Simple and Rapid Colorimetric Detection of Canine Parainfluenza Virus 5 (Orthorubulavirus mammalis) Using a Reverse-Transcription Loop-Mediated Isothermal Amplification Assay
Abstract
1. Introduction
2. Materials and Methods
2.1. Samples and Nucleic Acid Extraction
2.2. Construction of an RNA Standard
2.3. Primers for vRT-LAMP Assay
2.4. Optimization of vRT-LAMP Conditions
2.5. Reference cRT-PCR and qRT-PCR Assays
2.6. Specificity and Sensitivity of the vRT-LAMP Assay
2.7. Comparative Evaluation of the vRT-LAMP Assay with Clinical Samples
3. Results
3.1. Optimized Conditions of the vRT-LAMP Assay
3.2. Specificity of the vRT-LAMP Assay
3.3. Sensitivities of the vRT-LAMP, cRT-PCR, and qRT-PCR Assays
3.4. Diagnostic Performance of the vRT-LAMP Assay for Clinical Samples
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Rima, B.; Balkema-Buschmann, A.; Dundon, W.G.; Duprex, P.; Easton, A.; Fouchier, R.; Kurath, G.; Lamb, R.; Lee, B.; Rota, P.; et al. ICTV Virus Taxonomy Profile: Paramyxoviridae. J. Gen. Virol. 2019, 100, 1593–1594. [Google Scholar] [CrossRef]
- Hull, R.N.; Minner, J.R.; Smith, J.W. New viral agents recovered from tissue cultures of monkey kidney cells. I. Origin and properties of cytopathogenic agents S.V.1, S.V.2, S.V.4, S.V.5, S.V.6, S.V.11, S.V.12 and S.V.15. Am. J. Hyg. 1956, 63, 204–215. [Google Scholar] [CrossRef] [PubMed]
- Chatziandreou, N.; Stock, N.; Young, D.; Andrejeva, J.; Hagmaier, K.; McGeoch, D.J.; Randall, R.E. Relationships and host range of human, canine, simian and porcine isolates of simian virus 5 (parainfluenza virus 5). J. Gen. Virol. 2004, 85, 3007–3016. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.M.; Kim, H.R.; Jeon, G.T.; Baek, J.S.; Kwon, O.D.; Park, C.K. Molecular detection of porcine parainfluenza viruses 1 and 5 using a newly developed duplex real-time RT-PCR in South Korea. Animals 2023, 13, 598. [Google Scholar] [CrossRef]
- Oem, J.K.; Kim, S.H.; Kim, Y.H.; Lee, M.H.; Lee, K.K. Molecular characteristics of canine parainfluenza viruses type 5 (CPIV-5) isolated in Korea. Can. J. Vet. Res. 2015, 79, 64–67. [Google Scholar] [PubMed]
- Xie, J.; Tong, P.; Zhang, A.; Zhang, L.; Song, X.; Kuang, L. Identification and characterization of the first equine parainfluenza Virus 5. Virol. Sin. 2020, 35, 245–247. [Google Scholar] [CrossRef]
- Zhai, J.Q.; Zhai, S.L.; Lin, T.; Liu, J.K.; Wang, H.X.; Li, B.; Zhang, H.; Zou, S.Z.; Zhou, X.; Wu, M.F.; et al. First complete genome sequence of parainfluenza virus 5 isolated from lesser panda. Arch. Virol. 2017, 162, 1413–1418. [Google Scholar] [CrossRef]
- Binn, L.N.; Eddy, G.A.; Lazar, E.C.; Helms, J.; Murnane, T. Viruses recovered from laboratory dogs with respiratory disease. Proc. Soc. Exp. Biol. Med. 1967, 126, 140–145. [Google Scholar] [CrossRef]
- Decaro, N.; Mari, V.; Larocca, V.; Losurdo, M.; Lanave, G.; Lucente, M.S.; Corrente, M.; Catella, C.; Bo, S.; Elia, G.; et al. Molecular surveillance of traditional and emerging pathogens associated with canine infectious respiratory disease. Vet. Microbiol. 2016, 192, 21–25. [Google Scholar] [CrossRef]
