and Norovirus in Different Food Categories: A 6-Year Survey in Italy. Food Environ. Virol. 2022, 14, 69–76. Available online: https://link.springer.com/article/10.1007/s12560-021-09503-y (accessed on 28 December 2024). [CrossRef]
- Wang, X.; Ren, J.; Gao, Q.; Hu, Z.; Sun, Y.; Li, X.; Rowlands, D.J.; Yin, W.; Wang, J.; Stuart, D.I.; et al. Hepatitis A virus and the origins of picornaviruses. Nature 2014, 517, 85–88. Available online: https://www.nature.com/articles/nature13806 (accessed on 28 December 2024). [CrossRef] [PubMed]
- Guerra Veloz, M.F.; Agarwal, K. Hepatitis A and E and other hepatotropic viruses. Medicine 2023, 51, 347–350. Available online: http://www.medicinejournal.co.uk/article/S1357303923000348/fulltext (accessed on 28 December 2024). [CrossRef]
- El-Mokhtar, M.A.; Elkhawaga, A.A.; Ahmed, M.S.H.; El-Sabaa, E.M.W.; Mosa, A.A.; Abdelmohsen, A.S.; Moussa, A.M.; Salama, E.H.; Aboulfotuh, S.; Ashmawy, A.M.; et al. High Incidence of Acute Liver Failure among Patients in Egypt Coinfected with Hepatitis A and Hepatitis E Viruses. Microorganisms 2023, 11, 2898. Available online: https://www.mdpi.com/2076-2607/11/12/2898/htm (accessed on 28 December 2024). [CrossRef] [PubMed]
- McCaustland, K.A.; Bond, W.W.; Bradley, D.W.; Ebert, J.W.; Maynard, J.E. Survival of hepatitis A virus in feces after drying and storage for 1 month. J. Clin. Microbiol. 1982, 16, 957–958. Available online: https://journals.asm.org/doi/10.1128/jcm.16.5.957-958.1982 (accessed on 28 December 2024). [CrossRef]
- Siegl, G.; Weitz, M.; Kronauer, G. Stability of Hepatitis A Virus. Intervirology 1984, 22, 218–226. [Google Scholar] [CrossRef] [PubMed]
- Costafreda, M.I.; Pérez-Rodriguez, F.J.; D’Andrea, L.; Guix, S.; Ribes, E.; Bosch, A.; Pintó, R.M. Hepatitis A Virus Adaptation to Cellular Shutoff Is Driven by Dynamic Adjustments of Codon Usage and Results in the Selection of Populations with Altered Capsids. J. Virol. 2014, 88, 5029–5041. Available online: https://journals.asm.org/doi/10.1128/jvi.00087-14 (accessed on 28 December 2024). [CrossRef] [PubMed]
- Tjon, G.M.S.; Coutinho, R.A.; Van Den Hoek, A.; Esman, S.; Wijkmans, C.J.; Hoebe, C.J.P.A.; Wolters, B.; Swaan, C.; Geskus, R.B.; Dukers, N.; et al. High and persistent excretion of hepatitis A virus in immunocompetent patients. J. Med. Virol. 2006, 78, 1398–1405. Available online: https://pubmed.ncbi.nlm.nih.gov/16998883/ (accessed on 28 December 2024). [CrossRef] [PubMed][Green Version]
- Vilaplana, T.G.; Leeman, D.; Balogun, K.; Ngui, S.L.; Phipps, E.; Khan, W.M.; Incident Team; Balasegaram, S. Hepatitis A outbreak associated with consumption of dates, England and Wales, January 2021 to April 2021. Eurosurveillance 2021, 26, 2100432. Available online: https://www.eurosurveillance.org/content/10.2807/1560-7917.ES.2021.26.20.2100432 (accessed on 28 December 2024). [CrossRef]
- Pintó, R.M.; Costafreda, M.I.; Bosch, A. Risk assessment in shellfish-borne outbreaks of hepatitis A. Appl. Environ. Microbiol. 2009, 75, 7350–7355. Available online: https://journals.asm.org/doi/10.1128/AEM.01177-09 (accessed on 28 December 2024). [CrossRef]
- Di Cola, G.; Fantilli, A.C.; Pisano, M.B.; Ré, V.E. Foodborne transmission of hepatitis A and hepatitis E viruses: A literature review. Int. J. Food Microbiol. 2021, 338, 108986. Available online: https://pubmed.ncbi.nlm.nih.gov/33257099/ (accessed on 28 December 2024). [CrossRef] [PubMed]
