A Novel Cryptic Virus Isolated from Galphimia spp. in Mexico
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Material, RNA Extraction, and High-Throughput Sequencing
2.2. Data Processing and Phylogenetic Analysis
2.3. Validation by RT-PCR
3. Results
3.1. Identification of Viruses That Infect Galphimia spp.
3.2. Validation of Novel Virus by RT-PCR
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Anderson, C. Revision of Galphimia (Malpighiaceae). Contr. Univ. Mich. Herb. 2007, 25, 1–82. [Google Scholar]
- Sharma, A.; Angulo-Bejarano, P.I.; Madariaga-Navarrete, A.; Oza, G.; Iqbal, H.M.N.; Cardoso-Taketa, A.; Villarreal, M.L. Multidisciplinary investigations on Galphimia glauca: A Mexican medicinal plant with pharmacological potential. Molecules 2018, 15, 2985. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Herrera-Arellano, A.; Jiménez-Ferrer, J.E.; Zamilpa, A.; García-Alonso, G.; Herrera-Alvarez, S.; Tortoriello, J. Therapeutic effectiveness of Galphimia glauca vs lorazepam in generalized anxiety disorder. A controlled 15-week clinical trial. Planta Med. 2012, 78, 1529–1535. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Romero-Cerecero, O.; Islas-Garduño, A.L.; Zamilpa, A.; Pérez-García, M.D.; Tortoriello, J. Therapeutic effectiveness of Galphimia glauca in young people with social anxiety disorder: A pilot study. Evid. Based Complement. Alternat. Med. 2018, 2018, 1716939. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Osuna, L.; Pereda-Miranda, R.; Tortoriello, J.; Villarreal, M.L. Production of the sedative triterpene galphimine b in Galphima glauca tissue culture. Planta Med. 1999, 65, 149–152. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rios, M.Y.; Ortega, A.; Domínguez, B.; Déciga, M.; Rosa, V. Glaucacetalin E and galphimidin B from Galphimia glauca and their anxiolytic activity. J. Ethnopharmacol. 2020, 259, 112939. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Iglesias, D.; Donato-Capote, M.; Méndez-Tenorio, A.; Valdivia, A.V.; Gutiérrez-García, C.; Paul, S.; Iqbal, H.M.N.; Villarreal, M.L.; Sharma, A. Identification of putative candidate genes from Galphimia spp. encoding enzymes of the galphimines triterpenoids synthesis pathway with anxiolytic and sedative effects. Plants 2022, 11, 1879. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stergiopoulos, L.; Gordon, T.R. Cryptic fungal infections: The hidden agenda of plant pathogens. Front. Plant Sci. 2014, 5, 10–13. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Takahashi, H.; Fukuhara, T.; Kitazawa, H.; Kormelink, R. Virus latency and the impact on Plants. Front. Microbiol. 2019, 10, 2764. [Google Scholar] [CrossRef] [Scilit]
- Rumbou, A.; Candresse, T.; Marais, A.; Svanella-Dumas, L.; Landgraf, M.; von Bargen, S.; Büttner, C. Unravelling the virome in birch: RNA-Seq reveals a complex of known and novel viruses. PLoS ONE 2020, 15, e0221834. [Google Scholar] [CrossRef] [Scilit]
- Zhang, S.; Yang, L.; Ma, L.; Tian, X.; Li, R.; Zhou, C.; Cao, M. Virome of Camellia japonica: Discovery of and molecular characterization of new viruses of different taxa in camellias. Front. Microbiol. 2020, 11, 945. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Villamor, D.E.V.; Ho, T.; Al Rwahnih, M.; Martin, R.R.; Tzanetakis, I.E. High throughput sequencing for plant virus detection and discovery. Phytopathology 2019, 109, 716–725. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Byrne, M.; Kashyap, A.; Esquiro, L.; Ranson, N.; Sainsbury, F. The structure of a plant-specific partitivirus capsid reveals a unique coat protein domain architecture with an intrinsically disordered protrusion. Commun. Biol. 2021, 4, 1155. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vainio, E.J.; Chiba, S.; Ghabrial, S.A.; Maiss, E.; Roossinck, M.; Sabanadzovic, S. ICTV Report Consortium. ICTV virus taxonomy profile: Partitiviridae. J. Gen. Virol. 2018, 99, 17–18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shimura, H.; Kim, H.; Matsuzawa, A.; Akino, S.; Masuta, C. Coat protein of partitiviruses isolated from mycorrhizal fungi functions as an RNA silencing suppressor in plants and fungi. Sci. Rep. 2022, 12, 7855. