Identification of Germinants and Expression of Germination Genes in Clostridium perfringens Strains Isolated from Diarrheic Animals
Abstract
:1. Introduction
2. Materials and Methods
2.1. Bacterial Strains and Growth Conditions
2.2. Purification of C. perfringens Spores
2.3. Preparation of Germinant Solutions
2.4. Spore Germination Assay
2.5. Colony Formation Assay
2.6. Extraction of Total RNA and Reverse-Transcription Quantitative Polymerase Chain Reaction (RT-qPCR) Assay
2.7. Preparation of Spore Extracts and Western Blot Analysis
2.8. Statistical Analysis
3. Results
3.1. Germination of Spores of C. perfringens Animal Strains with Known Germinants
3.2. Germination of C. perfringens Animal Strains Spores with Individual Amino Acids
3.3. Effect of pH and Concentrations of L-Cysteine and L-Lysine on Germination of Spores of Animal Strains
3.4. Expression of Germination-Specific Genes in C. perfringens Animal Strains
3.5. Levels of Germination Proteins in C. perfringens Animal Strains
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- McClane, B.A.; Robertson, S.L.; Li, J. Clostridium perfringens. In Food Microbiology: Fundamentals and Frontiers, 4th ed.; Doyle, M.P., Buchanan, R.L., Eds.; ASM Press: Washington, DC, USA, 2013. [Google Scholar]
- McClane, B.A.; Uzal, F.A.; Miyakawa, M.E.F.; Lyerly, D.; Wilkins, T. The enterotoxic clostridia. In The Prokaryotes, 3rd ed.; Dworkin, M., Falkow, S., Rosenberg, E., Schleifer, K.-H., Stackebrandt, E., Eds.; Springer: New York, NY, USA, 2006; Volume 4, pp. 698–752. [Google Scholar]
- Uzal, F.A.; Freedman, J.C.; Shrestha, A.; Theoret, J.R.; Garcia, J.; Awad, M.M.; Adams, V.; Moore, R.J.; Rood, J.I.; McClane, B.A. Towards an understanding of the role of Clostridium perfringens toxins in human and animal disease. Future Microbiol. 2014, 9, 361–377. [Google Scholar] [CrossRef]
- Rood, J.I.; Adams, V.; Lacey, J.; Lyras, D.; McClane, B.A.; Melville, S.B.; Moore, R.J.; Popoff, M.R.; Sarker, M.R.; Songer, J.G.; et al. Expansion of the Clostridium perfringens toxin-based typing scheme. Anaerobe 2018, 53, 5–10. [Google Scholar] [CrossRef]
- Mehdizadeh Gohari, I.; Mauricio, A.N.; Li, J.; Shrestha, A.; Uzal, F.; McClane, B.A. Pathogenicity and virulence of Clostridium perfringens. Virulence 2021, 12, 723–753. [Google Scholar] [CrossRef]
- Niilo, L. Clostridium perfringens in animal disease: A review of current knowledge. Can. Vet. J. 1980, 21, 141–148. [Google Scholar]
- Songer, J.G. Clostridial enteric diseases of domestic animals. Clin. Microbiol. Rev. 1996, 9, 216–234. [Google Scholar] [CrossRef]
- Songer, J.G. Clostridia as agents of zoonotic disease. Vet. Microbiol. 2010, 140, 399–404. [Google Scholar] [CrossRef]
- Diab, S.S.; Songer, G.; Uzal, F.A. Clostridium difficile infection in horses: A review. Vet. Microbiol. 2013, 167, 42–49. [Google Scholar] [CrossRef]
- Uzal, F.A.; Navarro, M.A.; Asin, J.; Henderson, E.E. Clostridial diseases of horses: A review. Vaccines 2022, 10, 318. [Google Scholar] [CrossRef]
