Next Article in Journal
The Prevalence of Alert Pathogens and Microbial Resistance Mechanisms: A Three-Year Retrospective Study in a General Hospital in Poland
Previous Article in Journal
Diagnosis in Scrapie: Conventional Methods and New Biomarkers
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Pathogens
Volume 12
Issue 12
10.3390/pathogens12121400
pathogens-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Identification of a Novel Hepacivirus in Southeast Asian Shrew (Crocidura fuliginosa) from Yunnan Province, China

by
Ling Guo
1,2,†,
Bei Li
3,†,
Peiyu Han
1,†,
Na Dong
1,
Yan Zhu
3,
Fuli Li
1,
Haorui Si
3,
Zhengli Shi
3,
Bo Wang
4,
Xinglou Yang
5,* and
Yunzhi Zhang
1,*
1
Yunnan Province Key Laboratory of Anti-Pathogenic Plant Resources Screening, Yunnan Province Key University Laboratory of Zoonoses Cross-Border Prevention and Quarantine, Institute of Preventive Medicine, School of Public Health, Dali University, Dali 671000, China
2
Chongqing Jiangbei District Center for Disease Control and Prevention, Chongqing 400020, China
3
Key Laboratory of Special Pathogens and Biosafety, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan 430071, China
4
Department of Biomedical Sciences and Pathobiology, Virginia-Maryland College of Veterinary Medicine, Virginia Polytechnic Institute and State University, Blacksburg, VA 24061, USA
5
Yunnan Key Laboratory of Biodiversity Information, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming 650023, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Pathogens 2023, 12(12), 1400; https://doi.org/10.3390/pathogens12121400
Submission received: 18 October 2023 / Revised: 18 November 2023 / Accepted: 25 November 2023 / Published: 28 November 2023
(This article belongs to the Special Issue Rodent-Borne Viruses and Diseases)
Browse Figures
Review Reports Versions Notes

Abstract

:
The genus Hepacivirus contains single-stranded positive-sense RNA viruses belonging to the family Flaviviridae, which comprises 14 species. These 14 hepaciviruses have been found in different mammals, such as primates, dogs, bats, and rodents. To date, Hepacivirus has not been reported in the shrew genus of Crocidura. To study the prevalence and genetic evolution of Hepacivirus in small mammals in Yunnan Province, China, molecular detection of Hepacivirus in small mammals from Yunnan Province during 2016 and 2017 was performed using reverse-transcription polymerase chain reaction (RT-PCR). Our results showed that the overall infection rate of Hepacivirus in small mammals was 0.12% (2/1602), and the host animal was the Southeast Asian shrew (Crocidura fuliginosa) (12.5%, 2/16). Quantitative real-time PCR showed that Hepacivirus had the highest viral RNA copy number in the liver. Phylogenetic analysis revealed that the hepaciviruses obtained in this study does not belong to any designated species of hepaciviruses and forms an independent clade. To conclude, a novel hepacivirus was identified for the first time in C. fuliginosa specimens from Yunnan Province, China. This study expands the host range and viral diversity of hepaciviruses.

1. Introduction

The family Flaviviridae currently contains four genera, including Orthoflavivirus, Pestivirus, Hepacivirus, and Pegivirus (https://ictv.global/report/chapter/flaviviridae/flaviviridae, accessed on 15 November 2023). Hepavirius is a genus of a group of genetically diverse viruses with small spherical envelops and positive-sense RNA genomes of approximately 8.9–10.5 kb [1], which contain a single long open reading frame (ORF) flanked by 5′- and 3′-terminal untranslated regions (UTRs). The ORF encodes a polyprotein of approximately 3000 amino acids (aa), which is further proteolytically cleaved by host and viral proteases into structural proteins (Core, E1, and E2) and nonstructural proteins (p7, NS2, NS3, NS4A, NS4B, NS5A, and NS5B) [2].
Hepacivirus comprises 14 species (Hepacivirus bovis, colobi, equi, glareoli, hominis, macronycteridis, myodae, norvegici, otomopis, peromysci, platyrrhini, ratti, rhabdomysis, vittatae) according to the International Committee on Taxonomy of Viruses (ICTV) classification (https://ictv.global/taxonomy, accessed on 15 November 2023). Members of specific hepacivirus species show characteristically distinct host ranges, including horses and possibly dogs (Hepacivirus A, renamed Hepacivirus equi), tamarins and potentially other New World primates (Hepacivirus B, renamed Hepacivirus platyrrhini), humans (Hepacivirus C, renamed Hepacivirus hominis), colobus monkeys (Hepacivirus D, renamed Hepacivirus colobi), various species of rodents (Hepacivirus E, F, G, H, I and J, renamed Hepacivirus peromysci, myodae, ratti, norvegici, rhabdomysis, glareoli, respectively), bats (Hepacivirus K, L, and M, renamed Hepacivirus macronycteridis, vittatae, and otomopis, respectively), and cows (Hepacivirus N, renamed Hepacivirus bovis) [2,3,4,5] (https://ictv.global/report/chapter/flaviviridae/flaviviridae/hepacivirus, accessed on 15 November 2023). However, apart from the human hepatitis C virus (HCV, Hepacivirus hominis), the molecular biology of the other above-mentioned hepaciviruses has not been well characterized.
Recently, a novel hepacivirus in three-toed sloths (Bradypus variegatus) from Costa Rica was detected and could represent a novel hepacivirus species [6]. More importantly, a study suggested that host switches of hepacivirus were possible, such as from rodents to sloths, and rodents have played a prominent role in Hepacivirus genealogy [6]. Although small rodents and bovines are recognized as important reservoirs of hepaciviruses, few investigations have addressed hepacivirus in other small wild mammals in China [7,8,9,10,11,12,13]. This study aimed to close this knowledge gap, and hepacivirus screening was conducted on a total of 1602 small wild mammals captured in a wide geographical area, Yunnan Province, in China from 2016 to 2017.