- Van Damme, P.; Pintó, R.M.; Feng, Z.; Cui, F.; Gentile, A.; Shouval, D. Hepatitis A virus infection. Nat. Rev. Dis. Primers 2023, 9, 469. Available online: https://www.nature.com/articles/s41572-023-00461-2 (accessed on 28 December 2024). [CrossRef] [PubMed]
- Lemon, S.M.; Ott, J.J.; Van Damme, P.; Shouval, D. Type A viral hepatitis: A summary and update on the molecular virology, epidemiology, pathogenesis and prevention. J. Hepatol. 2018, 68, 167–184. Available online: http://www.journal-of-hepatology.eu/article/S016882781732278X/fulltext (accessed on 28 December 2024). [CrossRef]
- Hofmeister, M.G.; Gupta, N.; Hepatitis A Mortality Investigators. Preventable Deaths During Widespread Community Hepatitis A Outbreaks—United States, 2016–2022. MMWR Morb. Mortal. Wkly. Rep. 2023, 72, 1128–1133. Available online: https://www.cdc.gov/mmwr/volumes/72/wr/mm7242a1.htm (accessed on 28 December 2024). [CrossRef]
- Hernandez-Suarez, G.; Saha, D.; Lodroño, K.; Boonmahittisut, P.; Taniwijaya, S.; Saha, A.; Badur, S.; Poovorawan, Y. Seroprevalence and incidence of hepatitis A in Southeast Asia: A systematic review. PLoS ONE 2021, 16, e0258659. Available online: https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0258659 (accessed on 28 December 2024). [CrossRef] [PubMed]
- Lee, G.Y.; Kim, W.K.; Cho, S.; Park, K.; Kim, J.; Lee, S.H.; Lee, J.; Lee, Y.-S.; Kim, J.H.; Byun, K.S.; et al. Genotyping and Molecular Diagnosis of Hepatitis A Virus in Human Clinical Samples Using Multiplex PCR-Based Next-Generation Sequencing. Microorganisms 2022, 10, 100. Available online: https://www.mdpi.com/2076-2607/10/1/100/htm (accessed on 28 December 2024). [CrossRef] [PubMed]
- Mellou, K.; Sideroglou, T.; Papaevangelou, V.; Katsiaflaka, A.; Bitsolas, N.; Verykouki, E.; Triantafillou, E.; Baka, A.; Georgakopoulou, T.; Hadjichristodoulou, C. Considerations on the Current Universal Vaccination Policy against Hepatitis A in Greece after Recent Outbreaks. PLoS ONE 2015, 10, e0116939. Available online: https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0116939 (accessed on 28 December 2024). [CrossRef]
- Mellou, K.; Chrysostomou, A.; Sideroglou, T.; Kyritsi, M.; Georgakopoulou, T.; Tsiodras, S.; Hadjichristodoulou, C. Epidemiology of hepatitis A in Greece in the last decade: Management of reported cases and outbreaks and lessons learned. Epidemiol. Infect. 2020, 148, e58. Available online: https://www.cambridge.org/core/journals/epidemiology-and-infection/article/epidemiology-of-hepatitis-a-in-greece-in-the-last-decade-management-of-reported-cases-and-outbreaks-and-lessons-learned/3291B7B929FFA64C459F0F4A08614C30 (accessed on 28 December 2024). [CrossRef] [PubMed]
- Chhabra, P.; de Graaf, M.; Parra, G.I.; Chan, M.C.W.; Green, K.; Martella, V.; Wang, Q.; White, P.A.; Katayama, K.; Vennema, H.; et al. Updated classification of norovirus genogroups and genotypes. J. Gen. Virol. 2019, 100, 1393–1406. Available online: https://www.microbiologyresearch.org/content/journal/jgv/10.1099/jgv.0.001318 (accessed on 28 December 2024). [CrossRef] [PubMed]
- Cao, R.; Ma, X.; Pan, M. Molecular characteristics of norovirus in sporadic and outbreak cases of acute gastroenteritis and in sewage in Sichuan, China. Virol. J. 2022, 19, 180. Available online: https://virologyj.biomedcentral.com/articles/10.1186/s12985-022-01897-w (accessed on 28 December 2024). [CrossRef] [PubMed]
