Isolation and Microbiological and Molecular Identification of Brucella abortus in Cattle and Pigs, Slaughtered in Cattle Sheds Located in Northern Sierra of Ecuador
Abstract
1. Introduction
2. Materials and Methods
2.1. Description and Location of the Study
2.2. Serological Tests for the Diagnosis of Brucellosis
2.3. Isolation and Biotyping of the Brucella Species
2.4. Molecular Identification and Typing of Brucella spp.
2.5. Data Analysis
3. Results
3.1. Bovine Testing Results
3.1.1. Serological Screening of Bovines
3.1.2. Isolation and Biotyping of Brucella Isolates
3.1.3. Molecular Identification
3.2. Swine Testing
4. Discussion
4.1. Brucellosis in Cattle
4.2. Molecular Characterization
4.3. Brucellosis in Swine
4.4. Value of Active Surveillance in Slaughterhouses
5. Conclusions
6. Study Limitations
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hull, N.C.; Schumaker, B.A. Comparisons of Brucellosis Between Human and Veterinary Medicine. Infect. Ecol. Epidemiol. 2018, 8, 1500846. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bonilla-Aldana, D.K.; Trejos-Mendoza, A.E.; Pérez-Vargas, S.; Rivera-Casas, E.; Muñoz-Lara, F.; Zambrano, L.I.; Arteaga-Livias, K.; Ulloque-Badaracco, J.R.; Alarcon-Braga, E.A.; Hernandez-Bustamante, E.A.; et al. A Systematic Review and Meta-Analysis of Bovine Brucellosis Seroprevalence in Latin America and the Caribbean. New Microbes New Infect. 2023, 54, 101168. [Google Scholar] [CrossRef] [Scilit]
- Khurana, S.K.; Sehrawat, A.; Tiwari, R.; Prasad, M.; Gulati, B.; Shabbir, M.Z.; Chhabra, R.; Karthik, K.; Patel, S.K.; Pathak, M.; et al. Bovine Brucellosis–A Comprehensive Review. Vet. Q. 2021, 41, 61–88. [Google Scholar]
- Lucero, N.E.; Ayala, S.M.; Escobar, G.I.; Jacob, N.R. Brucella Isolated in Humans and Animals in Latin America from 1968 to 2006. Epidemiol. Infect. 2008, 136, 496–503. [Google Scholar] [CrossRef] [Scilit]
- Paucar, V.; Ron-Román, J.; Benítez-Ortiz, W.; Celi, M.; Berkvens, D.; Saegerman, C.; Ron-Garrido, L. Bayesian Estimation of the Prevalence and Test Characteristics (Sensitivity and Specificity) of Two Serological Tests (RB and SAT-EDTA) for the Diagnosis of Bovine Brucellosis in Small and Medium Cattle Holders in Ecuador. Microorganisms 2021, 9, 1815. [Google Scholar] [CrossRef] [Scilit]
- Carbonero, A.; Guzmán, L.T.; García-Bocanegra, I.; Borge, C.; Adaszek, L.; Arenas, A.; Saa, L.R. Seroprevalence and Risk Factors Associated with Brucella Seropositivity in Dairy and Mixed Cattle Herds from Ecuador. Trop. Anim. Health Prod. 2018, 50, 197–203. [Google Scholar] [CrossRef] [Scilit]
- Parra, K.; Minda-Aluisa, E.; Navarro, J.C. Información Filogenética de Los Genes Bcsp31, Omp2a y Omp2b en el Diagnóstico y Epidemiología Molecular de Brucella spp.; Universidad Internacional SEK: Quito, Ecuador, 2021. [Google Scholar]