- Herholz, C.; Miserez, R.; Nicolet, J.; Frey, J.; Popoff, M.; Gibert, M.; Gerber, H.; Straub, R. Prevalence of beta2-toxigenic Clostridium perfringens in horses with intestinal disorders. J. Clin. Microbiol. 1999, 37, 358–361. [Google Scholar] [CrossRef]
- Uzal, F.A.; Songer, J.G. Diagnosis of Clostridium perfringens intestinal infections in sheep and goats. J. Vet. Diagn. Investig. 2008, 20, 253–265. [Google Scholar] [CrossRef]
- Van Immerseel, F.; De Buck, J.; Pasmans, F.; Huyghebaert, G.; Haesebrouck, F.; Ducatelle, R. Clostridium perfringens in poultry: An emerging threat for animal and public health. Avian Pathol. 2004, 33, 537–549. [Google Scholar] [CrossRef]
- Silva, R.O.; Lobato, F.C. Clostridium perfringens: A review of enteric diseases in dogs, cats and wild animals. Anaerobe 2015, 33, 14–17. [Google Scholar] [CrossRef]
- Talukdar, P.K.; Olguin-Araneda, V.; Alnoman, M.; Paredes-Sabja, D.; Sarker, M.R. Updates on the sporulation process in Clostridium species. Res. Microbiol. 2015, 166, 225–235. [Google Scholar] [CrossRef]
- Li, J.; Paredes-Sabja, D.; Sarker, M.R.; McClane, B.A. Clostridium perfringens sporulation and sporulation-associated toxin production. Microbiol. Spectr. 2016, 4. [Google Scholar] [CrossRef]
- Paredes-Sabja, D.; Setlow, P.; Sarker, M.R. Germination of spores of Bacillales and Clostridiales species: Mechanisms and proteins involved. Trends Microbiol. 2011, 19, 85–94. [Google Scholar] [CrossRef]
- Paredes-Sabja, D.; Torres, J.A.; Setlow, P.; Sarker, M.R. Clostridium perfringens spore germination: Characterization of germinants and their receptors. J. Bacteriol. 2008, 190, 1190–1201. [Google Scholar] [CrossRef]
- Paredes-Sabja, D.; Setlow, P.; Sarker, M.R. SleC is essential for cortex peptidoglycan hydrolysis during germination of spores of the pathogenic bacterium Clostridium perfringens. J. Bacteriol. 2009, 191, 2711–2720. [Google Scholar] [CrossRef]
- Paredes-Sabja, D.; Setlow, P.; Sarker, M.R. The protease CspB is essential for initiation of cortex hydrolysis and dipicolinic acid (DPA) release during germination of spores of Clostridium perfringens type A food poisoning isolates. Microbiology 2009, 155, 3464–3472. [Google Scholar] [CrossRef]
- Talukdar, P.K.; Sarker, M.R. The serine proteases CspA and CspC are essential for germination of spores of Clostridium perfringens SM101 through activating SleC and cortex hydrolysis. Food Microbiol. 2020, 86, 103325. [Google Scholar] [CrossRef]
- Setlow, P.; Wang, S.; Li, Y.Q. Germination of spores of the orders Bacillales and Clostridiales. Annu. Rev. Microbiol. 2017, 71, 459–477. [Google Scholar] [CrossRef]
- Udompijitkul, P.; Alnoman, M.; Banawas, S.; Paredes-Sabja, D.; Sarker, M.R. New amino acid germinants for spores of the enterotoxigenic Clostridium perfringens type A isolates. Food Microbiol. 2014, 44, 24–33. [Google Scholar] [CrossRef]
- Paredes-Sabja, D.; Udompijitkul, P.; Sarker, M.R. Inorganic phosphate and sodium ions are cogerminants for spores of Clostridium perfringens type A food poisoning-related isolates. Appl. Environ. Microbiol. 2009, 75, 6299–6305. [Google Scholar] [CrossRef]