- Dong, J.; Tsui, W.N.T.; Leng, X.; Fu, J.; Lohman, M.; Anderson, J.; Hamill, V.; Lu, N.; Porter, E.P.; Gray, M.; et al. Development of a three-panel multiplex real-time PCR assay for simultaneous detection of nine canine respiratory pathogens. J. Microbiol. Methods 2022, 199, 106528. [Google Scholar] [CrossRef]
- Hiebl, A.; Auer, A.; Bagrinovschi, G.; Stejskal, M.; Hirt, R.; Rümenapf, H.T.; Tichy, A.; Künzel, F. Detection of selected viral pathogens in dogs with canine infectious respiratory disease in Austria. J. Small Anim. Pract. 2019, 60, 594–600. [Google Scholar] [CrossRef] [PubMed]
- Jeon, G.T.; Kim, H.R.; Shin, Y.K.; Kwon, O.K.; Kang, H.E.; Kwon, O.D.; Park, C.K. An improved duplex real-time quantitative RT-PCR assay with a canine endogenous internal positive control for more sensitive and reliable detection of canine parainfluenza virus 5. Vet. Sci. 2023, 10, 142. [Google Scholar] [CrossRef] [PubMed]
- Davidson, W.R.; Appel, M.J.; Doster, G.L.; Baker, O.E.; Brown, J.F. Diseases and parasites of red foxes, gray foxes, and coyotes from commercial sources selling to fox-chasing enclosures. J. Wildl. Dis. 1992, 28, 581–589. [Google Scholar] [CrossRef] [PubMed]
- Durchfeld, B.; Baumgärtner, W.; Krakowka, S. Intranasal infection of ferrets (Mustela putorius furo) with canine parainfluenza virus. J. Vet. Med. Ser. B 1991, 38, 505–512. [Google Scholar] [CrossRef]
- Ibrahim, Y.M.; Zhang, W.; Weird, G.M.; Zhang, H.; Pan, Y.; Zhang, L.; Xu, Y.; Li, C.; Chen, H.; Wang, Y. Characterization of parainfluenza virus 5 from diarrheic piglet highlights its zoonotic potential. Transbound. Emerg. Dis. 2022, 69, e1510–e1525. [Google Scholar] [CrossRef]
- Charoenkul, K.; Nasamran, C.; Janetanakit, T.; Chaiyawong, S.; Bunpapong, N.; Boonyapisitsopa, S.; Tangwangvivat, R.; Amonsin, A. Molecular detection and whole genome characterization of Canine Parainfluenza type 5 in Thailand. Sci. Rep. 2021, 85, 3007–3016. [Google Scholar] [CrossRef]
- Erles, K.; Dubovi, E.J.; Brooks, H.W.; Brownlie, J. Longitudinal study of viruses associated with canine infectious respiratory disease. J. Clin. Microbiol. 2004, 42, 4524–4529. [Google Scholar] [CrossRef]
- Windsor, R.C.; Johnson, L.R.; Sykes, J.E.; Drazenovich, T.L.; Leutenegger, C.M.; De Cock, H.E. Molecular detection of microbes in nasal tissue of dogs with idiopathic lymphoplasmacytic rhinitis. J. Vet. Intern. Med. 2006, 20, 250–256. [Google Scholar] [CrossRef]
- Notomi, T.; Okayama, H.; Masubuchi, H.; Yonekawa, T.; Watanabe, K.; Amino, N.; Hase, T. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 2000, 28, 63–69. [Google Scholar] [CrossRef]
- Dhama, K.; Karthik, K.; Chakraborty, S.; Tiwari, R.; Kapoor, S.; Kumar, A.; Thomas, P. Loop-mediated isothermal amplification of DNA (LAMP): A new diagnostic tool lights the world of diagnosis of animal and human pathogens: A review. Pak. J. Biol. Sci. 2014, 17, 151–166. [Google Scholar] [CrossRef]