- Ron-Román, J.; Ron-Garrido, L.; Abatih, E.; Celi-Erazo, M.; Vizcaíno-Ordóñez, L.; Calva-Pacheco, J.; González-Andrade, P.; Berkvens, D.; Benítez-Ortíz, W.; Brandt, J.; et al. Bayesian Evaluation of Three Serological Tests for Detecting Antibodies against Brucella Spp. Among Humans in the Northwestern Part of Ecuador. Am. J. Trop. Med. Hyg. 2019, 100, 1312–1320. [Google Scholar] [CrossRef] [Scilit]
- Vinueza, R.L.; Durand, B.; Zanella, G. Network Analysis of Cattle Movements in Ecuador. Prev. Vet. Med. 2022, 201, 105608. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rodríguez-Hidalgo, R.; Contreras-Zamora, J.; Ortiz, W.B.; Guerrero-Viracocha, K.; Salcan-Guaman, H.; Minda-Aluisa, E.; Garrido, L.R. Circulating Strains of Brucella Abortus in Cattle in Santo Domingo de Los Tsáchilas Province-Ecuador. Front. Public Health 2015, 3, 45. [Google Scholar] [CrossRef] [Scilit]
- Hernández-Mora, G.; Ruíz-Villalobos, N.; Bonilla-Montoya, R.; Romero-Zúñiga, J.J.; Jiménez-Arias, J.; González-Barrientos, R.; Barquero-Calvo, E.; Chacón-Díaz, C.; Rojas, N.; Chaves-Olarte, E.; et al. Epidemiology of Bovine Brucellosis in Costa Rica: Lessons Learned from Failures in the Control of the Disease. PLoS ONE 2017, 12, e0182380. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bricker, B.J. PCR as a Diagnostic Tool for Brucellosis. Vet. Microbiol. 2002, 90, 435–446. [Google Scholar] [CrossRef] [Scilit]
- Bricker, B.J.; Halling, S.M. Differentiation of Brucella Abortus Bv.1,2, and 4, Brucella Melitensis, Brucella Ovis, and Brucella Suis Bv. 1 by PCR. J. Clin. Microbiol. 1994, 32, 2660–2666. [Google Scholar] [PubMed]
- Whatmore, A.M.; Gopaul, K.K. Recent Advances in Molecular Approaches to Brucella Diagnostics and Epidemiology. In Brucella: Molecular Microbiology and Genomics; López-Goñi, L., O’Callaghan, D., Eds.; Caister Academic Press: Norfolk, UK, 2012; pp. 57–88. [Google Scholar]
- Morgan, W.J.B. Techniques for the Brucellosis Laboratory: G. G. Alton, L.M. Jones, R.D. Angus & J. M. Verger Versailles Cedex: INRA Publications. 1988. 192pp. Ff 195. Br. Vet. J. 1990, 146, 188. [Google Scholar] [CrossRef] [Scilit]
- Clavareau, C.; Wellemans, V.; Walravens, K.; Tryland, M.; Verger, J.M.; Grayon, M.; Cloeckaert, A.; Letesson, J.J.; Godfroid, J. Phenotypic and Molecular Characterization of a Brucella Strain Isolated from a Minke Whale (Balaenoptera acutorostrata). Microbiology 1998, 144, 3267–3273. [Google Scholar] [CrossRef] [Scilit]
- Halling, S.M.; Tatum, F.M.; Bricker, B.J. Sequence and Characterization of an Insertion Sequence, IS711, from Brucella Ovis. Gene 1993, 133, 123–127. [Google Scholar] [CrossRef] [Scilit]
- Bricker, B.J.; Halling, S.M. Enhancement of the Brucella AMOS PCR Assay for Differentiation of Brucella Abortus Vaccine Strains S19 and RB51. J. Clin. Microbiol. 1995, 33, 1640–1642. [Google Scholar] [CrossRef] [Scilit]
