Interactions of Mycoplasma hyopneumoniae and/or Mycoplasma hyorhinis with Streptococcus suis Serotype 2 Using In Vitro Co-Infection Models with Swine Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. Bacterial Strains and Growth Conditions
Strains | Characteristics | References |
---|---|---|
S. suis serotype 2 P1/7 ∆cps2F | Virulent serotype 2 strain isolated from a case of pig meningitis in the United Kingdom Non-encapsulated isogenic mutant derived from P1/7; in-frame deletion of cps2F gene | [22,23] |
Mycoplasma M. hyopneumoniae 682 M. hyorhinis 380 | Strains isolated in 2016 from the same herd showing respiratory disorders | [18] |
2.2. Source of Primary Cells
2.3. Cell Culture: Newborn Pig Tracheal Cell Line (NPTr), Primary Pulmonary Alveolar Macrophages (PAMs) and Bone-Marrow-Derived Porcine Dendritic Cells (BM-DCs)
2.4. Pre-Infection and Stimulation of NPTr Cells, PAMs and BM-DCs with M. hyopneumoniae and/or M. hyorhinis
2.5. Adhesion to and Invasion of NPTr by S. suis
2.6. Phagocytosis and Intracellular Survival Assay of S. suis by PAMs and BM-DCs
2.7. Cytotoxicity Assay
2.8. Induction of Pro-Inflammatory Cytokines
2.9. Statistical Analysis
3. Results
3.1. Pre-Infection of NPTr Epithelial Cells with M. hyopneumoniae and/or M. hyorhinis Does Not Promote Adhesion and Invasion of S. suis
3.2. Pre-Infection of PAMs and BM-DCs with M. hyopneumoniae and/or M. hyorhinis Does Not Affect Phagocytosis of S. suis
3.3. Pre-Infection of PAMs and BM-DCs with M. hyopneumoniae and/or M. hyorhinis Does Not Affect the Intracellular Survival Rate of S. suis
3.4. Pre-Infection of NPTr, PAMs and BM-DCs with M. hyopneumoniae and/or M. hyorhinis Significantly Increases Cytotoxicity
3.5. Pre-Infection with Mycoplasmas Followed by S. suis Infection of NPTr, PAMs and BM-DCs Differently Modulates the Relative mRNA Expression of Pro-Inflammatory Cytokines
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Gottschalk, M.; Segura, M. Streptococcocis. In Diseases of Swine, 11th ed.; Zimmerman, J.J., Karriker, L.A., Ramirez, A., Schwartz, K.J., Stevenson, G.W., Zhang, J., Eds.; Wiley-Blackwell: Hoboken, NJ, USA, 2019; pp. 934–950. [Google Scholar]
- Segura, M. Streptococcus suis Research: Progress and Challenges. Pathogens 2020, 9, 707. [Google Scholar] [CrossRef]
- Gottschalk, M.; Xu, J.; Calzas, C.; Segura, M. Streptococcus suis: A new emerging or an old neglected zoonotic pathogen? Future Microbiol. 2010, 5, 371–391. [Google Scholar] [CrossRef] [PubMed]
- Segura, M.; Fittipaldi, N.; Calzas, C.; Gottschalk, M. Critical Streptococcus suis Virulence Factors: Are They All Really Critical? Trends Microbiol. 2017, 25, 585–599. [Google Scholar] [CrossRef] [PubMed]
- Obradovic, M.R.; Segura, M.; Segales, J.; Gottschalk, M. Review of the speculative role of co-infections in Streptococcus suis-associated diseases in pigs. Vet. Res. 2021, 52, 49. [Google Scholar] [CrossRef] [PubMed]