- Mori, Y.; Notomi, T. Loop-mediated isothermal amplification (LAMP): A rapid, accurate, and cost-effective diagnostic method for infectious diseases. J. Infect. Chemother. 2009, 15, 62–69. [Google Scholar] [CrossRef] [PubMed]
- Wong, Y.P.; Othman, S.; Lau, Y.L.; Radu, S.; Chee, H.Y. Loop-mediated isothermal amplification (LAMP): A versatile technique for detection of micro-organisms. J. Appl. Microbiol. 2018, 124, 626–643. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.K.; Kim, H.R.; Kim, D.Y.; Kim, J.M.; Kwon, N.Y.; Park, J.H.; Park, J.Y.; Kim, S.H.; Lee, K.K.; Lee, C.; et al. A simple colorimetric detection of porcine epidemic diarrhea virus by reverse transcription loop-mediated isothermal amplification assay using hydroxynaphthol blue metal indicator. J. Virol. Methods 2021, 298, 114289. [Google Scholar] [CrossRef]
- Kim, D.Y.; Kim, H.R.; Park, J.H.; Kwon, N.Y.; Kim, J.M.; Kim, J.K.; Park, J.H.; Lee, K.K.; Kim, S.H.; Kim, W.I.; et al. Detection of a novel porcine circovirus 4 in Korean pig herds using a loop-mediated isothermal amplification assay. J. Virol. Methods 2022, 299, 114350. [Google Scholar] [CrossRef] [PubMed]
- Park, J.H.; Kim, H.R.; Chae, H.K.; Park, J.; Jeon, B.Y.; Lyoo, Y.S.; Park, C.K. Simple and rapid colorimetric detection of African swine fever virus by loop-mediated isothermal amplification assay using a hydroxynaphthol blue metal indicator. Korean J. Vet. Serv. 2022, 45, 9–30. [Google Scholar] [CrossRef]
- Cho, H.S.; Park, N.Y. Detection of canine distemper virus in blood samples by reverse transcription loop-mediated isothermal amplification. J. Vet. Med. B Infect. Dis. Vet. Public Health 2005, 52, 410–413. [Google Scholar] [CrossRef] [PubMed]
- Cho, H.S.; Kang, J.I.; Park, N.Y. Detection of canine parvovirus in fecal samples using loop-mediated isothermal amplification. J. Vet. Diagn. Investig. 2006, 18, 81–84. [Google Scholar] [CrossRef]
- Adaszek, L.; Jankowska, M.; Kalinowski, M.; Banach, T.; Wułupek, D.; Winiarczyk, S. The loop-mediated isothermal amplification assay for rapid diagnosis of Babesia canis infections in dogs. Pol. J. Vet. Sci. 2013, 16, 131–133. [Google Scholar] [CrossRef] [PubMed]
- Chua, A.P.B.; Galay, R.L.; Tanaka, T.; Yamazaki, W. Development of a loop-mediated isothermal amplification (LAMP) assay targeting the citrate synthase gene for detection of Ehrlichia canis canis in dogs. Vet. Sci. 2020, 7, 156. [Google Scholar] [CrossRef]
- Singh, M.D.; Singh, H.; Singh, N.K.; Singh, N.K.; Kashyap, N.; Sood, N.K.; Rath, S.S. Development of loop-mediated isothermal amplification (LAMP) assay for detection of Hepatozoon canis infection in dogs. Ticks Tick-Borne Dis. 2019, 10, 371–376. [Google Scholar] [CrossRef]
- Rima, B.K.; Gatherer, D.; Young, D.F.; Norsted, H.; Randall, R.E.; Davison, A.J. Stability of the parainfluenza virus 5 genome revealed by deep sequencing of strains isolated from different hosts and following passage in cell culture. J. Virol. 2014, 88, 3826–3836. [Google Scholar] [CrossRef] [PubMed]