- Ewalt, D.R.; Bricker, B.J. Validation of the Abbreviated Brucella AMOS PCR as a Rapid Screening Method for Differentiation of Brucella Abortus Field Strain Isolates and the Vaccine Strains, 19 and RB51. J. Clin. Microbiol. 2000, 38, 3085–3086. [Google Scholar] [CrossRef] [Scilit]
- Garrido-Haro, A.; Barrionuevo-Samaniego, M.; Moreno-Caballeros, P.; Burbano-Enriquez, A.; Sánchez-Vázquez, M.J.; Pompei, J.; Humblet, M.-F.; Ron-Román, J.; Saegerman, C. Seroprevalence and Risk Factors Related to Bovine Brucellosis in Continental Ecuador. Pathogens 2023, 12, 1134. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Martínez Herrera, D.I.; Abeledo, M.A.; Lara Gutiérrez, A.; Cardeña, A.P.; Robledo Salinas, M.L.; Pulido Camarillo, E.; Rosas Sastre, T.J.; Flores Castro, R. Evaluación de Métodos de Cultivo Para El Aislamiento Primario de Brucella Melitensis a Partir de Leche de Cabras Evaluation of Methods for the Primary Isolation of Brucella Melitensis in Goat Milk. Rev. Salud Anim. 2009, 31, 164–169. [Google Scholar]
- OIE. Brucelosis (Brucella Abortus, B. Melitensis y B. Suis). In Manual Terrestre de la OIE 2018; OIE: Paris, France, 2018; p. 48. [Google Scholar]
- Robert, G. Anatomía de Los Animales Domésticos, 5th ed.; Cynthia, E., Ghoshal, N.G., Daniel, H., Eds.; Masson, S.A.: Sarrià-Sant Gervasi, Barcelona, 2002; Volume Tomo II. [Google Scholar]
- Saegerman, C.; Berkvens, D.; Godfroid, J.; Walravens, K. Bovine Brucellosis. In Infectious and Parasitic Diseases of Livestock; CABI: Wallingford, UK, 2010; pp. 991–1011. [Google Scholar]
- Marín, C.M.; Alabart, J.L.; Blasco, J.M. Effect of Antibiotics Contained in Two Brucella Selective Media on Growth of Brucella Abortus, B. Melitensis, and B. Ovis. J. Clin. Microbiol. 1996, 34, 426–428. [Google Scholar] [CrossRef] [Scilit]
- Sangari, F.J.; Agüero, J.; García-Lobo, J.M. The Genes for Erythritol Catabolism Are Organized as an Inducible Operon in Brucella Abortus. Microbiology 2000, 146, 487–495. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Baum, M.; Zamir, O.; Bergman-Rios, R.; Katz, E.; Beider, Z.; Cohen, A.; Banai, M. Comparative Evaluation of Microagglutination Test and Serum Agglutination Test as Supplementary Diagnostic Methods for Brucellosis. J. Clin. Microbiol. 1995, 33, 2166–2170. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chimana, H.M.; Muma, J.B.; Samui, K.L.; Hang’ombe, B.M.; Munyeme, M.; Matope, G.; Phiri, A.M.; Godfroid, J.; Skjerve, E.; Tryland, M. A Comparative Study of the Seroprevalence of Brucellosis in Commercial and Small-Scale Mixed Dairy-Beef Cattle Enterprises of Lusaka Province and Chibombo District, Zambia. Trop. Anim. Health Prod. 2010, 42, 1541–1545. [Google Scholar] [CrossRef] [Scilit]