- Meng, F.; Tong, J.; Votsch, D.; Peng, J.Y.; Cai, X.; Willenborg, M.; Herrler, G.; Wu, N.H.; Valentin-Weigand, P. Viral Coinfection Replaces Effects of Suilysin on Streptococcus suis Adherence to and Invasion of Respiratory Epithelial Cells Grown under Air-Liquid Interface Conditions. Infect. Immun. 2019, 87, e00350-19. [Google Scholar] [CrossRef] [Green Version]
- Saade, G.; Deblanc, C.; Bougon, J.; Marois-Crehan, C.; Fablet, C.; Auray, G.; Belloc, C.; Leblanc-Maridor, M.; Gagnon, C.A.; Zhu, J.; et al. Coinfections and their molecular consequences in the porcine respiratory tract. Vet. Res. 2020, 51, 80. [Google Scholar] [CrossRef]
- Maes, D.; Sibila, M.; Kuhnert, P.; Segales, J.; Haesebrouck, F.; Pieters, M. Update on Mycoplasma hyopneumoniae infections in pigs: Knowledge gaps for improved disease control. Transbound. Emerg. Dis. 2018, 65 (Suppl. S1), 110–124. [Google Scholar] [CrossRef] [Green Version]
- Sibila, M.; Pieters, M.; Molitor, T.; Maes, D.; Haesebrouck, F.; Segales, J. Current perspectives on the diagnosis and epidemiology of Mycoplasma hyopneumoniae infection. Vet. J. 2009, 181, 221–231. [Google Scholar] [CrossRef]
- Wallgren, P.; Norregard, E.; Molander, B.; Persson, M.; Ehlorsson, C.J. Serological patterns of Actinobacillus pleuropneumoniae, Mycoplasma hyopneumoniae, Pasteurella multocida and Streptococcus suis in pig herds affected by pleuritis. Acta Vet. Scand. 2016, 58, 71. [Google Scholar] [CrossRef] [Green Version]
- Kobisch, M.; Friis, N.F. Swine mycoplasmoses. Rev. Sci. Tech. 1996, 15, 1569–1605. [Google Scholar] [CrossRef]
- Pieters, M.; Maes, D. Mycoplasmosis. In Diseases of Swine, 11th ed.; Zimmerman, J.J., Karriker, L.A., Ramirez, A., Schwartz, K.J., Stevenson, G.W., Zhang, J., Eds.; Wiley-Blackwell: Hoboken, NJ, USA, 2019; pp. 863–883. [Google Scholar]
- Fourour, S.; Tocqueville, V.; Paboeuf, F.; Lediguerher, G.; Morin, N.; Kempf, I.; Marois-Crehan, C. Pathogenicity study of Mycoplasma hyorhinis and M. flocculare in specific-pathogen-free pigs pre-infected with M. hyopneumoniae. Vet. Microbiol. 2019, 232, 50–57. [Google Scholar] [CrossRef]
- Buttenschon, J.; Friis, N.F.; Aalbaek, B.; Jensen, T.K.; Iburg, T.; Mousing, J. Microbiology and pathology of fibrinous pericarditis in Danish slaughter pigs. Zentralbl. Veterinarmed. A 1997, 44, 271–280. [Google Scholar] [CrossRef]
- Nathues, H.; Kubiak, R.; Tegeler, R.; Beilage, E.G. Occurrence of Mycoplasma hyopneumoniae infections in suckling and nursery pigs in a region of high pig density. Vet. Rec. 2010, 166, 194–198. [Google Scholar] [CrossRef] [PubMed]
- Kang, I.; Kim, D.; Han, K.; Seo, H.W.; Oh, Y.; Park, C.; Lee, J.; Gottschalk, M.; Chae, C. Optimized protocol for multiplex nested polymerase chain reaction to detect and differentiate Haemophilus parasuis, Streptococcus suis, and Mycoplasma hyorhinis in formalin-fixed, paraffin-embedded tissues from pigs with polyserositis. Can. J. Vet. Res. 2012, 76, 195–200. [Google Scholar] [PubMed]