- Duncan, C.L.; Strong, D.H. Improved medium for sporulation of Clostridium perfringens. Appl. Microbiol. 1968, 16, 82–89. [Google Scholar] [CrossRef]
- Zhao, Y.; Melville, S.B. Identification and characterization of sporulation-dependent promoters upstream of the enterotoxin gene (cpe) of Clostridium perfringens. J. Bacteriol. 1998, 180, 136–142. [Google Scholar] [CrossRef]
- Collie, R.E.; McClane, B.A. Evidence that the enterotoxin gene can be episomal in Clostridium perfringens isolates associated with non-food-borne human gastrointestinal diseases. J. Clin. Microbiol. 1998, 36, 30–36. [Google Scholar] [CrossRef]
- Waters, M.; Raju, D.; Garmory, H.S.; Popoff, M.R.; Sarker, M.R. Regulated expression of the beta2-toxin gene (cpb2) in Clostridium perfringens type A isolates from horses with gastrointestinal diseases. J. Clin. Microbiol. 2005, 43, 4002–4009. [Google Scholar] [CrossRef]
- Garmory, H.S.; Chanter, N.; French, N.P.; Bueschel, D.; Songer, J.G.; Titball, R.W. Occurrence of Clostridium perfringens beta2-toxin amongst animals, determined using genotyping and subtyping PCR assays. Epidemiol. Infect. 2000, 124, 61–67. [Google Scholar] [CrossRef]
- Waters, M.; Savoie, A.; Garmory, H.S.; Bueschel, D.; Popoff, M.R.; Songer, J.G.; Titball, R.W.; McClane, B.A.; Sarker, M.R. Genotyping and phenotyping of beta2-toxigenic Clostridium perfringens fecal isolates associated with gastrointestinal diseases in piglets. J. Clin. Microbiol. 2003, 41, 3584–3591. [Google Scholar] [CrossRef]
- Bueschel, D.M.; Jost, B.H.; Billington, S.J.; Trinh, H.T.; Songer, J.G. Prevalence of cpb2, encoding beta2 toxin, in Clostridium perfringens field isolates: Correlation of genotype with phenotype. Vet. Microbiol. 2003, 94, 121–129. [Google Scholar] [CrossRef]
- Duncan, C.L.; Strong, D.H.; Sebald, M. Sporulation and enterotoxin production by mutants of Clostridium perfringens. J. Bacteriol. 1972, 110, 378–391. [Google Scholar] [CrossRef]
- Banawas, S.; Paredes-Sabja, D.; Setlow, P.; Sarker, M.R. Characterization of germinants and their receptors for spores of non-food-borne Clostridium perfringens strain F4969. Microbiology 2016, 162, 1972–1983. [Google Scholar] [CrossRef] [PubMed]
- Banawas, S.; Korza, G.; Paredes-Sabja, D.; Li, Y.; Hao, B.; Setlow, P.; Sarker, M.R. Location and stoichiometry of the protease CspB and the cortex-lytic enzyme SleC in Clostridium perfringens spores. Food Microbiol. 2015, 50, 83–87. [Google Scholar] [CrossRef]
- Banawas, S.; Paredes-Sabja, D.; Korza, G.; Li, Y.; Hao, B.; Setlow, P.; Sarker, M.R. The Clostridium perfringens germinant receptor protein GerKC is located in the spore inner membrane and is crucial for spore germination. J. Bacteriol. 2013, 195, 5084–5091. [Google Scholar] [CrossRef]
- Banawas, S.; Sarker, M.R. L-lysine (pH 6.0) induces germination of spores of Clostridium perfringens type F isolates carrying chromosomal or plasmid-borne enterotoxin gene. Microb. Pathog. 2018, 123, 227–232. [Google Scholar] [CrossRef]
- Alnoman, M.; Udompijitkul, P.; Banawas, S.; Sarker, M.R. Bicarbonate and amino acids are co-germinants for spores of Clostridium perfringens type A isolates carrying plasmid-borne enterotoxin gene. Food Microbiol. 2018, 69, 64–71. [Google Scholar] [CrossRef]