- Muñoz, P.M.; Mick, V.; Sacchini, L.; Janowicz, A.; de Miguel, M.J.; Cherfa, M.-A.; Nevado, C.R.; Girault, G.; Andrés-Barranco, S.; Jay, M.; et al. Phylogeography and Epidemiology of Brucella Suis Biovar 2 in Wildlife and Domestic Swine. Vet. Microbiol. 2019, 233, 68–77. [Google Scholar] [CrossRef] [Scilit]
- Ron-Román, J.; Ron-Garrido, L.; Abatih, E.; Celi-Erazo, M.; Vizcaíno-Ordóñez, L.; Calva-Pacheco, J.; González-Andrade, P.; Berkvens, D.; Benítez-Ortíz, W.; Brandt, J.; et al. Human Brucellosis in Northwest Ecuador: Typifying Brucella Spp., Seroprevalence, and Associated Risk Factors. Vector-Borne Zoonotic Dis. 2014, 14, 124–133. [Google Scholar] [CrossRef] [Scilit] [PubMed]



| Primer | Sequence (5′–3′) | Length |
|---|---|---|
| IS6501 3′ | GATAGAAGGCTTGAAGCTTGCGGAC | 260 bp |
| IS6501 5′ | ACGCCGGTGTATGGGAAAGGCTTTT | |
| IS711-specific | TGCCGATCACTTAAGGGCCTTCAT | |
| B. abortus—specific | GACGAACGGAATTTTTCCAATCCC | 498 bp |
| B. melitensis—specific | AAATCGCGTCCTTGCTGGTCTGA | 731 bp |
| B. ovis—specific | CGGGTTCTGGCACCATCGTCG | 976 bp |
| B. suis—specific | GCGCGGTTTTCTGAAGGTTCAGG | 285 bp |
| RB51/2308 | CCCCGGAAGATATGCTTCGATCC | 364 bp |
| eri 1 | GCGCCGCGAAGAACTTATCAA | 178 bp |
| eri 2 | CGCCATGTTAGCGGCGGTGA |
| Slaughterhouse Localization | Slaughterhouse | Province of Animal Origin | Sex of Animals Sampled | Bovines Sampled | Positive Serological Results | Microbiological Isolates | B. abortus bv 1 | B. abortus bv 4 | |||
|---|---|---|---|---|---|---|---|---|---|---|---|
| RB | SAT-EDTA | RB and SAT-EDTA * | Positives to Serology | ||||||||
| Carchi | 498 | ||||||||||
| Montúfar | 245 | ||||||||||
| Carchi | 245 | ||||||||||
| Female | 98 | 0 | 2 | 7 | 9 | 4 | 1 | 3 | |||
| Male | 147 | 2 | 2 | 1 | 5 | 0 | |||||
| Tulcán | 253 | ||||||||||
| Carchi | 253 | ||||||||||
| Female | 153 | 0 | 2 | 8 | 10 | 1 | 1 | ||||
| Male | 100 | 0 | 0 | 0 | 0 | 0 | |||||
| Imbabura | 290 | ||||||||||
| Antonio Ante | 119 | ||||||||||
| Imbabura | 119 | ||||||||||
| Female | 79 | 0 | 3 | 13 | 16 | 0 | |||||
| Male | 40 | 0 | 0 | 0 | 0 | 0 | |||||
| Ibarra | 171 | ||||||||||
| Carchi | 16 | ||||||||||
| Female | 1 | 0 | 0 | 0 | 0 | 0 | |||||
| Male | 15 | 0 | 0 | 0 | 0 | 0 | |||||
| Imbabura | 155 | ||||||||||
| Female | 35 | 0 | 2 | 2 | 4 | 0 | |||||
| Male | 120 | 0 | 5 | 0 | 5 | 2 | 2 | ||||
| Pichincha | 1266 | ||||||||||
| Cayambe | 313 | ||||||||||
| Carchi | 2 | ||||||||||
| Female | 2 | 0 | 0 | 0 | 0 | 0 | |||||
| Male | 0 | 0 | 0 | 0 | 0 | 0 | |||||
| Imbabura | 189 | ||||||||||
| Female | 142 | 0 | 4 | 0 | 4 | 1 | 1 | ||||
| Male | 47 | 0 | 0 | 0 | 0 | 0 | |||||
| ND | 2 | ||||||||||
| Female | 1 | 0 | 0 | 0 | 0 | 0 | |||||
| Male | 1 | 0 | 0 | 0 | 0 | 0 | |||||
| Pichincha | 120 | ||||||||||
| Female | 95 | 0 | 3 | 3 | 6 | 0 | |||||
| Male | 25 | 0 | 0 | 0 | 0 | 0 | |||||
| Mejía | 953 | ||||||||||
| Cañar | 2 | ||||||||||
| Female | 0 | 0 | 0 | 0 | 0 | 0 | |||||