2. Materials and Methods

2.1. Samples Collection and Ethical Statements

From 2016 to 2017, small mammal samples were collected at 12 sites in Yunnan Province, China (Figure 1 and Table 1). The sample trapping was performed using cage-type traps using freshly fried fritters as bait. The collected small mammals were brought back to the laboratory and were exsanguinated during isoflurane anesthesia on a warming blanket to minimize distress. Species were initially identified based on morphology, followed by further molecular identification of the species via sequence analysis of the mitochondrial (mt)-cytochrome b (Cytb) gene [14]. The samples were dissected in an aseptic environment of a biosafety level 2 (BSL-2) laboratory, and the heart, liver, spleen, lung, kidney, and intestine tissues were collected in 2 mL cryogenic vials (CORNING, Shanghai, China) and stored temporarily in liquid nitrogen. The samples were then stored at −80 °C before further laboratory analyses. This study was approved by and conducted according to the guidelines of the Animal Ethics Committee of Dali University (approval no. DLDXLL2017007).

2.2. Viral RNA Extraction and RT-PCR for Hepacivirus

Under aseptic conditions, approximately 0.1 g of liver tissue sample was cut into GeneReady Animal PIII crushing tubes (Life Real, Hangzhou, China) and diluted with 1 mL of sterilized phosphate-buffered saline (PBS) to prepare a 10% weight per volume (% w/v) tissue suspension, followed by grinding in a GeneReady Ultimate grinder (Life Real, Hangzhou, China). The tissue suspension was then clarified via centrifugation at 10,000× g for 15 min and filtered through a 0.45 mm membrane. Viral RNA was extracted from liver tissue using the Viral RNA mini kit (Qiagen, Hilden, Germany) following the manufacturer’s protocol. Hepacivirus RNA was detected using a 400 bp segment of NS3 analysis via reverse-transcription-nested polymerase chain reaction (RT-PCR) with degenerate primers (Hepaci-F1: GCICCIACIGGIAGYGGIAA; Hepaci-R1: CCIGTCATIAGRGCRTCIGT; Hepaci-R2: CARTCIRTIACIGARTCRAARTYICC; Hepaci-F2: TAYGAYGTIATIATITGYGAYGARTG; Hepaci-F3: TAYGAYGTIATIATITGYGAYGA; Hepaci-F4: GCIACIGCIACICCICCIGG; Hepaci-R3: CCIGTCATIGRGCRTCIGT; Hepaci-R4: CARTCIRTIACIGARTCRAARTYICC), as described previously [8,15,16]. PCR was performed using Super ScriptⅢ One-Step RT-PCR System with Platinum Taq DNA Polymerase (Thermo Fisher Scientific, Waltham, MA, USA), following the manufacturer’s instructions. First-round RT-PCR was performed with 5 µL of RNA, 400 nM each of 1st-round primers or an equimolar mix of primers, 1 µg of bovine serum albumin, 0.2 mM of each dNTP, and 2.4 mM of MgSO4. Second-round 50 µL Platinum Taq reactions involved the use of 1 µL of 1st-round PCR product, 2.5 mM MgCl2, and 400 nM each of the 2nd-round primers. First-round RT-PCR reactions used a touchdown protocol with reverse-transcription at 48 °C for 30 min, denaturation at 95 °C for 3 min, followed by PCR 10 cycles of 15 s at 94 °C, 20 s at 60 °C, with a decrease of 1 °C per cycle, and extension at 72 °C for 45 s, followed by another 40 cycles at 50 °C annealing temperature. Second-round reactions used the same cycling protocol without the RT step. The PCR products were examined on 1.2% agarose gel for electrophoretic analysis and observed with a UV gel imager for the presence of target bands with a specific molecular weight (about 400 bp). The objective PCR bands underwent gel purification with a MinElute Gel Extraction Kit (Qiagen, Hilden, Germany), and they were sequenced with both forward and reverse primers by Tsingke Biotechnology (Wuhan, China).

2.3. Viral Complete Genome Sequencing and Assembly

The entire genome sequence of the two hepacivirus RNA-positive samples was evaluated using next-generation sequencing using an Illumina HiSeq 3000 system (Illumina, San Diego, CA, USA). The sequencing reads were assembled and analyzed using MEGAHIT (v1.2.9) and Geneious (v10.0.9) algorithms, respectively. The remaining genome gaps were filled using specific primers through conventional PCR. The genome end sequences were obtained via rapid amplification of cDNA ends (RACE) using a Clontech SMARTer RACE 5′ and 3′ Kit (Takara, Kusatsu, Japan) and via poly (A) tailing [17].

2.4. Phylogenetic Analysis

The sequence alignments contained the genomic nucleotide sequences of the virus identified in this study together with 27 sequences obtained from representative members of the genus Hepacivirus using ClustalW. Phylogenetic trees were inferred for coding sequences of the polyprotein genes using the maximum likelihood (ML) method and the Jukes–Cantor model implemented in MEGA X software. To assess support for individual nodes, 1000 bootstrap replicates were obtained following the same procedure. The phylogenetic trees were visualized using Adobe Illustrator CC 2018.
RDP4 was used to detect potential recombination sequences and parental sequences in gene fragments and entire ORF sequences. Potential recombination events were considered significant when the p-values of more than 6 detection methods were all <0.05. SimPlot software 3.5.1 was used for further verification.