- Goto, M.; Honda, E.; Ogura, A.; Nomoto, A.; Hanaki, K. Colorimetric detection of loop-mediated isothermal amplification reaction by using hydroxy naphthol blue. Biotechniques 2009, 46, 167–172. [Google Scholar] [CrossRef]
- Kwiecien, R.; Kopp-Schneider, A.; Blettner, M. Concordance analysis: Part 16 of a series on evaluation of scientific publications. Dtsch. Ärztebl. Int. 2011, 108, 515–521. [Google Scholar] [CrossRef]
- Land, K.J.; Boeras, D.I.; Chen, X.S.; Ramsay, A.R.; Peeling, R.W. REASSURED diagnostics to inform disease control strategies, strengthen health systems and improve patient outcomes. Nat. Microbiol. 2019, 4, 46–54. [Google Scholar] [CrossRef]
- Nagamine, K.; Hase, T.; Notomi, T. Accelerated reaction by loop-mediated isothermal amplification using loop primers. Mol. Cell. Probes 2002, 16, 223–229. [Google Scholar] [CrossRef] [PubMed]
- Higashimoto, Y.; Ihira, M.; Kawamura, Y.; Inaba, M.; Shirato, K.; Suzuki, T.; Hasegawa, H.; Kageyama, T.; Doi, Y.; Hata, T.; et al. Dry loop-mediated isothermal amplification assay for detection of SARS-CoV-2 from clinical specimens. Fujita Med. J. 2023, 9, 84–89. [Google Scholar] [CrossRef]
- Howson, E.L.A.; Armson, B.; Madi, M.; Kasanga, C.J.; Kandusi, S.; Sallu, R.; Chepkwony, E.; Siddle, A.; Martin, P.; Wood, J.; et al. Evaluation of Two Lyophilized Molecular Assays to Rapidly Detect Foot-and-Mouth Disease Virus Directly from Clinical Samples in Field Settings. Transbound. Emerg. Dis. 2017, 64, 861–871. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Sharma, S.; Bhardwaj, N.; Pande, V.; Savargaonkar, D.; Anvikar, A.R. Advanced Lyophilised Loop Mediated Isothermal Amplification (L-LAMP) based point of care technique for the detection of dengue virus. J. Virol. Methods 2021, 293, 114168. [Google Scholar] [CrossRef]
- Song, X.; Coulter, F.J.; Yang, M.; Smith, J.L.; Tafesse, F.G.; Messer, W.B.; Reif, J.H. A lyophilized colorimetric RT-LAMP test kit for rapid, low-cost, at-home molecular testing of SARS-CoV-2 and other pathogens. Sci. Rep. 2022, 12, 7043. [Google Scholar] [CrossRef]
- Francois, P.; Tangomo, M.; Hibbs, J.; Bonetti, E.J.; Boehme, C.C.; Notomi, T.; Perkins, M.D.; Schrenzel, J. Robustness of a loop-mediated isothermal amplification reaction for diagnostic applications. FEMS Immunol. Med. Microbiol. 2011, 62, 41–48. [Google Scholar] [CrossRef]
- Kaneko, H.; Kawana, T.; Fukushima, E.; Suzutani, T. Tolerance of loop-mediated isothermal amplification to a culture medium and biological substances. J. Biochem. Biophys. Methods 2007, 70, 499–501. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Zhang, C.; Zhao, M.; Liu, K.; Li, H.; Li, N.; Gao, L.; Yang, X.; Ma, T.; Zhu, J.; et al. A direct isothermal amplification system adapted for rapid SNP genotyping of multifarious sample types. Biosens. Bioelectron. 2018, 115, 70–76. [Google Scholar] [CrossRef] [PubMed]