| Male | 2 | 0 | 0 | 0 | 0 | 0 | |||||
| Cotopaxi | 29 | ||||||||||
| Female | 25 | 0 | 0 | 2 | 2 | 0 | |||||
| Male | 4 | 0 | 0 | 0 | 0 | 0 | |||||
| Manabí | 259 | ||||||||||
| Female | 240 | 0 | 2 | 3 | 5 | 1 | 1 | ||||
| Male | 19 | 0 | 0 | 1 | 1 | 0 | |||||
| Pichincha | 540 | ||||||||||
| Female | 406 | 4 | 7 | 45 | 56 | 7 | 2 | 5 | |||
| Male | 134 | 2 | 2 | 0 | 4 | 1 | 1 | ||||
| Santo Domingo | 96 | ||||||||||
| Female | 87 | 0 | 0 | 5 | 5 | 0 | |||||
| Male | 9 | 1 | 0 | 0 | 1 | 0 | |||||
| Tungurahua | 27 | ||||||||||
| Female | 9 | 0 | 0 | 2 | 2 | 0 | |||||
| Male | 18 | 0 | 0 | 0 | 0 | 0 | |||||
| Total | 2054 | 9 | 34 | 92 | 135 | 17 | 4 | 13 | |||
| Sample Code | Zootechnical Information | Sampling Area and Animal Origin | Serological Test Results | Species and Biovar | |||||
|---|---|---|---|---|---|---|---|---|---|
| Age (Months) | Sex | Race | Province Location Slaughterhouse | Slaughterhouse | Province of Animal Origin | RB | SAT-EDTA (IAU) | ||
| 1 | 48 | M | Taurus | Pichincha | Machachi | Pichincha | + | 15 | B. abortus bv 4 |
| 2 | 66 | F | Taurus | Pichincha | Machachi | Pichincha | + | 5120 | B. abortus bv 1 |
| 3 | 30 | F | Taurus | Pichincha | Machachi | Pichincha | + | 800 | B. abortus bv 4 |
| 4 | 60 | F | Taurus | Pichincha | Machachi | Pichincha | + | 3200 | B. abortus bv 4 |
| 5 | 48 | F | Taurus | Pichincha | Machachi | Pichincha | + | 800 | B. abortus bv 4 |
| 6 | 48 | F | Taurus | Pichincha | Machachi | Pichincha | + | 1600 | B. abortus bv 1 |
| 7 | 42 | F | Taurus | Pichincha | Machachi | Pichincha | + | 800 | B. abortus bv 4 |
| 8 | 72 | F | Taurus | Pichincha | Machachi | Pichincha | + | 200 | B. abortus bv 4 |
| 9 | 48 | F | Taurus | Pichincha | Machachi | Manabí | − | 50 | B. abortus bv 4 |
| 10 | 54 | F | Taurus | Pichincha | Cayambe | Imbabura | − | 100 | B. abortus bv 4 |
| 11 | 24 | M | Taurus | Imbabura | Ibarra | Imbabura | − | 80 | B. abortus bv 4 |
| 12 | 18 | M | Taurus | Imbabura | Ibarra | Imbabura | − | 40 | B. abortus bv 4 |
| 13 | 60 | F | Taurus | Carchi | San Gabriel | Carchi | ++++ | 800 | B. abortus bv 4 |
| 14 | 72 | F | Taurus | Carchi | San Gabriel | Carchi | ++++ | 3200 | B. abortus bv 4 |
| 15 | 42 | F | Taurus | Carchi | Tulcán | Carchi | ++++ | 3200 | B. abortus bv 1 |
| 16 | 60 | F | Taurus | Carchi | San Gabriel | Carchi | +++ | 240 | B. abortus bv 1 |
| 17 | 54 | F | Taurus | Carchi | San Gabriel | Carchi | ++++ | 6400 | B. abortus bv 4 |
| Code | Microbiological Test Results | Growth Inhibition on Colorants | Agglutination with Serum | Species and Biovar | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Organ | Catalase | Oxidase | Urease Activity | H2S Production | CO2 Requirement | Thionin 20 µg | Thionin 10 µg | Basic Fuschin 20 µg | Safranin 100 µg | Anti A | Anti M | ||