2.5. Quantitative Real-Time RT-PCR (qRT-PCR)

Using a HiScript II One Step qRT-PCR SYBR Green kit (Vazyme Biotech, Nanjing, China), quantitative RT-PCR was performed according to the manufacturer’s instructions. A positive control from the partial genome RNA transcript of the DNA template was applied using a MAXI script Kit (Applied Biosystems, Waltham, MA, USA) in vitro. Specific primers (5′–TCGGTGATGTCTTTATGAGGC–3′ and 5′–CCTTGGTCTGACTTTGATCTTAAC–3′) were designed based on the sequence obtained in this study. PCR conditions were as follows: 50 °C for 15 min; 95 °C for 5 min; 40 cycles at 95 ˚C for 10 s, 60 °C for 30 s, 95 °C for 15 s, and a final extension at 60 °C for 1 min.

3. Results

3.1. Hepacivirus Detection

Overall, 1602 small mammals—comprising 21 species, 11 genera, 4 families, and 3 orders—were trapped in 12 counties of Yunnan Province (Figure 1 and Table 1). Two liver tissue samples (0.12%, 2/1602) of Crocidura fuliginosa (commonly known as Southeast Asian shrew) were positive for hepacivirus nucleic acids. Taxonomically, the Southeast Asian shrew is a species of insectivore in the genus Crocidura, family Soricidae, order Eulipotyphla, which is widely spread throughout Southeastern Asian countries (https://en.wikipedia.org/wiki/Southeast_Asian_shrew, accessed on 15 November 2023).
One Crocidura fuliginosa specimen was collected from Nanjian County (termed Hepacivirus Cf/NJ12), and another was collected from Xiangyun County (termed Hepacivirus Cf/XY174) in 2017. The positive rate of hepacivirus infection among Crocidura fuliginosas was 12.5% (2/16). Specifically, Hepacivirus Cf/NJ12 had 73.7% nucleotide identity with Hepacivirus Cf/XY174 based on the partial NS3 sequence. In particular, Hepacivirus Cf/NJ12 shares a high similarity (69.25%) with the Asian house shrew (Suncus murinus) hepacivirus SZCDC19 (GenBank no. MF775363) based on the partial NS3 sequence. In contrast, Hepacivirus Cf/XY174 is most similar (68.90%) to Suncus sp. hepacivirus SoSm-HepaV/Cs2009 (GenBank no. MT085224) based on the partial NS3 sequences.

3.2. Genome Characterization

Because of the poor sequence assembly quality of Hepacivirus Cf/XY174, only the complete genomic sequence of Hepacivirus Cf/NJ12 was determined, which was 10,383 nucleotides in length and with a G + C content of 54.5% (genome warehouse number: GWHBHEC01000000). Similar to other known hepaciviruses, the genome of Hepacivirus Cf/NJ12 containseda single ORF encoding a polyprotein of 3167 amino acids flanked by the 5′- and 3′-untranslated regions (UTR) (822 and 57 nucleotides, respectively), and the polyprotein was putatively cleaved in ten proteins (Core, E1, E2, P7, N2, N3, N4A, N4B, N5A, N5B) (Figure 2). The predicted polyprotein shared the highest identity of 65.5% (nucleotide) and 72.1% (amino acid) with a hepacivirus detected in a striped field mouse (Species: Apodemus agrarius) (GenBank no. QUS47367) in 2016 from Wenzhou City, China. However, the Hepacivirus Cf/NJ12 had only an identity of 40.6% (nucleotide) and 26.6% (amino acid) with the human HCV reference strain H77 (GenBank no. AF009606). Comparative sequence analysis showed that the Hepacivirus Cf/NJ12 ORF detected had 30.3–37.7% nucleotide and 20.6–31.1% amino acid identities with other known hepacivirus species (Table 2).

3.3. Phylogenetic and p-Distance

Phylogenetic analysis based on the nucleotide sequence of the ORF region showed that the hepacivirus strain detected in Crocidura fuliginosa formed an independent clade (Figure 3A). Notably, the novel Hepacivirus Cf-NJ12 is clustered with other four hepaciviruses previously found in different rodents, indicating that it branched out from their ancestor long before the other four rodent hepaciviruses. However, it should also be noted that the rodent hepaciviruses and bat hepaciviruses dispersed in the phylogenetic tree of the genus Hepacivirus, the precise relationship between shrew hepaciviruses and rodent hepaciviruses is yet to be determined and awaits the determination of further complete genomes of genetically heterogeneous hepaciviruses in other small mammals.
In addition to the Southeast Asian shrew (Crocidura fuliginosa) (Figure 3B), the genus Crocidura actually contains three additional species, namely, the Asian gray shrew (Crocidura attenuata), Horsfield’s shrew (Crocidura horsfieldii), and Voracious shrew (Crocidura vorax), which presumably harbor their own hepaciviruses. It would be appealing to elucidate the relationship of hepaciviruses in Crocidura shrews.
We did not find any evidence of recombination in the Hepacivirus Cf/NJ12 genome. The amino acid p-distances of the conserved regions 996–1437 and 2693–3115 (relevant to positions 1123–1566 and 2536–2959 of the HCV genotype 1a of H77 reference strain (AF011751) of Hepacivirus Cf/NJ12 range within 0.518–0.590 and 0.464–0.546 with known species of the genus Hepacivirus, respectively (Table 2). The ICTV species demarcation criteria for this genus state that a novel hepacivirus must exhibit a p-distance greater than 0.25 between amino acids 1123 and 1566 of NS3 and greater than 0.3 between amino acids 2536 and 2959 NS5, as numbered in the HCV genotype 1a of H77 reference strain (AF011751) [3]. Therefore, we propose that Hepacivirus Cf/NJ12 should constitute a new hepacivirus species.

3.4. Quantification of Hepacivirus in Different Tissues Using qRT-PCR

To determine the viral loads of hepacivirus in different organs of the hepacivirus-RNA-positive specimen, viral genomic RNA copies were quantified in several tissue samples, including the liver, spleen, kidney, and intestine of Hepacivirus Cf-NJ12 via qRT-PCR. The results showed that hepacivirus RNA was detected in all tested tissues, and the viral load in Crocidura fuliginosa ranged from 5 × 104 to 3.14 × 105 copies/gram of tissue. Moreover, the viral load in the liver was numerically higher than in other tissues and reached 3.14 × 105 copies/g tissues (Figure 4). Whether shrew hepacivirus causes persistent or chronic infection in its host as human HCV remains unclear.