- Auray, G.; Lachance, C.; Wang, Y.; Gagnon, C.A.; Segura, M.; Gottschalk, M. Transcriptional Analysis of PRRSV-Infected Porcine Dendritic Cell Response to Streptococcus suis Infection Reveals Up-Regulation of Inflammatory-Related Genes Expression. PLoS ONE 2016, 11, e0156019. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fourour, S.; Marois-Crehan, C.; Martelet, L.; Fablet, C.; Kempf, I.; Gottschalk, M.; Segura, M. Intra-Species and Inter-Species Differences in Cytokine Production by Porcine Antigen-Presenting Cells Stimulated by Mycoplasma hyopneumoniae, M. hyorhinis, and M. flocculare. Pathogens 2019, 8, 34. [Google Scholar] [CrossRef] [Green Version]
- Friis, N.F. Some recommendations concerning primary isolation of Mycoplasma suipneumoniae and Mycoplasma flocculare a survey. Nord. Vet. Med. 1975, 27, 337–339. [Google Scholar]
- Fourour, S.; Fablet, C.; Tocqueville, V.; Dorenlor, V.; Eono, F.; Eveno, E.; Kempf, I.; Marois-Crehan, C. A new multiplex real-time TaqMan((R)) PCR for quantification of Mycoplasma hyopneumoniae, M. hyorhinis and M. flocculare: Exploratory epidemiological investigations to research mycoplasmal association in enzootic pneumonia-like lesions in slaughtered pigs. J. Appl. Microbiol. 2018, 125, 345–355. [Google Scholar] [CrossRef]
- Kellog, D.E.; Kwok, S. Detection of human immunodeficiency virus. In PCR Protocols: A Guide to Methods and Applications; Innis, M.A., Gelfand, D.H., White, T.J., Sninsky, J.J., Eds.; Academic Press: San Diego, CA, USA, 1990; pp. 339–343. [Google Scholar]
- Slater, J.D.; Allen, A.G.; May, J.P.; Bolitho, S.; Lindsay, H.; Maskell, D.J. Mutagenesis of Streptococcus equi and Streptococcus suis by transposon Tn917. Vet. Microbiol. 2003, 93, 197–206. [Google Scholar] [CrossRef] [PubMed]
- Lecours, M.P.; Gottschalk, M.; Houde, M.; Lemire, P.; Fittipaldi, N.; Segura, M. Critical role for Streptococcus suis cell wall modifications and suilysin in resistance to complement-dependent killing by dendritic cells. J. Infect. Dis. 2011, 204, 919–929. [Google Scholar] [CrossRef] [Green Version]
- Mathieu-Denoncourt, A.; Letendre, C.; Auger, J.P.; Segura, M.; Aragon, V.; Lacouture, S.; Gottschalk, M. Limited interactions between Streptococcus suis and Haemophilus parasuis in in vitro Co-Infection Studies. Pathogens 2018, 7, 7. [Google Scholar] [CrossRef] [Green Version]
- Wang, Y.; Gagnon, C.A.; Savard, C.; Music, N.; Srednik, M.; Segura, M.; Lachance, C.; Bellehumeur, C.; Gottschalk, M. Capsular sialic acid of Streptococcus suis serotype 2 binds to swine influenza virus and enhances bacterial interactions with virus-infected tracheal epithelial cells. Infect. Immun. 2013, 81, 4498–4508. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dang, Y.; Lachance, C.; Wang, Y.; Gagnon, C.A.; Savard, C.; Segura, M.; Grenier, D.; Gottschalk, M. Transcriptional approach to study porcine tracheal epithelial cells individually or dually infected with swine influenza virus and Streptococcus suis. BMC Vet. Res. 2014, 10, 86. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Martelet, L.; Lacouture, S.; Goyette-Desjardins, G.; Beauchamp, G.; Surprenant, C.; Gottschalk, M.; Segura, M. Porcine dendritic cells as an in vitro model to assess the immunological behaviour of Streptococcus suis Subunit vaccine formulations and the polarizing effect of adjuvants. Pathogens 2017, 6, 13. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lecours, M.P.; Segura, M.; Lachance, C.; Mussa, T.; Surprenant, C.; Montoya, M.; Gottschalk, M. Characterization of porcine dendritic cell response to Streptococcus suis. Vet. Res. 2011, 42, 72. [Google Scholar] [CrossRef] [Green Version]