| 1 | Liver | + | + | + | + | + | − | − | + | + | − | + | B. abortus bv 4 |
| 2 | Lymph nodes | + | + | + | + | + | − | − | + | + | + | − | B. abortus bv 1 |
| 3 | Lymph nodes | + | + | − | + | + | − | − | + | + | − | + | B. abortus bv 4 |
| 4 | Lymph nodes | + | + | − | + | + | − | − | + | + | − | + | B. abortus bv 4 |
| 5 | Lymph nodes | + | + | + | + | + | − | − | + | + | − | + | B. abortus bv 4 |
| 6 | Lymph nodes | + | + | + | + | + | − | − | + | + | + | − | B. abortus bv 1 |
| 7 | Lymph nodes | + | + | − | + | + | − | − | + | + | − | + | B. abortus bv 4 |
| 8 | Lymph nodes | + | + | + | + | + | − | − | + | + | − | + | B. abortus bv 4 |
| 9 | Liver, spleen, lymph nodes | + | + | + | + | + | − | − | + | + | − | + | B. abortus bv 4 |
| 10 | Liver | + | + | + | + | + | − | − | + | + | − | + | B. abortus bv 4 |
| 11 | Spleen | + | + | + | + | + | − | − | + | + | − | + | B. abortus bv 4 |
| 12 | Liver | + | + | + | + | + | − | − | + | + | − | + | B. abortus bv 4 |
| 13 | Lymph nodes | + | + | + | + | + | − | − | + | + | − | + | B. abortus bv 4 |
| 14 | Lymph nodes | + | + | + | + | + | − | − | − a | − | − | + | B. abortus bv 4 |
| 15 | Lymph nodes, spleen | + | + | + | + | + | − | − | + | + | + | − | B. abortus bv 1 |
| 16 | Lymph nodes, spleen | + | + | + | + | + | − | − | + | + | + | − | B. abortus bv 1 |
| 17 | Lymph nodes | + | + | + | + | + | − | − | + | + | − | + | B. abortus bv 4 |
| C-B2 | + | + | + | + | + | − | − | − | − | + | − | B. abortus bv 2 | |
| C-B9 | + | + | + | − | + | + | + | + | + | − | + | B. abortus bv 9 | |
| C-B1 | + | + | + | + a | + | − | − | + | + | + | − | B. abortus bv 1 | |
| C-B4 | + | + | + | + | + | − | − | + a | + | − | + | B. abortus bv 4 | |
| Sample Code | Molecular Test Results | ||
|---|---|---|---|
| PCR IS711 | AMOS PCR | mAMOS PCR | |
| 1 | Brucella spp. | B. abortus bv. 4 | NP |
| 2 | Brucella spp. | B. abortus bv. 1 | Field strain |
| 3 | Brucella spp. | B. abortus bv. 4 | NP |
| 4 | Brucella spp. | B. abortus bv. 4 | NP |
| 5 | Brucella spp. | B. abortus bv. 4 | NP |
| 6 | Brucella spp. | B. abortus bv. 1 | Field strain |
| 7 | Brucella spp. | B. abortus bv. 4 | NP |
| 8 | Brucella spp. | B. abortus bv. 4 | NP |
| 9 | Brucella spp. | B. abortus bv. 4 | NP |
| 10 | Brucella spp. | B. abortus bv. 4 | NP |
| 11 | Brucella spp. | B. abortus bv. 4 | NP |
| 12 | Brucella spp. | B. abortus bv. 4 | NP |
| 13 | Brucella spp. | B. abortus bv. 4 | NP |
| 14 | Brucella spp. | B. abortus bv. 4 | NP |
| 15 | Brucella spp. | B. abortus bv. 1 | Field strain |
| 16 | Brucella spp. | B. abortus bv. 1 | Field strain |
| 17 | Brucella spp. | B. abortus bv. 4 | NP |
| Province Location Slaughterhouse | Slaughterhouse | Province of Animal Origin | Sex of Animals Sampled | Number of Samples | Serological Test Results | Microbiological Isolates | |||
|---|---|---|---|---|---|---|---|---|---|