- Liggins, M.; Ramírez Ramírez, N.; Abel-Santos, E. Comparison of sporulation and germination conditions for Clostridium perfringens type A and G strains. Front. Microbiol. 2023, 14, 1143399. [Google Scholar] [CrossRef]
- Paidhungat, M.; Setlow, P. Isolation and characterization of mutations in Bacillus subtilis that allow spore germination in the novel germinant D-alanine. J. Bacteriol. 1999, 181, 3341–3350. [Google Scholar] [CrossRef]
- Abee, T.; Groot, M.N.; Tempelaars, M.; Zwietering, M.; Moezelaar, R.; van der Voort, M. Germination and outgrowth of spores of Bacillus cereus group members: Diversity and role of germinant receptors. Food Microbiol. 2011, 28, 199–208. [Google Scholar] [CrossRef] [PubMed]
- Broussolle, V.; Gauillard, F.; Nguyen-The, C.; Carlin, F. Diversity of spore germination in response to inosine and L-alanine and its interaction with NaCl and pH in the Bacillus cereus group. J. Appl. Microbiol. 2008, 105, 1081–1090. [Google Scholar] [CrossRef] [PubMed]
- van der Voort, M.; Garcia, D.; Moezelaar, R.; Abee, T. Germinant receptor diversity and germination responses of four strains of the Bacillus cereus group. Int. J. Food Microbiol. 2010, 139, 108–115. [Google Scholar] [CrossRef] [PubMed]
- Alnoman, M.; Udompijitkul, P.; Paredes-Sabja, D.; Sarker, M.R. The inhibitory effects of sorbate and benzoate against Clostridium perfringens type A isolates. Food Microbiol. 2015, 48, 89–98. [Google Scholar] [CrossRef] [PubMed]
- Ghosh, S.; Scotland, M.; Setlow, P. Levels of germination proteins in dormant and superdormant spores of Bacillus subtilis. J. Bacteriol. 2012, 194, 2221–2227. [Google Scholar] [CrossRef] [PubMed]
Strains | Host/ Origin | Relevant Characteristics 1 | References |
---|---|---|---|
SM101 | Human | Diarrheic FP strain, chromosomal cpe+ | [26] |
F4969 | Human | Diarrheic NFB strain, plasmid cpe+ | [27] |
106902 | Horse | Diarrheic strain, cpb2+, cpe- | [11,28] |
106903 | Horse | Diarrheic strain, cpb2+, cpe- | [11,28] |
JGS1071 | Pig | Diarrheic strain, cpb2+, cpe- | [29,30] |
JGS1807 | Pig | Diarrheic strain, cpb2+, cpe- | [29,30] |
JGS4122 | Poultry | Diarrheic strain, cpb2+, cpe- | [31] |
JGS4125 | Poultry | Diarrheic strain, cpb2+, cpe- | [31] |
Primer Name | Primer Sequence (5’–3’) | Gene |
---|---|---|
CPP1386 | TCTGGGATATGCGCTCTTCT | cspA |
CPP1387 | ATGGTCCTCCTTGCTCCTTT | cspA |
CPP1388 | TAGGGGCGTTGTTAGACCTG | cspB |
CPP1389 | AGAAGAGCGCATATCCCAGA | cspB |
CPP1390 | CTGCAAGAGTGGCAATTCAA | cspC |
CPP1391 | TCCTTTTCCTCTGGTTCAGG | cspC |
CPP1392 | TTCATGACGGGAGACCAAAT | sleC |
CPP1393 | AGTTTCAGGCCACGTTGAAA | sleC |
CPP1394 | GTGGGAGCTGGAATTGCTT | gerKA |
CPP1395 | TCCAAATCGATACTGCACCA | gerKA |
CPP1396 | TCAACCCTAGGTTCTTTGAGG | gerKB |
CPP1397 | TCCATTCTCTACAAAACCACCA | gerKB |
CPP1398 | AGCGGAGGAGCTTTGTTAAA | gerKC |
CPP1399 | GGGTCTTGAGGGTTCATAACTTC | gerKC |
CPP1400 | GCATTAACCATGAGCGAACA | gerAA |
CPP1401 | GCAACATCAGGCCTTTCTGTA | gerAA |