- Corsaut, L.; Misener, M.; Canning, P.; Beauchamp, G.; Gottschalk, M.; Segura, M. Field Study on the immunological response and protective effect of a licensed autogenous vaccine to control Streptococcus suis infections in post-weaned piglets. Vaccines 2020, 8, 384. [Google Scholar] [CrossRef]
- Liu, W.; Zhou, D.; Yuan, F.; Liu, Z.; Duan, Z.; Yang, K.; Guo, R.; Li, M.; Li, S.; Fang, L.; et al. Surface proteins mhp390 (P68) contributes to cilium adherence and mediates inflammation and apoptosis in Mycoplasma hyopneumoniae. Microb. Pathog. 2019, 126, 92–100. [Google Scholar] [CrossRef]
- Xiong, Q.; Zhang, B.; Wang, J.; Ni, B.; Ji, Y.; Wei, Y.; Xiao, S.; Feng, Z.; Liu, M.; Shao, G. Characterization of the role in adherence of Mycoplasma hyorhinis variable lipoproteins containing different repeat unit copy numbers. Vet. Microbiol. 2016, 197, 39–46. [Google Scholar] [CrossRef]
- Auger, J.P.; Payen, S.; Roy, D.; Dumesnil, A.; Segura, M.; Gottschalk, M. Interactions of Streptococcus suis serotype 9 with host cells and role of the capsular polysaccharide: Comparison with serotypes 2 and 14. PLoS ONE 2019, 14, e0223864. [Google Scholar] [CrossRef] [Green Version]
- Shapouri-Moghaddam, A.; Mohammadian, S.; Vazini, H.; Taghadosi, M.; Esmaeili, S.A.; Mardani, F.; Seifi, B.; Mohammadi, A.; Afshari, J.T.; Sahebkar, A. Macrophage plasticity, polarization, and function in health and disease. J. Cell Physiol. 2018, 233, 6425–6440. [Google Scholar] [CrossRef]
- Savina, A.; Amigorena, S. Phagocytosis and antigen presentation in dendritic cells. Immunol. Rev. 2007, 219, 143–156. [Google Scholar] [CrossRef] [PubMed]
- Chabot-Roy, G.; Willson, P.; Segura, M.; Lacouture, S.; Gottschalk, M. Phagocytosis and killing of Streptococcus suis by porcine neutrophils. Microb. Pathog. 2006, 41, 21–32. [Google Scholar] [CrossRef]
- Auger, J.P.; Boa, A.C.; Segura, M.; Gottschalk, M. Antigen I/II Participates in the Interactions of Streptococcus suis Serotype 9 With Phagocytes and the Development of Systemic Disease. Front. Cell. Infect. Microbiol. 2019, 9, 124. [Google Scholar] [CrossRef] [PubMed]
- Segura, M.A.; Cleroux, P.; Gottschalk, M. Streptococcus suis and group B Streptococcus differ in their interactions with murine macrophages. FEMS Immunol. Med. Microbiol. 1998, 21, 189–195. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- DeBey, M.C.; Ross, R.F. Ciliostasis and loss of cilia induced by Mycoplasma hyopneumoniae in porcine tracheal organ cultures. Infect. Immun. 1994, 62, 5312–5318. [Google Scholar] [CrossRef] [Green Version]
- Thacker, E.L. Immunology of the porcine respiratory disease complex. Vet. Clin. N. Am. Food Anim. Pract. 2001, 17, 551–565. [Google Scholar] [CrossRef]