4. Discussion

So far, the genus Hepacivirus includes 14 species with a wide range of host reservoirs, including humans, Old World colobus monkeys, various rodent and bat species, European and African cattle, horses, and donkeys (https://ictv.global/report/chapter/flaviviridae/flaviviridae/hepacivirus, accessed on 15 November 2023). Rodents are the natural reservoirs of various hepaciviruses, and they may be the major hosts driving the spread of hepaciviruses between different host orders [6]; among the rodential hosts of six hepaciviruses (originally named Hepacivirus E to J) in Hepacivirus according to ICTV, Hepacivirus peromysci (E) was detected in deer mouse (Peromysus maniculateus) [18], Hepacivirus myodae (F) and Hepacivirus glareoli (J) were detected in bank vole (Myodes glareolus) [15], Hepacivirus ratti (G) and Hepacivirus norvegici (H) were detected in Norway rat (Rattus norvegicus) [19], and Hepacivirus rhabdomysis (I) was detected in South African four-striped mouse (Rhabdomys pumilio) [15]. In a previous study, among 4770 rodent sera and organ specimens (41 species) from around the world, three highly divergent rodent hepacivirus clades were detected in 27 (1.8%) of 1465 European bank voles (Myodes glareolus) and 10 (1.9%) of 518 South African four-striped mice (Rhabdomys pumilio) [15]. However, in this survey, hepacivirus was only detected in one of three species of shrews (order Eulipotyphla) with a detection rate of 12.5% (2/16), but none was detected in 18 species of rodents (order Rodentia); whether other animal species could harbor hepacivirus remains to be determined. Moreover, which small mammals have higher hepacivirus genetic diversity and detection rates is largely unknown.
Southeast Asian shrew (Crocidura fuliginosa) is widely distributed in Southeast Asia (https://www.iucnredlist.org/species/40631/115176525, accessed on 15 November 2023), although the current population trend is unknown. Among the total of 16 Southeast Asian shrew samples collected from seven counties, a novel hepacivirus was detected in one sample from Xiangyun County and one of three samples from Nanjian County. A plausible explanation for the results is that Xiangyun County and Nanjian County are connected (Figure 1) and belong to the Wuliang Mountains, which are known for their abundant biodiversity under suitable geographic conditions, including temperature, humidity, altitude, longitude, and latitude. Additionally, the ecosystems of the two counties are similar, so are altogether suitable for the growth and reproduction of small mammals such as the Southeast Asian shrew. In the present study, the novel hepacivirus was only found in Xiangyun County and Nanjian County, reflecting that the distribution of these viruses may be limited to these two regions. However, it still cannot be ruled out that with the increase in the sample size, the virus would also be detected in other locations. Nonetheless, whether Southeast Asian shrews in other counties of Yunnan Province harbor this novel hepacivirus remains to be determined. Moreover, considering the movement of shrews due to ecological changes, we cannot exclude the possibility of hepacivirus spread in the future. Since there is thus far no evidence of zoonotic infection of hepacivirus, it is unlikely that the novel shrew hepacivirus can cross species barriers to infect humans.
In addition to the hepaciviruses that have already been reported by ICTV, novel hepaciviruses have been gradually discovered around the world. For example, novel hepaciviruses were found in Asian house shrew (Suncus murinus) in Shenzhen, China [8]; montane grass mouse (Akodon montensis), delicate vesper mouse (Calomys tener), black-footed pigmy rice rat (Oligoryzomys nigripes), hairy-tailed bolo mouse (Necromys lasiurus) and house mouse (Mus musculus) from São Paulo State, Brazil [5]; long-tailed ground squirrel (Spermophilus undulates) from Xinjiang Uygur Autonomous Region, China [9]; cows from Yunnan, China [11]; common brushtail possum (Trichosurus Vulpecula) from Sydney, Australia [20]; and vrown-throated three-toed sloth (Bradypus variegatus) from the Sloth Sanctuary, Penshurt, Limón, Costa Rica [6]. The phylogenetic analysis in our study demonstrated that Hepacivirus Cf/NJ12 is independent of the other 14 existing hepacivirus species (Figure 3). However, Hepacivirus Cf/NJ12 formed a large clade with four hepacivirus species Hepacivirus peromysci (E), myodae (F), norvegici (H), ratti (G), indicating that Hepacivirus Cf/NJ12 may have had a common ancestor with them. Based on the species demarcation criteria of ICTV, the Hepacivirus Cf/NJ12 obtained in this study is a novel hepacivirus species according to p-distance analysis. Notably, these are the first hepaciviruses detected in Crocidura fuliginosa and the first whole-genome sequences of the novel hepacivirus reported. The ever-expanding host range of hepacivirus suggests that hepacivirus may have crossed species barriers in ancient times and have thus contributed to its genetic diversification. However, there is no documented evidence of the experimental infection of hepacivirus in laboratory animals or another host other than that in which it was discovered, indicating that the currently occurring hepaciviruses are highly adapted to their specific hosts, and therefore cross-species transmission is less likely.
It is worth noting that rodent hepaciviruses contain six species of hepaciviruses, and bat hepaciviruses contain three species of hepaciviruses, indicating that hepaciviruses are highly genetically diverse in these two animal orders. Furthermore, the phylogenetic relationships revealed that rodent hepacivirus share the earliest common ancestor with other known hepaciviruses [21]. Collectively, rodents and, to a lesser extent, bats may be the ancestor hosts of hepaciviruses [2,15,22]. Nevertheless, our discovery of a new hepacivirus in the insectivores still further deepens our understanding of the genetic evolution of hepaciviruses. Intriguingly, different hepaciviruses can infect the same host. For example, Hepacivirus ratti (G) and norvegici (H) infect Rattus norvegicus [23]; Hepacivirus macronycteridis (K) and vittatae (L) infect Hipposideros vittatus [24]. On the one hand, this genetic diversity of hepaciviruses in certain hosts may have evolved through interspecies transmission. On the other hand, it is possible that the segregated animal hosts later come into contact and can still share their divergent hepaviruses.
Nevertheless, there are still many knowledge gaps in the molecular evolution of hepaciviruses, which require further investigation and research [25]. With the focus on the virome in small mammals and the development and advancement of sequencing techniques, it is anticipated that an increasing number of genetically diverse hepaciviruses will be identified in the near future, since hepacivirus has only been detected in less than 1% of the named rodent, chiropteran, and insectivore species to date. Most importantly, the identification of animal hepaciviruses will provide a better understanding of the evolutionary history and origin of human HCV.
We found that in addition to the liver, hepacivirus RNA was also detected in the spleen, kidney, and intestine. Similar to other reported hepaciviruses, the highest viral load was detected in the liver [8,9,15]. However, it should be cautiously interpreted that if hepaciviruses are produced massively in the liver, the viruses are highly likely to enter the blood (viremia), which will lead to RNA detection in the other tissues that have blood. Whether the novel hepacivirus displays hepatotropism remains to be determined using histopathological examinations, immunohistochemistry, and/or in situ hybridization; meanwhile, the impact of hepaciviruses on hosts, such as hepatitis and liver fibrosis, could be studied, which will collectively shed light on virus–host interactions. Unfortunately, due to the improper preservation of tissue samples, we could not perform histopathological examination of the liver tissues of the two hepacivirus-positive samples. The herein-described data were obtained from only one positive animal, which is insufficient for a comprehensive understanding of the epidemiologic characteristics of C. fuliginosa hepacivirus.
The discovery of Hepacivirus Cf/NJ12 extends our understanding of the genetic diversity and host range of hepaciviruses. Chimpanzee (Pan troglodytes) and tree shrew (Tupaia telangeri) are known to have clinical symptoms similar to humans after inoculation with HCV [26,27]. The course and pathological signs experienced by bank vole (Clethrionomys glareolus) inoculated with Hepacivirus myodae and glareoli Hepacivirus are similar to those of humans infected with HCV [28]. However, chimpanzees are relatively rare and expensive subjects, and studying the pathogenesis of HCV replication in chimpanzees may take 10 to 20 years. In fact, the pathogeneses of hepacivirus infection in tree shrews, bank vole, and humans are quite different. Therefore, there is still a lack of suitable animal models to study the pathogenesis and immunity of hepaciviruses. The first discovery of novel hepacivirus in C. fuliginosa may provide a new option for future development of a suitable hepacivirus animal model.