- Chen, Q.; Ma, J.; Gao, L.; Xian, R.; Wei, K.; Shi, A.; Yuan, F.; Cao, M.; Zhao, Y.; Jin, M.; et al. Determination and analysis of whole genome sequence of recombinant GII.6[P7] norovirus in Ningxia, China. Infect. Genet. Evolution. 2023, 115, 105499. [Google Scholar] [CrossRef] [PubMed]
- Fang, Y.; Dong, Z.; Liu, Y.; Wang, W.; Hou, M.; Wu, J.; Wang, L.; Zhao, Y. Molecular epidemiology and genetic diversity of norovirus among hospitalized children with acute gastroenteritis in Tianjin, China, 2018–2020. BMC Infect. Dis. 2021, 21, 1–9. Available online: https://bmcinfectdis.biomedcentral.com/articles/10.1186/s12879-021-06375-2 (accessed on 28 December 2024). [CrossRef]
- Cannon, J.L.; Barclay, L.; Collins, N.R.; Wikswo, M.E.; Castro, C.J.; Magaña, L.C.; Gregoricus, N.; Marine, R.L.; Chhabra, P.; Vinjé, J. Genetic and Epidemiologic Trends of Norovirus Outbreaks in the United States from 2013 to 2016 Demonstrated Emergence of Novel GII.4 Recombinant Viruses. J. Clin. Microbiol. 2017, 55, 2208–2221. Available online: https://pubmed.ncbi.nlm.nih.gov/28490488/ (accessed on 28 December 2024). [CrossRef] [PubMed]
- Lee, D.H.; Ju, H.J.; Lee, Y.; Bae, Y.K. Development of RNA reference materials for norovirus GI and GII using digital PCR. Virology 2025, 603, 110358. [Google Scholar] [CrossRef] [PubMed]
- Ahmed, S.M.; Hall, A.J.; Robinson, A.E.; Verhoef, L.; Premkumar, P.; Parashar, U.D.; Koopmans, M.; Lopman, B.A. Global prevalence of norovirus in cases of gastroenteritis: A systematic review and meta-analysis. Lancet Infect. Dis. 2014, 14, 725–730. Available online: https://pubmed.ncbi.nlm.nih.gov/24981041/ (accessed on 28 December 2024). [CrossRef] [PubMed]
- Pouillot, R.; Smith, M.; Van Doren, J.M.; Catford, A.; Holtzman, J.; Calci, K.R.; Edwards, R.; Goblick, G.; Roberts, C.; Stobo, J.; et al. Risk Assessment of Norovirus Illness from Consumption of Raw Oysters in the United States and in Canada. Risk Anal. 2022, 42, 344–369. Available online: https://onlinelibrary.wiley.com/doi/full/10.1111/risa.13755 (accessed on 28 December 2024). [CrossRef] [PubMed]
- Parra, G.I.; Squires, R.B.; Karangwa, C.K.; Johnson, J.A.; Lepore, C.J.; Sosnovtsev, S.V.; Green, K.Y. Static and Evolving Norovirus Genotypes: Implications for Epidemiology and Immunity. PLoS Pathog. 2017, 13, e1006136. Available online: https://journals.plos.org/plospathogens/article?id=10.1371/journal.ppat.1006136 (accessed on 28 December 2024). [CrossRef] [PubMed]
- Ahn, S.Y.; Park, J.Y.; Lim, I.S.; Chae, S.A.; Yun, S.W.; Lee, N.M.; Kim, S.Y.; Choi, B.S.; Yi, D.Y. Changes in the Occurrence of Gastrointestinal Infections after COVID-19 in Korea. J. Korean Med. Sci. 2021, 36, e180. [Google Scholar] [CrossRef]
- Kirk, M.D.; Pires, S.M.; Black, R.E.; Caipo, M.; Crump, J.A.; Devleesschauwer, B.; Döpfer, D.; Fazil, A.; Fischer-Walker, C.L.; Hald, T.; et al. World Health Organization Estimates of the Global and Regional Disease Burden of 22 Foodborne Bacterial, Protozoal, and Viral Diseases, 2010: A Data Synthesis. PLoS Med. 2015, 12, e1001921. Available online: https://journals.plos.org/plosmedicine/article?id=10.1371/journal.pmed.1001921 (accessed on 28 December 2024).