- Nie, K.; Qi, S.X.; Zhang, Y.; Luo, L.; Xie, Y.; Yang, M.J.; Zhang, Y.; Li, J.; Shen, H.; Li, Q.; et al. Evaluation of a direct reverse transcription loop-mediated isothermal amplification method without RNA extraction for the detection of human enterovirus 71 subgenotype C4 in nasopharyngeal swab specimens. PLoS ONE 2012, 7, e52486. [Google Scholar] [CrossRef] [PubMed]
- Wei, S.; Kohl, E.; Djandji, A.; Morgan, S.; Whittier, S.; Mansukhani, M.; Hod, E.; D’Alton, M.; Suh, Y.; Williams, Z. Direct diagnostic testing of SARS-CoV-2 without the need for prior RNA extraction. Sci. Rep. 2021, 11, 2402. [Google Scholar] [CrossRef] [PubMed]





| Primer Name | Sequence (5′–3′) a | Length (bp) | Genome Position b |
|---|---|---|---|
| CPIV5N-F3 | AGATCAGAGTGAGGAAGGTAC | 21 | 119–219 |
| CPIV5N-B3 | GGTCAGCTAATTTGACATGATTG | 23 | 400–422 |
| CPIV5N-LF | AGAGGTTAGTATAAATACCCTGATT | 25 | 247–271 |
| CPIV5N–LB | CAAGGGATTCYCATCGCTTTG | 21 | 336–356 |
| CPIV5N–FIP (F1c + F2) | CCGRGATCTTAGCTCTGGGTTAT + ATCCCACCTACAACACTAAAACC | 46 | 273–295 + 221–243 |
| CPIV5N–BIP (B1c + B2) | GCCTACGGATTGTTCTCAGTAATGG + GGCTGATGGTAGYGAAAACATTG | 48 | 309−333 + 369−391 |
| Method | New vRT-LAMP | Positive Rate | Overall Agreement a | |||
|---|---|---|---|---|---|---|
| Positive | Negative | Total | ||||
| cRT-PCR [11] | Positive | 12 | 0 | 12 | 4.49% | 99.3% |
| Negative | 2 | 253 | 255 | |||
| Total | 14 | 253 | 267 | |||
| Positive rate | 5.24% | |||||
| qRT-PCR [10] | Positive | 14 | 0 | 14 | 5.24% | 100% |
| Negative | 0 | 253 | 253 | |||
| Total | 14 | 253 | 267 | |||
| Positive rate | 5.24% | |||||
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kim, J.-M.; Kim, H.-R.; Baek, J.-S.; Kwon, O.-K.; Kang, H.-E.; Shin, Y.-K.; Park, C.-K. Simple and Rapid Colorimetric Detection of Canine Parainfluenza Virus 5 (Orthorubulavirus mammalis) Using a Reverse-Transcription Loop-Mediated Isothermal Amplification Assay. Pathogens 2023, 12, 921. https://doi.org/10.3390/pathogens12070921
Kim J-M, Kim H-R, Baek J-S, Kwon O-K, Kang H-E, Shin Y-K, Park C-K. Simple and Rapid Colorimetric Detection of Canine Parainfluenza Virus 5 (Orthorubulavirus mammalis) Using a Reverse-Transcription Loop-Mediated Isothermal Amplification Assay. Pathogens. 2023; 12(7):921. https://doi.org/10.3390/pathogens12070921
Chicago/Turabian StyleKim, Jong-Min, Hye-Ryung Kim, Ji-Su Baek, Oh-Kyu Kwon, Hae-Eun Kang, Yeun-Kyung Shin, and Choi-Kyu Park. 2023. "Simple and Rapid Colorimetric Detection of Canine Parainfluenza Virus 5 (Orthorubulavirus mammalis) Using a Reverse-Transcription Loop-Mediated Isothermal Amplification Assay" Pathogens 12, no. 7: 921. https://doi.org/10.3390/pathogens12070921
APA StyleKim, J.-M., Kim, H.-R., Baek, J.-S., Kwon, O.-K., Kang, H.-E., Shin, Y.-K., & Park, C.-K. (2023). Simple and Rapid Colorimetric Detection of Canine Parainfluenza Virus 5 (Orthorubulavirus mammalis) Using a Reverse-Transcription Loop-Mediated Isothermal Amplification Assay. Pathogens, 12(7), 921. https://doi.org/10.3390/pathogens12070921