- Fittipaldi, N.; Segura, M.; Grenier, D.; Gottschalk, M. Virulence factors involved in the pathogenesis of the infection caused by the swine pathogen and zoonotic agent Streptococcus suis. Future Microbiol. 2012, 7, 259–279. [Google Scholar] [CrossRef]
- Hsu, T.; Minion, F.C. Identification of the cilium binding epitope of the Mycoplasma hyopneumoniae P97 adhesin. Infect. Immun. 1998, 66, 4762–4766. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Leal Zimmer, F.M.A.; Paes, J.A.; Zaha, A.; Ferreira, H.B. Pathogenicity & virulence of Mycoplasma hyopneumoniae. Virulence 2020, 11, 1600–1622. [Google Scholar] [PubMed]
- Pan, Q.; Xu, Q.; Liu, T.; Zhang, Y.; Xin, J. Mycoplasma hyopneumoniae membrane protein Mhp271 interacts with host UPR protein GRP78 to facilitate infection. Mol. Microbiol. 2022, 118, 208–222. [Google Scholar] [CrossRef]
- Park, C.; Jeong, J.; Kang, I.; Choi, K.; Park, S.J.; Chae, C. Increased fucosyl glycoconjugate by Mycoplasma hyopneumoniae enhances adherences of Pasteurella multocida type A in the ciliated epithelial cells of the respiratory tract. BMC Vet. Res. 2016, 12, 25. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ackermann, M.R.; Debey, M.C.; Debey, B.M. Bronchiolar metaplasia and Ulex europaeus agglutinin I (UEA-I) affinity in Mycoplasma hyopneumoniae-infected lungs of six pigs. Vet. Pathol. 1991, 28, 533–535. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, J.; Li, Y.; Pan, L.; Li, J.; Yu, Y.; Liu, B.; Zubair, M.; Wei, Y.; Pillay, B.; Olaniran, A.O.; et al. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) moonlights as an adhesin in Mycoplasma hyorhinis adhesion to epithelial cells as well as a plasminogen receptor mediating extracellular matrix degradation. Vet. Res. 2021, 52, 80. [Google Scholar] [CrossRef]
- Beier, L.S.; Siqueira, F.M.; Schrank, I.S. Evaluation of growth and gene expression of Mycoplasma hyopneumoniae and Mycoplasma hyorhinis in defined medium. Mol. Biol. Rep. 2018, 45, 2469–2479. [Google Scholar] [CrossRef]
- Viana, F.; O’Kane, C.M.; Schroeder, G.N. Precision-cut lung slices: A powerful ex vivo model to investigate respiratory infectious diseases. Mol. Microbiol. 2022, 117, 578–588. [Google Scholar] [CrossRef]
- Haas, B.; Grenier, D. Understanding the virulence of Streptococcus suis: A veterinary, medical, and economic challenge. Med. Mal. Infect. 2018, 48, 159–166. [Google Scholar] [CrossRef]
- Varol, C.; Mildner, A.; Jung, S. Macrophages: Development and tissue specialization. Annu. Rev. Immunol. 2015, 33, 643–675. [Google Scholar] [CrossRef]
- Bieber, K.; Autenrieth, S.E. Dendritic cell development in infection. Mol. Immunol. 2020, 121, 111–117. [Google Scholar] [CrossRef]
- Houde, M.; Gottschalk, M.; Gagnon, F.; Van Calsteren, M.R.; Segura, M. Streptococcus suis capsular polysaccharide inhibits phagocytosis through destabilization of lipid microdomains and prevents lactosylceramide-dependent recognition. Infect. Immun. 2012, 80, 506–517. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Charland, N.; Kobisch, M.; Martineau-Doize, B.; Jacques, M.; Gottschalk, M. Role of capsular sialic acid in virulence and resistance to phagocytosis of Streptococcus suis capsular type 2. FEMS Immunol. Med. Microbiol. 1996, 14, 195–203. [Google Scholar] [CrossRef]