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xiao, X.; Cheng, J.; Tang, J.; Fu, Y.; Jiang, D.; Baker, T.S.; Ghabrial, S.A.; Xie, J. A novel Partitivirus that confers hypovirulence on plant pathogenic fungi. J. Virol. 2014, 88, 10120–10133. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Massart, S.; Chiumenti, M.; De Jonghe, K.; Glover, R.; Haegeman, A.; Koloniuk, I.; Komínek, P.; Kreuze, J.; Kutnjak, D.; Lotos, L.; et al. Virus detection by high-throughput sequencing of small RNAs: Large-scale performance testing of sequence analysis strategies. Phytopathology 2019, 109, 488–497. [Google Scholar] [CrossRef] [Scilit]
- Nchongboh, G.; Minarovits, J.; Richert-Pöggeler, K.R. Virus latency: Heterogeneity of host-virus interaction in shaping the virosphere. In Plant Virus-Host Interaction, 2nd ed.; Gaur, R.K., Khurana, S.M.P., Sharma, P., Hohn, T., Eds.; Publishre; Academic Press: Cambridge, MA, USA, 2021; pp. 111–137. [Google Scholar]
- Zhang, F.; Su, X.; Zhang, S.; Wang, M.; Wang, T.; Zheng, X.; Zhang, Z. Genomic characterization and seed transmission of a novel unclassified partitivirus infecting Polygonatum kingianum Coll. et Hemsl. Heliyon 2023, 9, e16719. [Google Scholar] [CrossRef] [Scilit]
- Gutiérrez-Sánchez, Á.; Cobos, A.; López-Herranz, M.; Canto, T.; Pagán, I. Environmental conditions modulate plant virus vertical transmission and survival of infected seeds. Phytopathology 2023, 113, 1773–1787. [Google Scholar] [CrossRef] [Scilit]
- Pagán, I. Transmission through seeds: The unknown life of plant viruses. PLoS Pathog. 2022, 18, e1010707. [Google Scholar] [CrossRef]
- Li, L.; Liu, J.; Zhang, Q.; Fu, R.; Zhu, X.; Li, C.; Chen, J. Seed-borne viral dsRNA elements in three cultivated Raphanus and Brassica plants suggest three cryptoviruses. Can. J. Microbiol. 2016, 62, 287–295. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Grasis, J.A. The intra-dependence of viruses and the holobiont. Front. Immunol. 2017, 9, 1501. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nakatsukasa-Akune, M.; Yamashita, K.; Shimoda, Y.; Uchiumi, T.; Abe, M.; Aoki, T.; Kamizawa, A.; Ayabe, S.I.; Higashi, S.; Suzuki, A. Suppression of root nodule formation by artificial expression of the TrEnodDR1 (coat protein of White clover cryptic virus 1) gene in Lotus japonicus. Mol. Plant Microbe Interact. 2005, 18, 1069–1080. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Takahashi, H.; Shoji, H.; Ando, S.; Kanayama, Y.; Kusano, T.; Takeshita, M.; Suzuki, M.; Masuta, C. RCY1-mediated resistance to Cucumber mosaic virus is regulated by LRR domain-mediated interaction with CMV(Y) following degradation of RCY1. Mol. Plant Microbe Interact. 2012, 25, 1171–1185. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tomita, R.; Sekine, K.T.; Mizumoto, H.; Sakamoto, M.; Murai, J.; Kiba, A.; Hikichi, Y.; Suzuki, K.; Kobayashi, K. Genetic basis for the hierarchical interaction between Tobamovirus spp. and L resistance gene alleles from different pepper species. Mol. Plant Microbe Interact. 2011, 24, 108–117. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Richard, M.M.S.; Knip, M.; Schachtschabel, J.; Beijaert, M.S.; Takken, F.L.W. Perturbation of nuclear-cytosolic shuttling of Rx1 compromises extreme resistance and translational arrest of potato virus X transcripts. Plant J. 2021, 106, 468–479. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, S.B.; Lee, H.Y.; Seo, S.; Lee, J.H.; Choi, D. RNA-dependent RNA polymerase (NIb) of the potyviruses is an avirulence factor for the broad-spectrum resistance gene Pvr4 in Capsicum annuum cv. CM334. PLoS ONE 2015, 10, e0119639. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mishra, J.; Srivastava, R.; Trivedi, P.K.; Verma, P.C. Effect of virus infection on the secondary metabolite production and phytohormone biosynthesis in plants. 3 Biotech 2020, 10, 547. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Akhter, M.S.; Nakahara, K.S.; Masuta, C. Resistance induction based on the understanding of molecular interactions between plant viruses and host plants. Virol. J. 2021, 18, 176. [Google Scholar] [CrossRef] [Scilit]