| RB | SAT-EDTA | RB and SAT-EDTA | Positives to Serology | ||||||
| Carchi | 566 | ||||||||
| San Gabriel | 160 | ||||||||
| Carchi | 160 | ||||||||
| Female | 76 | 0 | 0 | 0 | 0 | 0 | |||
| Male | 84 | 1 | 0 | 0 | 1 | 0 | |||
| Tulcán | 406 | ||||||||
| Carchi | 406 | ||||||||
| Female | 203 | 0 | 0 | 0 | 0 | 0 | |||
| Male | 203 | 0 | 1 | 0 | 1 | 0 | |||
| Imbabura | 365 | ||||||||
| Atuntaqui | 114 | ||||||||
| Imbabura | 114 | 0 | |||||||
| Female | 33 | 1 | 1 | 0 | 2 | 0 | |||
| Male | 81 | 0 | 2 | 0 | 2 | 0 | |||
| Ibarra | 251 | 0 | |||||||
| Imbabura | 251 | 0 | |||||||
| Female | 173 | 0 | 0 | 0 | 0 | 0 | |||
| Male | 78 | 0 | 0 | 0 | 0 | 0 | |||
| Pichincha | 119 | ||||||||
| Cayambe | 119 | ||||||||
| Imbabura | 7 | ||||||||
| Female | 5 | 0 | 0 | 1 | 1 | 0 | |||
| Male | 2 | 0 | 0 | 0 | 0 | 0 | |||
| Pichincha | 112 | ||||||||
| Female | 69 | 0 | 4 | 0 | 4 | 0 | |||
| Male | 43 | 0 | 0 | 0 | 0 | 0 | |||
| Total | 1050 | 2 | 8 | 1 | 11 | 0 | |||
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Celi-Erazo, M.; Minda-Aluisa, E.; Olmedo-Pinchao, L.; Ron-Garrido, L.; Ortega-Sierra, T.; López-Balladares, J.; Carlosama-Yépez, M.; Gonzalón-Alcarraz, S.; de Waard, J.H.; Saegerman, C.; et al. Isolation and Microbiological and Molecular Identification of Brucella abortus in Cattle and Pigs, Slaughtered in Cattle Sheds Located in Northern Sierra of Ecuador. Pathogens 2025, 14, 1003. https://doi.org/10.3390/pathogens14101003
Celi-Erazo M, Minda-Aluisa E, Olmedo-Pinchao L, Ron-Garrido L, Ortega-Sierra T, López-Balladares J, Carlosama-Yépez M, Gonzalón-Alcarraz S, de Waard JH, Saegerman C, et al. Isolation and Microbiological and Molecular Identification of Brucella abortus in Cattle and Pigs, Slaughtered in Cattle Sheds Located in Northern Sierra of Ecuador. Pathogens. 2025; 14(10):1003. https://doi.org/10.3390/pathogens14101003
Chicago/Turabian StyleCeli-Erazo, Maritza, Elizabeth Minda-Aluisa, Lisbeth Olmedo-Pinchao, Lenin Ron-Garrido, Tania Ortega-Sierra, Julián López-Balladares, Marlon Carlosama-Yépez, Santiago Gonzalón-Alcarraz, Jacobus H. de Waard, Claude Saegerman, and et al. 2025. "Isolation and Microbiological and Molecular Identification of Brucella abortus in Cattle and Pigs, Slaughtered in Cattle Sheds Located in Northern Sierra of Ecuador" Pathogens 14, no. 10: 1003. https://doi.org/10.3390/pathogens14101003
APA StyleCeli-Erazo, M., Minda-Aluisa, E., Olmedo-Pinchao, L., Ron-Garrido, L., Ortega-Sierra, T., López-Balladares, J., Carlosama-Yépez, M., Gonzalón-Alcarraz, S., de Waard, J. H., Saegerman, C., Ron-Román, J., & Benítez-Ortiz, W. (2025). Isolation and Microbiological and Molecular Identification of Brucella abortus in Cattle and Pigs, Slaughtered in Cattle Sheds Located in Northern Sierra of Ecuador. Pathogens, 14(10), 1003. https://doi.org/10.3390/pathogens14101003