- Li, J.; Wang, J.; Liu, Y.; Yang, J.; Guo, L.; Ren, S.; Chen, Z.; Liu, Z.; Zhang, Y.; Qiu, W.; et al. Porcine reproductive and respiratory syndrome virus NADC30-like strain accelerates Streptococcus suis serotype 2 infection in vivo and in vitro. Transbound Emerg. Dis. 2019, 66, 729–742. [Google Scholar] [CrossRef]
- Deeney, A.S.; Maglennon, G.A.; Chapat, L.; Crussard, S.; Jolivet, E.; Rycroft, A.N. Mycoplasma hyopneumoniae evades phagocytic uptake by porcine alveolar macrophages in vitro. Vet. Res. 2019, 50, 51. [Google Scholar] [CrossRef] [Green Version]
- Caruso, J.P.; Ross, R.F. Effects of Mycoplasma hyopneumoniae and Actinobacillus (Haemophilus) pleuropneumoniae infections on alveolar macrophage functions in swine. Am. J. Vet. Res. 1990, 51, 227–231. [Google Scholar] [PubMed]
- Bin, L.; Luping, D.; Bing, S.; Zhengyu, Y.; Maojun, L.; Zhixin, F.; Yanna, W.; Haiyan, W.; Guoqing, S.; Kongwang, H. Transcription analysis of the porcine alveolar macrophage response to Mycoplasma hyopneumoniae. PLoS ONE 2014, 9, e101968. [Google Scholar] [CrossRef] [PubMed]
- Bercier, P.; Gottschalk, M.; Grenier, D. Streptococcus suis suilysin compromises the function of a porcine tracheal epithelial barrier model. Microb. Pathog. 2020, 139, 103913. [Google Scholar] [CrossRef] [PubMed]
- Lun, S.; Perez-Casal, J.; Connor, W.; Willson, P.J. Role of suilysin in pathogenesis of Streptococcus suis capsular serotype 2. Microb. Pathog. 2003, 34, 27–37. [Google Scholar] [CrossRef] [PubMed]
- Tenenbaum, T.; Asmat, T.M.; Seitz, M.; Schroten, H.; Schwerk, C. Biological activities of suilysin: Role in Streptococcus suis pathogenesis. Future Microbiol. 2016, 11, 941–954. [Google Scholar] [CrossRef]
- Votsch, D.; Willenborg, M.; Baumgartner, W.; Rohde, M.; Valentin-Weigand, P. Bordetella bronchiseptica promotes adherence, colonization, and cytotoxicity of Streptococcus suis in a porcine precision-cut lung slice model. Virulence 2021, 12, 84–95. [Google Scholar] [CrossRef]
- Meng, F.; Wu, N.H.; Nerlich, A.; Herrler, G.; Valentin-Weigand, P.; Seitz, M. Dynamic Virus-Bacterium Interactions in a Porcine Precision-Cut Lung Slice Coinfection Model: Swine Influenza Virus Paves the Way for Streptococcus suis Infection in a Two-Step Process. Infect. Immun. 2015, 83, 2806–2815. [Google Scholar] [CrossRef] [Green Version]
- Bai, F.; Ni, B.; Liu, M.; Feng, Z.; Xiong, Q.; Xiao, S.; Shao, G. Mycoplasma hyopneumoniae-derived lipid-associated membrane proteins induce apoptosis in porcine alveolar macrophage via increasing nitric oxide production, oxidative stress, and caspase-3 activation. Vet. Immunol. Immunopathol. 2013, 155, 155–161. [Google Scholar] [CrossRef]