- Hall, A.J.; Lopman, B.A.; Payne, D.C.; Patel, M.M.; Gastañaduy, P.A.; Vinjé, J.; Parashar, U.D. Norovirus disease in the United States. Emerg Infect. Dis. 2013, 19, 1198–1205. Available online: https://pubmed.ncbi.nlm.nih.gov/23876403/ (accessed on 28 December 2024). [CrossRef]
- Bryce, J.; Boschi-Pinto, C.; Shibuya, K.; Black, R.E. WHO estimates of the causes of death in children. Lancet 2005, 365, 1147–1152. [Google Scholar] [CrossRef] [PubMed]
- Mondal, S.; Feirer, N.; Brockman, M.; Preston, M.A.; Teter, S.J.; Ma, D.; Goueli, S.A.; Moorji, S.; Saul, B.; Cali, J. A direct capture method for purification and detection of viral nucleic acid enables epidemiological surveillance of SARS-CoV-2. Sci. Total Environ. 2021, 795, 148834. Available online: https://pmc.ncbi.nlm.nih.gov/articles/PMC8262391/ (accessed on 28 December 2024). [CrossRef]
- Costafreda, M.I.; Bosch, A.; Pintó, R.M. Development, evaluation, and standardization of a real-time TaqMan reverse transcription-PCR assay for quantification of hepatitis A virus in clinical and shellfish samples. Appl. Environ. Microbiol. 2006, 72, 3846–3855. Available online: https://pubmed.ncbi.nlm.nih.gov/16751488/ (accessed on 30 December 2024). [CrossRef] [PubMed]
- Svraka, S.; Duizer, E.; Vennema, H.; De Bruin, E.; Van Der Veer, B.; Dorresteijn, B.; Koopmans, M. Etiological role of viruses in outbreaks of acute gastroenteritis in The Netherlands from 1994 through 2005. J. Clin. Microbiol. 2007, 45, 1389–1394. Available online: https://pubmed.ncbi.nlm.nih.gov/17360839/ (accessed on 30 December 2024). [CrossRef] [PubMed]
- Kageyama, T.; Kojima, S.; Shinohara, M.; Uchida, K.; Fukushi, S.; Hoshino, F.B.; Takeda, N.; Katayama, K. Broadly reactive and highly sensitive assay for Norwalk-like viruses based on real-time quantitative reverse transcription-PCR. J. Clin. Microbiol. 2003, 41, 1548–1557. Available online: https://pubmed.ncbi.nlm.nih.gov/12682144/ (accessed on 30 December 2024). [CrossRef] [PubMed]
- Loisy, F.; Atmar, R.L.; Guillon, P.; Le Cann, P.; Pommepuy, M.; Le Guyader, F.S. Real-time RT-PCR for norovirus screening in shellfish. J. Virol. Methods 2005, 123, 1–7. Available online: https://pubmed.ncbi.nlm.nih.gov/15582692/ (accessed on 30 December 2024). [CrossRef]
- Chatziprodromidou, I.P.; Dimitrakopoulou, M.E.; Apostolou, T.; Katopodi, T.; Charalambous, E.; Vantarakis, A. Hepatitis A and E in the Mediterranean: A systematic review. Travel Med. Infect. Dis. 2022, 47, 102283. [Google Scholar] [CrossRef]
- Donnan, E.J.; Fielding, J.E.; Gregory, J.E.; Lalor, K.; Rowe, S.; Goldsmith, P.; Antoniou, M.; Fullerton, K.E.; Knope, K.; Copland, J.G.; et al. A Multistate Outbreak of Hepatitis A Associated with Semidried Tomatoes in Australia, 2009. Clin. Infect. Dis. 2012, 54, 775–781. [Google Scholar] [CrossRef]