5. Conclusions

In summary, hepacivirus was identified for the first time in C. fuliginosa specimens from Xiangyun County and Nanjian County, Yunnan Province. Hepaciviruses were only identified in C. fuliginosa samples, which suggests that more sensitive and powerful detection methods are warranted for an accurate and broader assessment. The obtained genomic sequence of Hepacivirus Cf/NJ12 showed low identity with known hepaciviruses. Thus, it could be classified as a novel species in the genus Hepacivirus based on the ICTV criteria [3]. Along with previous reports, we showed that hepacivirus has a wide host range, including C. fuliginosa [29,30,31]. Taken together, these results expand our knowledge of the diversity and host range of hepaciviruses. Nonetheless, further studies should address the pathology and evolutionary pattern of hepaciviruses.

Author Contributions

Conceptualization, L.G., P.H. and Y.Z. (Yunzhi Zhang); methodology, B.L., Y.Z. (Yan Zhu) and X.Y.; formal analysis, L.G., P.H., H.S., B.W., Y.Z. (Yan Zhu) and X.Y.; investigation, Y.Z. (Yunzhi Zhang), N.D. and F.L.; resources, B.L., N.D., F.L. and H.S.; data curation, B.L., N.D., F.L., Y.Z. (Yan Zhu) and B.W.; writing—original draft preparation, L.G. and P.H.; writing—review and editing, B.W., X.Y. and Y.Z. (Yunzhi Zhang); visualization, L.G., P.H. and H.S.; supervision, B.L., Z.S. and X.Y.; project administration, Z.S. and Y.Z. (Yunzhi Zhang); funding acquisition, Z.S., X.Y. and Y.Z. (Yunzhi Zhang). All authors have read and agreed to the published version of the manuscript.

Funding

This work was jointly supported by the National Natural Science Foundation of China (U2002218, 81874274 to Y.Z.); Yunnan high-level health and family planning technical personnel training project (L-2017027 to Y.Z.); the key program of Chinese Academy of Sciences (CAS) (KJZD-SW-L11 to Z.S.); and the Youth innovation promotion association of CAS (2019328 to X.Y.).

Institutional Review Board Statement

This study was approved by and conducted according to the guidelines of the Animal Ethics Committee of the Yunnan Institute of Endemic Diseases Control and Prevention (approval no. 2017007).

Informed Consent Statement

Not applicable.

Data Availability Statement

All sequences used in this study were from the National Center for Biological Information (NCBI) database. Hepacivirus Cf/NJ12 sequences were uploaded to the Genome Warehouse in the National Genomics Data Center under the accession number: GWHBHEC01000000.

Acknowledgments

We thank for the sequencing technical support provided by Qitan Technology Ltd. (Chengdu, China).