- Blanco-Ulate, B.; Hopfer, H.; Figueroa-Balderas, R.; Ye, Z.; Rivero, R.M.; Albacete, A.; Pérez-Alfocea, F.; Koyama, R.; Anderson, M.M.; Smith, R.J.; et al. Red blotch disease alters grape berry development and metabolism by interfering with the transcriptional and hormonal regulation of ripening. J. Exp. Bot. 2017, 68, 1225–1238. [Google Scholar] [CrossRef] [Scilit]
- Chen, S.; Yu, N.; Yang, S.; Zhong, B.; Lan, H. Identification of Telosma mosaic virus infection in Passiflora edulis and its impact on phytochemical contents. Virol. J. 2018, 15, 168. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Parizad, S.; Dizadji, A.; Habibi, M.K.; Winter, S.; Kalantari, S.; Movi, S.; Tendero, C.; Alonso, G.L.; Moratalla-Lopez, N. The effects of geographical origin and virus infection on the saffron (Crocus sativus L.) quality. Food Chem. 2019, 295, 387–394. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hamelin, F.M.; Hilker, F.M.; Sun, T.A.; Jeger, M.J.; Hajimorad, M.R.; Allen, L.J.S.; Prendeville, H.R. The evolution of parasitic and mutualistic plantvirus symbioses through transmission-virulence trade-offs. Virus Res. 2017, 241, 77–87. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gesto-Borroto, R.; Cardoso-Taketa, A.; Yactayo-Chang, J.P.; Medina-Jiménez, K.; Hornung-Leoni, C.; Lorence, A.; Villarreal, M.L. DNA barcoding and TLC as tools to properly identify natural populations of the Mexican medicinal species Galphimia glauca Cav. PLoS ONE 2019, 14, e0217313. [Google Scholar] [CrossRef] [Scilit] [PubMed]



| Gene Target | Primer Name | Primer Sequence | PCR Product Length (bp) |
|---|---|---|---|
| RNA-dependent RNA polymerase | GCV_RdRp | F 5′CATACACGCGCAATGTCTCG 3′ R 5′TGTGCCCAGTAAGTGTTCCC 3′ | 503 |
| Coat protein | GCV_CP | F 5′TGTTTCGAACAGGGACTCCG 3′ R 5′TACTTCGTAACCACCGTGCC 3′ | 565 |
| Virus Name | Host | Identity (%) |
|---|---|---|
| RNA-dependent RNA polymerase (RdRp) | ||
| Vitis cryptic virus | Vitis coignetiae | 65.40 |
| Dichroa partitivirus 2 | Dichroa sp. | 64.54 |
| Citrullus lanatus cryptic virus | Citrullus lanatus | 63.83 |
| Citrullus lanatus partitivirus | Citrullus lanatus | 63.40 |
| Polygonatum partitivirus 2 | Polygonatum kingianum | 62.00 |
| Arceuthobium sichuanense virus 7 | Arceuthobium sichuanense | 60.76 |
| Mercurialis partitivirus 1 | Mercurialis perennis | 62.13 |
| Raphanus sativus cryptic virus 3 | Raphanus sativus | 60.93 |
| Panax cryptic virus 1 | Panax sp. | 61.91 |
| Coriandrum sativum deltapartitivirus 2 | Coriandrum sativum | 61.36 |
| Coat protein (CP) | ||
| Vitis cryptic virus | Vitis coignetiae | 45.21 |
| Dichroa partitivirus 2 | Dichroa sp. | 45.64 |
| Arceuthobium sichuanense virus 7 | Arceuthobium sichuanense | 41.69 |
| Pittosporum cryptic virus 1 | Pittosporum tobira | 42.65 |
| Dactylorhiza cryptic virus 3 | Dactylorhiza sp. | 39.36 |
| Panax cryptic virus 1 | Panax sp. | 39.61 |
| Polygonatum partitivirus 2 | Polygonatum kingianum | 40.15 |
| Citrullus lanatus partitivirus | Citrullus lanatus | 40.21 |
| Citrullus lanatus cryptic virus | Citrullus lanatus | 40.57 |
| Coriandrum sativum deltapartitivirus 2 | Coriandrum sativum | 39.48 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Iglesias, D.; Stevens, K.; Sharma, A.; Diaz-Lara, A. A Novel Cryptic Virus Isolated from Galphimia spp. in Mexico. Pathogens 2024, 13, 504. https://doi.org/10.3390/pathogens13060504
Iglesias D, Stevens K, Sharma A, Diaz-Lara A. A Novel Cryptic Virus Isolated from Galphimia spp. in Mexico. Pathogens. 2024; 13(6):504. https://doi.org/10.3390/pathogens13060504
Chicago/Turabian StyleIglesias, Dianella, Kristian Stevens, Ashutosh Sharma, and Alfredo Diaz-Lara. 2024. "A Novel Cryptic Virus Isolated from Galphimia spp. in Mexico" Pathogens 13, no. 6: 504. https://doi.org/10.3390/pathogens13060504
APA StyleIglesias, D., Stevens, K., Sharma, A., & Diaz-Lara, A. (2024). A Novel Cryptic Virus Isolated from Galphimia spp. in Mexico. Pathogens, 13(6), 504. https://doi.org/10.3390/pathogens13060504