- Ni, B.; Bai, F.F.; Wei, Y.; Liu, M.J.; Feng, Z.X.; Xiong, Q.Y.; Hua, L.Z.; Shao, G.Q. Apoptosis induced by lipid-associated membrane proteins from Mycoplasma hyopneumoniae in a porcine lung epithelial cell line with the involvement of caspase 3 and the MAPK pathway. Genet. Mol. Res. 2015, 14, 11429–11443. [Google Scholar] [CrossRef] [PubMed]
- Browning, G.F.; Marenda, M.S.; Noormohammadi, A.H.; Markham, P.F. The central role of lipoproteins in the pathogenesis of mycoplasmoses. Vet. Microbiol. 2011, 153, 44–50. [Google Scholar] [CrossRef] [PubMed]
- Kostyal, D.A.; Butler, G.H.; Beezhold, D.H. Mycoplasma hyorhinis molecules that induce tumor necrosis factor alpha secretion by human monocytes. Infect. Immun. 1995, 63, 3858–3863. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kornspan, J.D.; Tsur, M.; Tarshis, M.; Rottem, S.; Brenner, T. Mycoplasma hyorhinis induces proinflammatory responses in mice lymphocytes. J. Basic. Microbiol. 2015, 55, 679–684. [Google Scholar] [CrossRef] [PubMed]
- Thanawongnuwech, R.; Thacker, B.; Halbur, P.; Thacker, E.L. Increased production of proinflammatory cytokines following infection with porcine reproductive and respiratory syndrome virus and Mycoplasma hyopneumoniae. Clin. Diagn. Lab. Immunol. 2004, 11, 901–908. [Google Scholar]
Gene Name | Forward 5′-3′ | Reverse 5′-3′ | Probes 5′-3′ |
---|---|---|---|
p102 (M. hyopneumoniae) p37 (M. hyorhinis) | TAAGGGTCAAAGTCAAAGTC TTCTATTTTCATCTATATTTTCGC | AAATTAAAAGCTGTTCAAATGC TCATTGACCTTGACTAACTG | CY5 *-AACCAGTTTCCACTTCATCGCC-BHQ2 § TXR †-CATCCTCTTGCTTGACTACTCCTG-BHQ2 § |
Gene Name | Forward 5′-3′ | Reverse 5′-3′ |
---|---|---|
β2M PPiA IL-6 CXCL8 | CGTGGCCTTGGTCCTGCTCG TGCAGACAAAGTTCCAAAGACAG ACTCCCTCTCCACAAGCGCCTT TGTGAGGCTGCAGTTCTGGCAAG | TCCGTTTTCCGCTGGGTGGC GCCACCAGTGCCATTATGG TGGCATCTTCTTCCAGGCGTCCC GGGTGGAAAGGTGTGGAATGCGT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pageaut, H.; Lacouture, S.; Lehoux, M.; Marois-Créhan, C.; Segura, M.; Gottschalk, M. Interactions of Mycoplasma hyopneumoniae and/or Mycoplasma hyorhinis with Streptococcus suis Serotype 2 Using In Vitro Co-Infection Models with Swine Cells. Pathogens 2023, 12, 866. https://doi.org/10.3390/pathogens12070866
Pageaut H, Lacouture S, Lehoux M, Marois-Créhan C, Segura M, Gottschalk M. Interactions of Mycoplasma hyopneumoniae and/or Mycoplasma hyorhinis with Streptococcus suis Serotype 2 Using In Vitro Co-Infection Models with Swine Cells. Pathogens. 2023; 12(7):866. https://doi.org/10.3390/pathogens12070866
Chicago/Turabian StylePageaut, Héloïse, Sonia Lacouture, Mélanie Lehoux, Corinne Marois-Créhan, Mariela Segura, and Marcelo Gottschalk. 2023. "Interactions of Mycoplasma hyopneumoniae and/or Mycoplasma hyorhinis with Streptococcus suis Serotype 2 Using In Vitro Co-Infection Models with Swine Cells" Pathogens 12, no. 7: 866. https://doi.org/10.3390/pathogens12070866
APA StylePageaut, H., Lacouture, S., Lehoux, M., Marois-Créhan, C., Segura, M., & Gottschalk, M. (2023). Interactions of Mycoplasma hyopneumoniae and/or Mycoplasma hyorhinis with Streptococcus suis Serotype 2 Using In Vitro Co-Infection Models with Swine Cells. Pathogens, 12(7), 866. https://doi.org/10.3390/pathogens12070866