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Simmonds, P.; Becher, P.; Bukh, J.; Gould, E.A.; Meyers, G.; Monath, T.; Muerhoff, S.; Pletnev, A.; Rico-Hesse, R.; Smith, D.B.; et al. ICTV Virus Taxonomy Profile: Flaviviridae. J. Gen. Virol. 2017, 98, 2–3. [Google Scholar] [CrossRef] [PubMed]
  2. Scheel, T.K.; Simmonds, P.; Kapoor, A. Surveying the global virome: Identification and characterization of HCV-related animal hepaciviruses. Antivir. Res. 2015, 115, 83–93. [Google Scholar] [CrossRef] [PubMed]
  3. Smith, D.B.; Becher, P.; Bukh, J.; Gould, E.A.; Meyers, G.; Monath, T.; Muerhoff, A.S.; Pletnev, A.; Rico-Hesse, R.; Stapleton, J.T.; et al. Proposed update to the taxonomy of the genera Hepacivirus and Pegivirus within the Flaviviridae family. J. Gen. Virol. 2016, 97, 2894–2907. [Google Scholar] [CrossRef] [PubMed]
  4. Simons, J.N.; Pilot-Matias, T.J.; Leary, T.P.; Dawson, G.J.; Desai, S.M.; Schlauder, G.G.; Muerhoff, A.S.; Erker, J.C.; Buijk, S.L.; Chalmers, M.L.; et al. Identification of two flavivirus-like genomes in the GB hepatitis agent. Proc. Natl. Acad. Sci. USA 1995, 92, 3401–3405. [Google Scholar] [CrossRef] [PubMed]
  5. de Souza, W.M.; Fumagalli, M.J.; Sabino-Santos, G., Jr.; Motta Maia, F.G.; Modha, S.; Teixeira Nunes, M.R.; Murcia, P.R.; Moraes Figueiredo, L.T. A Novel Hepacivirus in Wild Rodents from South America. Viruses 2019, 11, 297. [Google Scholar] [CrossRef] [PubMed]
  6. Moreira-Soto, A.; Arroyo-Murillo, F.; Sander, A.L.; Rasche, A.; Corman, V.; Tegtmeyer, B.; Steinmann, E.; Corrales-Aguilar, E.; Wieseke, N.; Avey-Arroyo, J.; et al. Cross-order host switches of hepatitis C-related viruses illustrated by a novel hepacivirus from sloths. Virus Evol. 2020, 6, veaa033. [Google Scholar] [CrossRef] [PubMed]
  7. Wu, Z.; Lu, L.; Du, J.; Yang, L.; Ren, X.; Liu, B.; Jiang, J.; Yang, J.; Dong, J.; Sun, L.; et al. Comparative analysis of rodent and small mammal viromes to better understand the wildlife origin of emerging infectious diseases. Microbiome 2018, 6, 178. [Google Scholar] [CrossRef]
  8. Guo, H.; Cai, C.; Wang, B.; Zhuo, F.; Jiang, R.; Wang, N.; Li, B.; Zhang, W.; Zhu, Y.; Fan, Y.; et al. Novel hepacivirus in Asian house shrew, China. Sci. China Life Sci. 2019, 62, 701–704. [Google Scholar] [CrossRef]
  9. Li, L.L.; Liu, M.M.; Shen, S.; Zhang, Y.J.; Xu, Y.L.; Deng, H.Y.; Deng, F.; Duan, Z.J. Detection and characterization of a novel hepacivirus in long-tailed ground squirrels (Spermophilus undulatus) in China. Arch. Virol. 2019, 164, 2401–2410. [Google Scholar] [CrossRef]
  10. An, C.H.; Li, J.; Wang, Y.T.; Nie, S.M.; Chang, W.H.; Zhou, H.; Xu, L.; Sun, Y.X.; Shi, W.F.; Li, C.X. Identification of a novel hepacivirus in Mongolian gerbil (Meriones unguiculatus) from Shaanxi, China. Virol. Sin. 2022, 37, 307–310. [Google Scholar] [CrossRef]
  11. Qiang, X.; Shen, X.; Peng, H.; Guo, X.; He, Z.; Yao, M.; Fu, G.; Cui, Y.; Zhang, X.; Huang, Y.; et al. Complete genome sequence of a novel bovine hepacivirus from Yunnan, China. Arch. Virol. 2020, 165, 1489–1494. [Google Scholar] [CrossRef] [PubMed]
  12. Lu, G.; Ou, J.; Zhao, J.; Li, S. Presence of a Novel Subtype of Bovine Hepacivirus in China and Expanded Classification of Bovine Hepacivirus Strains Worldwide into 7 Subtypes. Viruses 2019, 11, 843. [Google Scholar] [CrossRef] [PubMed]
  13. Lu, G.; Jia, K.; Ping, X.; Huang, J.; Luo, A.; Wu, P.; Li, S. Novel bovine hepacivirus in dairy cattle, China. Emerg. Microbes Infect. 2018, 7, 54. [Google Scholar] [CrossRef] [PubMed]
  14. Guillén-Servent, A.; Francis, C.M. A new species of bat of the Hipposideros bicolor group (Chiroptera: Hipposideridae) from Central Laos, with evidence of convergent evolution with Sundaic taxa. Acta Chiropterologica 2006, 8, 39–61. [Google Scholar] [CrossRef]
  15. Drexler, J.F.; Corman, V.M.; Muller, M.A.; Lukashev, A.N.; Gmyl, A.; Coutard, B.; Adam, A.; Ritz, D.; Leijten, L.M.; van Riel, D.; et al. Evidence for novel hepaciviruses in rodents. PLoS Pathog. 2013, 9, e1003438. [Google Scholar] [CrossRef]
  16. Wang, B.; Yang, X.L.; Li, W.; Zhu, Y.; Ge, X.Y.; Zhang, L.B.; Zhang, Y.Z.; Bock, C.T.; Shi, Z.L. Detection and genome characterization of four novel bat hepadnaviruses and a hepevirus in China. Virol. J. 2017, 14, 40. [Google Scholar] [CrossRef]