Amino Acids 1 | Decrease in OD600 (% Mean ± SD) 2 | |||||||
---|---|---|---|---|---|---|---|---|
Human Strains | Horse Strains | Pig Strains | Poultry Strains | |||||
SM101 | F4969 | 106902 | 106903 | JGS1071 | JGS1807 | JGS4122 | JGS4125 | |
Nonpolar, aliphatic | ||||||||
Gly | 38 ± 3.2 | 4 ± 0.7 | 5 ± 1.6 | 4 ± 12.3 | 16 ± 8.2 | 3 ± 2.6 | 1 ± 2.5 | 0 ± 6.7 |
Ala | 43 ± 5.0 | 9 ± 0.5 | 12 ± 4.3 | 4 ± 1.9 | 19 ± 10.0 | 7 ± 5.9 | 4 ± 2.4 | 4 ± 7.3 |
Val | 29 ± 2.4 | 7 ± 0.1 | 6 ± 3.1 | 12 ± 5.1 | 14 ± 7.9 | 6 ± 2.4 | 3 ± 4.4 | 7 ± 7.6 |
Leu | 34 ± 5.2 | 4 ± 0.7 | 2 ± 3.5 | 4 ± 0.8 | 8 ± 5.4 | 2 ± 3.9 | −3 ± 7.2 | 5 ± 10.9 |
Met | 26 ± 2.4 | 21 ± 0.9 | 2 ± 6.4 | 3 ± 3.3 | 13 ± 6.6 | 3 ± 3.2 | 3 ± 2.6 | 7 ± 5.3 |
Ile | 26 ± 1.2 | 16 ± 0.4 | 11 ± 12.6 | 14 ± 2.3 | 13 ± 7.4 | 2 ± 5.9 | 5 ± 16.6 | 4 ± 6.5 |
Pro | 6 ± 0.6 | 7 ± 0.6 | 3 ± 7.5 | −3 ± 3.9 | 13 ± 6.7 | 5 ± 1.7 | 1 ± 6.4 | −3 ± 8.9 |
Aromatic | ||||||||
Phe | −3 ± 7.0 | 6 ± 1.5 | −3 ± 5.7 | 3 ± 1.8 | 6 ± 4.6 | −3 ± 5.5 | −2 ± 1.7 | −1 ± 2.0 |
Tyr | 12 ± 6.8 | 5 ± 4.6 | 1 ± 4.5 | 0 ± 2.8 | 11 ± 2.3 | 0 ± 3.2 | −2 ± 3.8 | −4 ± 2.7 |
Trp | −4 ± 3.2 | 7 ± 2.8 | −2 ± 3.5 | −3 ± 6.8 | 8 ± 3.8 | 0 ± 3.7 | −4 ± 6.8 | −4 ± 4.7 |
Polar, uncharged | ||||||||
Ser | 22 ± 8.9 | 13 ± 10.5 | 16 ± 3.9 | 23 ± 3.8 | 12 ± 8.2 | 16 ± 5.3 | −2 ± 15.0 | 4 ± 8.1 |
Thr | 30 ± 0.6 | 16 ± 2.4 | 4 ± 11.3 | 16 ± 7.9 | 19 ± 7.2 | 9 ± 7.1 | −1 ± 5.9 | 4 ± 5.3 |
Asn | 17 ± 6.0 | 9 ± 2.7 | 19 ± 8.6 | 2 ± 8.9 | 21 ± 9.4 | 9 ± 6.8 | −1 ± 5.4 | 6 ± 10.1 |
Gln | 32 ± 1.6 | 29 ± 0.1 | 17 ± 8.5 | −1 ± 2.9 | 19 ± 6.9 | 3 ± 8.7 | −1 ± 5.0 | −5 ± 6.4 |
Positively charged | ||||||||
Arg | 41 ± 2.7 | 1 ± 6.9 | 20 ± 7.5 | −5 ± 1.1 | 21 ± 7.8 | 13 ± 15.2 | −1 ± 4.8 | 2 ± 12.5 |
His | 29 ± 6.8 | 12 ± 2.6 | 5 ± 8.8 | 17 ± 2.6 | 15 ± 4.3 | 7 ± 6.1 | −1 ± 6.7 | 8 ± 7.7 |
Negatively charged | ||||||||
Asp | 35 ± 0.9 | 0 ± 0.6 | 13 ± 9.7 | −4 ± 0.6 | 21 ± 8.0 | 9 ± 14.2 | 1 ± 6.2 | 2 ± 10.7 |
Glu | 31 ± 0.1 | 9 ± 1.5 | 10 ± 7.2 | −4 ± 8.4 | 23 ± 10.5 | 8 ± 20.2 | −6 ± 3.1 | −5 ± 3.9 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Talukdar, P.K.; Alnoman, M.; Sarker, M.R. Identification of Germinants and Expression of Germination Genes in Clostridium perfringens Strains Isolated from Diarrheic Animals. Pathogens 2024, 13, 194. https://doi.org/10.3390/pathogens13030194
Talukdar PK, Alnoman M, Sarker MR. Identification of Germinants and Expression of Germination Genes in Clostridium perfringens Strains Isolated from Diarrheic Animals. Pathogens. 2024; 13(3):194. https://doi.org/10.3390/pathogens13030194
Chicago/Turabian StyleTalukdar, Prabhat K., Maryam Alnoman, and Mahfuzur R. Sarker. 2024. "Identification of Germinants and Expression of Germination Genes in Clostridium perfringens Strains Isolated from Diarrheic Animals" Pathogens 13, no. 3: 194. https://doi.org/10.3390/pathogens13030194
APA StyleTalukdar, P. K., Alnoman, M., & Sarker, M. R. (2024). Identification of Germinants and Expression of Germination Genes in Clostridium perfringens Strains Isolated from Diarrheic Animals. Pathogens, 13(3), 194. https://doi.org/10.3390/pathogens13030194