- Demiray, T.; Köroğlu, M.; Jacobsen, K.H.; Özbek, A.; Terzi, H.A.; Altındiş, M. Hepatitis A virus epidemiology in Turkey as universal childhood vaccination begins: Seroprevalence and endemicity by region. Turk. J. Pediatr. 2016, 58, 480–491. Available online: https://pubmed.ncbi.nlm.nih.gov/28621088/ (accessed on 28 December 2024). [CrossRef] [PubMed]
- Hamza, H.; Abd-Elshafy, D.N.; Fayed, S.A.; Bahgat, M.M.; El-Esnawy, N.A.; Abdel-Mobdy, E. Detection and characterization of hepatitis A virus circulating in Egypt. Arch. Virol. 2017, 162, 1921–1931. Available online: https://link.springer.com/article/10.1007/s00705-017-3294-4 (accessed on 28 December 2024). [CrossRef] [PubMed]
- Poovorawan, Y.; Theamboonlers, A.; Chongsrisawat, V.; Jantaradsamee, P.; Chutsirimongkol, S.; Tangkijvanich, P. Clinical features and molecular characterization of hepatitis A virus outbreak in a child care center in Thailand. J. Clin. Virol. 2005, 32, 24–28. [Google Scholar] [CrossRef] [PubMed]
- Kwon, J.C.; Chang, H.Y.; Kwon, O.Y.; Park, J.H.; Oh, I.S.; Kim, H.J.; Lee, J.H.; Roh, H.-J.; Lee, H.W. Seroepidemiology of Hepatitis Viruses and Hepatitis B Genotypes of Female Marriage Immigrants in Korea. Yonsei Med. J. 2018, 59, 1072–1078. [Google Scholar] [CrossRef]
- Yusoff, F.A.; Rahman, R.A.; May, L.H.; Budart, S.B.; Sulaiman, L.H. Investigation of hepatitis A outbreak in district of Manjung, Perak, Malaysia, October 2012. West. Pac. Surveill. Response J. 2015, 6, 27. Available online: https://pmc.ncbi.nlm.nih.gov/articles/PMC4542483/ (accessed on 28 December 2024). [CrossRef]
- Chen, W.C.; Chiang, P.H.; Liao, Y.H.; Huang, L.C.; Hsieh, Y.J.; Chiu, C.M.; Lo, Y.C.; Yang, C.H.; Yang, J.Y. Outbreak of hepatitis a virus infection in Taiwan, June 2015 to September 2017. Eurosurveillance 2019, 24, 1800133. Available online: https://www.eurosurveillance.org/content/10.2807/1560-7917.ES.2019.24.14.1800133 (accessed on 28 December 2024). [CrossRef] [PubMed]
- Juniastuti Wahyuddin, D.; Nihayatussa’adah Amin, M.; Yamani, L.N.; Utsumi, T.; Sustini, F.; Lusida, M.I. Analysis of genetic and serology of hepatitis A virus infection during and after outbreak in two junior high schools in Surabaya, Indonesia. J. Med. Virol. 2019, 91, 1048–1055. Available online: https://onlinelibrary.wiley.com/doi/full/10.1002/jmv.25403 (accessed on 28 December 2024). [CrossRef]
- Snyder, M.R.; McGinty, M.D.; Shearer, M.P.; Meyer, D.; Hurtado, C.; Nuzzo, J.B. Outbreaks of hepatitis A in US communities, 2017–2018: Firsthand experiences and operational lessons from public health responses. Am. J. Public Health 2019, 109, S297–S302. Available online: https://ajph.aphapublications.org/doi/10.2105/AJPH.2019.305139 (accessed on 28 December 2024). [CrossRef]
- Naoumov, N.V. Hepatitis A and E. Medicine 2007, 35, 35–38. [Google Scholar] [CrossRef]
- Surveillance Atlas of Infectious Diseases. Available online: https://atlas.ecdc.europa.eu/public/index.aspx (accessed on 28 December 2024).