  17. Wang, B.; Kruger, L.; Machnowska, P.; Eshetu, A.; Gunsenheimer-Bartmeyer, B.; Bremer, V.; Hauser, A.; Bannert, N.; Bock, C.T. Characterization of a hepatitis C virus genotype 1 divergent isolate from an HIV-1 coinfected individual in Germany assigned to a new subtype 1o. Virol. J. 2019, 16, 28. [Google Scholar] [CrossRef]
  18. Kapoor, A.; Simmonds, P.; Scheel, T.K.; Hjelle, B.; Cullen, J.M.; Burbelo, P.D.; Chauhan, L.V.; Duraisamy, R.; Sanchez Leon, M.; Jain, K.; et al. Identification of rodent homologs of hepatitis C virus and pegiviruses. mBio 2013, 4, e00216-13. [Google Scholar] [CrossRef]
  19. Firth, C.; Bhat, M.; Firth, M.A.; Williams, S.H.; Frye, M.J.; Simmonds, P.; Conte, J.M.; Ng, J.; Garcia, J.; Bhuva, N.P.; et al. Detection of zoonotic pathogens and characterization of novel viruses carried by commensal Rattus norvegicus in New York City. mBio 2014, 5, e01933-14. [Google Scholar] [CrossRef]
  20. Chang, W.S.; Eden, J.S.; Hartley, W.J.; Shi, M.; Rose, K.; Holmes, E.C. Metagenomic discovery and co-infection of diverse wobbly possum disease viruses and a novel hepacivirus in Australian brushtail possums. One Health Outlook 2019, 1, 5. [Google Scholar] [CrossRef]
  21. Rasche, A.; Sander, A.L.; Corman, V.M.; Drexler, J.F. Evolutionary biology of human hepatitis viruses. J. Hepatol. 2019, 70, 501–520. [Google Scholar] [CrossRef] [PubMed]
  22. Pybus, O.G.; Theze, J. Hepacivirus cross-species transmission and the origins of the hepatitis C virus. Curr. Opin. Virol. 2016, 16, 1–7. [Google Scholar] [CrossRef]
  23. Pfaender, S.; Brown, R.J.; Pietschmann, T.; Steinmann, E. Natural reservoirs for homologs of hepatitis C virus. Emerg. Microbes Infect. 2014, 3, e21. [Google Scholar] [CrossRef] [PubMed]
  24. Quan, P.L.; Firth, C.; Conte, J.M.; Williams, S.H.; Zambrana-Torrelio, C.M.; Anthony, S.J.; Ellison, J.A.; Gilbert, A.T.; Kuzmin, I.V.; Niezgoda, M.; et al. Bats are a major natural reservoir for hepaciviruses and pegiviruses. Proc. Natl. Acad. Sci. USA 2013, 110, 8194–8199. [Google Scholar] [CrossRef] [PubMed]
  25. Sharp, P.M.; Simmonds, P. Evaluating the evidence for virus/host co-evolution. Curr. Opin. Virol. 2011, 1, 436–441. [Google Scholar] [CrossRef] [PubMed]
  26. Bukh, J. Animal models for the study of hepatitis C virus infection and related liver disease. Gastroenterology 2012, 142, 1279–1287.e3. [Google Scholar] [CrossRef]
  27. Amako, Y.; Tsukiyama-Kohara, K.; Katsume, A.; Hirata, Y.; Sekiguchi, S.; Tobita, Y.; Hayashi, Y.; Hishima, T.; Funata, N.; Yonekawa, H.; et al. Pathogenesis of hepatitis C virus infection in Tupaia belangeri. J. Virol. 2010, 84, 303–311. [Google Scholar] [CrossRef]
  28. Rohrs, S.; Begeman, L.; Straub, B.K.; Boadella, M.; Hanke, D.; Wernike, K.; Drewes, S.; Hoffmann, B.; Keller, M.; Drexler, J.F.; et al. The Bank Vole (Clethrionomys glareolus)-Small Animal Model for Hepacivirus Infection. Viruses 2021, 13, 2421. [Google Scholar] [CrossRef]
  29. Hartlage, A.S.; Cullen, J.M.; Kapoor, A. The Strange, Expanding World of Animal Hepaciviruses. Annu. Rev. Virol. 2016, 3, 53–75. [Google Scholar] [CrossRef]
  30. Shi, M.; Lin, X.D.; Chen, X.; Tian, J.H.; Chen, L.J.; Li, K.; Wang, W.; Eden, J.S.; Shen, J.J.; Liu, L.; et al. The evolutionary history of vertebrate RNA viruses. Nature 2018, 556, 197–202. [Google Scholar] [CrossRef]
  31. Chu, L.; Jin, M.; Feng, C.; Wang, X.; Zhang, D. A highly divergent hepacivirus-like flavivirus in domestic ducks. J. Gen. Virol. 2019, 100, 1234–1240. [Google Scholar] [CrossRef] [PubMed]
Pathogens 12 01400 g001
Figure 1. Sampling sites and numbers of sampled specimens per order. The circles indicate 12 sample collection sites in Yunnan Province, China, while red superscript asterisks indicate the spots where the two Southeast Asian shrew hepaciviruses (Cf/XY174 and Cf/NJ12) were detected.
Figure 1. Sampling sites and numbers of sampled specimens per order. The circles indicate 12 sample collection sites in Yunnan Province, China, while red superscript asterisks indicate the spots where the two Southeast Asian shrew hepaciviruses (Cf/XY174 and Cf/NJ12) were detected.
Pathogens 12 01400 g001
Pathogens 12 01400 g002
Figure 2. Schematic diagram of the genomic organization of Hepacivirus Cf/NJ12 genome.