- Hepatitis A, Acute—National Public Health Organization. Available online: https://eody.gov.gr/disease/ipatitida-a-oxeia/ (accessed on 28 December 2024).
- Badur, S.; Öztürk, S.; Ozakay, A.; Khalaf, M.; Saha, D.; Van Damme, P. A review of the experience of childhood hepatitis A vaccination in Saudi Arabia and Turkey: Implications for hepatitis A control and prevention in the Middle East and North African region. Hum. Vaccin. Immunother. 2021, 17, 3710. Available online: https://pmc.ncbi.nlm.nih.gov/articles/PMC8437515/ (accessed on 30 December 2024). [CrossRef] [PubMed]
- Papadopoulos, A.G.; Fratsea, L.M.; Spyrellis, S.; Baltas, P. Exploring the contribution of migrant labour in Greek agriculture. Ital. Rev. Agric. Econ. 2021, 76, 33–48. [Google Scholar]
- Mellou, K.; Chrisostomou, A.; Sideroglou, T.; Georgakopoulou, T.; Kyritsi, M.; Hadjichristodoulou, C.; Tsiodras, S. Hepatitis a among refugees, asylum seekers and migrants living in hosting facilities, Greece, April to December 2016. Eurosurveillance 2017, 22, 30448. [Google Scholar] [CrossRef]
- National Vaccination Program for Children & Adolescents 2023—National Vaccination Program (NVP) for Children and Adolescents—Ministry of Health. Available online: https://www.moh.gov.gr/articles/health/dieythynsh-dhmosias-ygieinhs/emboliasmoi/ethniko-programma-emboliasmwn-epe-paidiwn-kai-efhbwn/11252-programma-emboliasmwn-paidiwn-efhbwn-2023 (accessed on 29 December 2024).
- Bosch, A.; Gkogka, E.; Le Guyader, F.S.; Loisy-Hamon, F.; Lee, A.; van Lieshout, L.; Marthi, B.; Myrmel, M.; Sansom, A.; Schultz, A.C.; et al. Foodborne viruses: Detection, risk assessment, and control options in food processing. Int. J. Food Microbiol. 2018, 285, 110–128. [Google Scholar] [CrossRef] [PubMed]
- Ng, T.L.; Chan, P.P.; Phua, T.H.; Loh, J.P.; Yip, R.; Wong, C.; Liaw, C.; Tan, B.; Chiew, K.; Chua, S.; et al. Oyster-associated outbreaks of Norovirus gastroenteritis in Singapore. J. Infect. 2005, 51, 413–418. [Google Scholar] [CrossRef] [PubMed]
- Rexin, D.; Kaas, L.; Langlet, J.; Croucher, D.; Hewitt, J. Droplet Digital PCR for Precise Quantification of Human Norovirus in Shellfish Associated with Gastroenteritis Illness. J. Food Prot. 2024, 87, 100363. [Google Scholar] [CrossRef] [PubMed]
- Lowther, J.A.; Cross, L.; Stapleton, T.; Gustar, N.E.; Walker, D.I.; Sills, M.; Treagus, S.; Pollington, V.; Lees, D.N. Use of F-Specific RNA Bacteriophage to Estimate Infectious Norovirus Levels in Oysters. Food Environ. Virol. 2019, 11, 247–258. Available online: https://link.springer.com/article/10.1007/s12560-019-09383-3 (accessed on 28 December 2024). [CrossRef]
- Analysis of the European baseline survey of norovirus in oysters. EFSA J. 2019, 17, e05762. [CrossRef]
- Torok, V.; Hodgson, K.; McLeod, C.; Tan, J.; Malhi, N.; Turnbull, A. National survey of foodborne viruses in Australian oysters at production. Food Microbiol. 2018, 69, 196–203. [Google Scholar] [CrossRef]
- Nachamkin, I.; Richard-Greenblatt, M.; Yu, M.; Bui, H. Reduction in Sporadic Norovirus Infections Following the Start of the COVID-19 Pandemic, 2019–2020, Philadelphia. Infect. Dis. Ther. 2021, 10, 1793–1798. Available online: https://link.springer.com/article/10.1007/s40121-021-00473-z (accessed on 28 December 2024). [CrossRef] [PubMed]
- Kittigul, L.; Thamjaroen, A.; Chiawchan, S.; Chavalitshewinkoon-Petmitr, P.; Pombubpa, K.; Diraphat, P. Prevalence and Molecular Genotyping of Noroviruses in Market Oysters, Mussels, and Cockles in Bangkok, Thailand. Food Environ. Virol. 2016, 8, 133–140. Available online: https://link.springer.com/article/10.1007/s12560-016-9228-6 (accessed on 28 December 2024). [CrossRef] [PubMed]
- Vantarakis, A.; Nearxou, A.; Pagonidis, D.; Melegos, F.; Seretidis, J.; Kokkinos, P.; Zarkadis, I.K.; Parasidis, T.; Alamanos, Y. An outbreak of hepatitis A in Roma populations living in three prefectures in Greece. Epidemiol. Infect. 2010, 138, 1025–1031. Available online: https://www.cambridge.org/core/journals/epidemiology-and-infection/article/an-outbreak-of-hepatitis-a-in-roma-populations-living-in-three-prefectures-in-greece/D2868824F4495281801A82AE29A2D6A5 (accessed on 30 December 2024). [CrossRef] [PubMed]
- Karagiannis, I.; Detsis, M.; Gkolfinopoulou, K.; Pervanidou, D.; Panagiotopoulos, T.; Bonovas, S. An outbreak of gastroenteritis linked to seafood consumption in a remote Northern Aegean island, February–March 2010. Rural Remote Health 2010, 10, 1507. [Google Scholar] [CrossRef] [PubMed]
Food Category | Type of Food |
---|---|
Vegetables | Okra, Sun-Dried Tomatoes, Garlic, Tomatoes, Salad, Lettuce, Spinach |
Fruits | Plums, Dates, Cherries, Apricots, Processed Fruits, Fruits, Mango |
Soft Fruits/Berries | Raspberries, Strawberries, Fragostafylla, Berries, Blueberries, Cranberries, Soft Fruits |
Animal-Based Products | Mussels |
Nuts and Seeds | Peanuts, Hazel, Cassius |
Processed Foods | Sun-Dried Tomatoes (Paste), Tomato (Paste), Sauces |
Others | Cinnamon |
Viruses | Primers and Probes | Sequence | References |
---|---|---|---|
Hepatitis A | HAV68 (Fw) | TCACCGCCGTTTGCCTAG | [33] |
HAV (Rv) | GGAGAGCCCTGGAAGAAAG | ||
HAV150 (Probe) | [FAM]-CCTGAACCTGCAGGAATTAA-[BHQ1] | ||
Norovirus GI | QNIF4 (Fw) | CGCTGGATGCGNTTCCAT | [34] |
NV1LCR (Rv) | CCTTAGACGCCATCATCATTTAC | ||
NVGG1p (Probe) | [FAM]-TGGACAGGAGAYCGCRATCT-[TAMRA] | ||
Norovirus GII | QNIFS (Fw) | ATGTTCAGRTGGATGAGRTTCTCWGA | [35,36] |
COG2R (Rv) | TCGACGCCATCTTCATTCACA | ||
QNIFs (Probe) | [FAM]-AGCACGTGGGAGGGCGATCG-[TAMRA] |
Type Of Food | Category | Kind | Origin | Month | Year | Virus |
---|---|---|---|---|---|---|
Okra | Vegetables | Frozen | Greece | December | 2019 | HAV |
Okra | Vegetables | Frozen | Greece | December | 2019 | HAV |
Mussels | Animal-Based Products | Frozen | Greece | March | 2020 | HAV |
Sun-Dried Tomatoes | Vegetables | Dried | Turkey | May | 2020 | HAV |
Sun-Dried Tomatoes | Vegetables | Dried | Turkey | August | 2020 | HAV |
Sun-Dried Tomatoes | Vegetables | Dried | Turkey | October | 2020 | HAV |
Sun-Dried Tomatoes | Vegetables | Dried | Turkey | October | 2020 | HAV |
Soft Fruits | Soft Fruits/ Berries | Frozen | Greece | November | 2020 | HAV |
Strawberries | Soft Fruits/Berries | Fresh | Greece | April | 2021 | NoV |
Strawberries | Soft Fruits/Berries | Fresh | Greece | July | 2021 | NoV |
Cherry | Fruits | Fresh | Greece | July | 2021 | NoV |
Sun-Dried Tomatoes (Paste) | Processed Foods | Fresh | Greece | March | 2024 | NoV |
Category | Total Samples | % Whole Sampling | Positive Samples | % Positivity per Category | % Positivity Whole Sampling |
---|---|---|---|---|---|
Vegetables | 138 | 68.32 | 6 | 4.35 | 2.97 |
Fruits | 16 | 7.92 | 0 | 0 | 0 |
Soft fruits/Berries | 37 | 18.32 | 1 | 2.70 | 0.5 |
Processed foods | 4 | 1.98 | 0 | 0 | 0 |
Nuts and Seeds | 5 | 2.48 | 0 | 0 | 0 |
Animal Based products | 1 | 0.5 | 1 | 100 | 0.5 |
Others | 1 | 0.5 | 0 | 0 | 0 |
Category | Total Samples | % Whole Sampling | Positive Samples | % Positivity per Category | % Positivity Whole Sampling |
---|---|---|---|---|---|
Vegetables | 17 | 26.56 | 0 | 0 | 0 |
Fruits | 7 | 10.94 | 1 | 14.29 | 1.56 |
Soft fruits/Berries | 31 | 48.44 | 2 | 6.45 | 3.12 |
Processed foods | 4 | 6.25 | 1 | 25 | 1.56 |
Nuts and Seeds | 0 | 0 | 0 | 0 | 0 |
Animal Based products | 5 | 7.81 | 0 | 0 | 0 |
Others | 0 | 0 | 0 | 0 | 0 |
Virus | Positive Tests | % Positive Tests | Virus Type Prevalence | Total Samples |
---|---|---|---|---|
Hepatitis A | 8 | 3.96 | 1.3–6.6 | 202 |
Norovirus GI/GII | 4 | 6.25 | 0.3–12.1 | 64 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Fokas, R.; Anastopoulou, Z.; Koukouvini, K.-A.; Dimitrakopoulou, M.-E.; Kotsiri, Z.; Chorti-Tripsa, E.; Kotsalou, C.; Tzimotoudis, D.; Vantarakis, A. Long-Term Surveillance of Food Products of Diverse Origins: A Five-Year Survey of Hepatitis A and Norovirus in Greece, 2019–2024. Pathogens 2025, 14, 135. https://doi.org/10.3390/pathogens14020135
Fokas R, Anastopoulou Z, Koukouvini K-A, Dimitrakopoulou M-E, Kotsiri Z, Chorti-Tripsa E, Kotsalou C, Tzimotoudis D, Vantarakis A. Long-Term Surveillance of Food Products of Diverse Origins: A Five-Year Survey of Hepatitis A and Norovirus in Greece, 2019–2024. Pathogens. 2025; 14(2):135. https://doi.org/10.3390/pathogens14020135
Chicago/Turabian StyleFokas, Rafail, Zoi Anastopoulou, Kalypso-Angeliki Koukouvini, Maria-Eleni Dimitrakopoulou, Zoi Kotsiri, Eleftheria Chorti-Tripsa, Chrysoula Kotsalou, Dimosthenis Tzimotoudis, and Apostolos Vantarakis. 2025. "Long-Term Surveillance of Food Products of Diverse Origins: A Five-Year Survey of Hepatitis A and Norovirus in Greece, 2019–2024" Pathogens 14, no. 2: 135. https://doi.org/10.3390/pathogens14020135
APA StyleFokas, R., Anastopoulou, Z., Koukouvini, K.-A., Dimitrakopoulou, M.-E., Kotsiri, Z., Chorti-Tripsa, E., Kotsalou, C., Tzimotoudis, D., & Vantarakis, A. (2025). Long-Term Surveillance of Food Products of Diverse Origins: A Five-Year Survey of Hepatitis A and Norovirus in Greece, 2019–2024. Pathogens, 14(2), 135. https://doi.org/10.3390/pathogens14020135