Figure 2. Schematic diagram of the genomic organization of Hepacivirus Cf/NJ12 genome.
Pathogens 12 01400 g002
Pathogens 12 01400 g003
Figure 3. (A) Phylogenetic analysis based on the nucleotide sequence of the hepacivirus open reading frame region. Maximum likelihood phylogenetic tree showing the evolutionary relationship of Hepacivirus Cf/NJ12 (highlighted in bold) with representative members of the Hepacivirus genus. The scale bar indicates nucleotide substitutions per site. Bootstrap values (≥60) of 1000 replicates are shown in the main nodes. (B) Specimen images of the Southeast Asian shrew (Crocidura fuliginosa).
Figure 3. (A) Phylogenetic analysis based on the nucleotide sequence of the hepacivirus open reading frame region. Maximum likelihood phylogenetic tree showing the evolutionary relationship of Hepacivirus Cf/NJ12 (highlighted in bold) with representative members of the Hepacivirus genus. The scale bar indicates nucleotide substitutions per site. Bootstrap values (≥60) of 1000 replicates are shown in the main nodes. (B) Specimen images of the Southeast Asian shrew (Crocidura fuliginosa).
Pathogens 12 01400 g003
Pathogens 12 01400 g004
Figure 4. Real-time RT-PCR quantification of viral genomic RNA. The host of positive sample Hepacivirus Cf/NJ12 was selected, and real-time RT-PCR was used to quantify the viral RNA in the liver, spleen, kidney, and intestine. Units are presented in copies per gram.
Figure 4. Real-time RT-PCR quantification of viral genomic RNA. The host of positive sample Hepacivirus Cf/NJ12 was selected, and real-time RT-PCR was used to quantify the viral RNA in the liver, spleen, kidney, and intestine. Units are presented in copies per gram.
Pathogens 12 01400 g004
Table 1. RT-PCR detection results for hepacivirus in small wild mammals collected from 2016 to 2017 in Yunnan Province, China.
Table 1. RT-PCR detection results for hepacivirus in small wild mammals collected from 2016 to 2017 in Yunnan Province, China.
OrderFamilyGenusSpeciesSampling Location of Samples (Sample Size; Sampling Year)P/D * (%)
RodentiaCricetidaeEothenomysE. miletusZhaoyang (38; 2016), Luxi (42; 2016), Xiangyun (2; 2016), Xiangyun (7; 2017), Luxi (23; 2017)0/112 (0%)
MuridaeApodemusA. agrariusWeixin (3; 2016), Ruili (1; 2017)0/4 (0%)
A. chevrieriLianghe (5; 2016), Yiliang (19; 2016), Zhaoyan (88; 2016), Weixin (1; 2016), Luxi (21; 2016), Xiangyun (4; 2016), Yuanmou (7; 2016), Xiangyun (11; 2017), Luxi (19; 2017), Yuanmou (12; 2017)0/187 (0%)
A. dracoMenghai (1; 2016), Yuanmou (3; 2016)0/4 (0%)
MusM. musculusLianghe (12; 2016), Yiliang (2; 2016), Zhaoyang (3; 2016), Weixin (4; 2016), Xiangyun (1; 2016), Mengla (1; 2016), Xiangyun (12; 2017), Yuanjiang (5; 2017), Ruili (17; 2017),0/57 (0%)
M. pahariLianghe (3; 2016), Yiliang (12; 2016), Yuanmou (1; 2016),0/16 (0%)
M. caroliLianghe (1; 2016), Yiliang (26; 2016), Yuanmou (1; 2016), Xiangyun (10; 2017), Yuanjiang (11; 2017)0/49 (0%)
RattusR. sladeniLianghe (4; 2016), Menghai (3; 2016), Yuanmou (6; 2016), Yuanjiang (11; 2017), Ruili (8; 2017), Nanjian (1; 2017)0/33 (0%)
R. norvegicusYiliang (8; 2016), Zhaoyang (6; 2016), Luxi (202; 2016), Xiangyun (21; 2016), Yuanmou (19; 2016), Xiangyun (32; 2017), Yuanjiang (10; 2017), Luxi (82; 2017), Yuanjiang (11; 2017), Yuanmou (58; 2017)0/449 (0%)
R. rattusLianghe (3; 2016), Ruili (1; 2017)0/4 (0%)
R. tanezumi TemminckLianghe (73; 2016), Yiliang (12; 2016), Zhaoyang (2; 2016), Weixin (19; 2016), Xiangyun (11; 2016), Mengla (26; 2016), Menghai (91; 2016), Yuanmou (10; 2016), Xiangyun (110; 2017), Yuanjiang (42; 2017), Ruili (76; 2017), Luxi (4; 2017), Yuanjiang (3; 2017), Yuanmou (3; 2017), Nanjian (7; 2017)0/489 (0%)
R. nitidusYiliang (1; 2016), Zhaoyang (1; 2016), Weixin (2; 2016), Menghai (1; 2016)0/5 (0%)
R. yunnanensisWeixin (5; 2016), Mengla (5; 2016), Yuanmou (7; 2016), Yuanmou (4; 2017)0/21 (0%)
Niviventer
N. fulvescensLianghe (1; 2016), Ruili (1; 2017), Nanjian (1; 2017)0/3 (0%)
N. niviventerLianghe (3; 2016), Yiliang (3; 2016), Xiangyun (2; 2017), Ruili (2; 2017), Yuanmou (1; 2017)0/11 (0%)
BandicotaB. indicaLianghe (1; 2016), Yuanjiang (1; 2017), Ruili (22; 2017), Ruili (12; 2017)0/36 (0%)
MicromysM. minutusYiliang (1; 2016), Luxi (1; 2016)0/2 (0%)
EulipotyphlaSoricidaeCrociduraC. fuliginosaZhaoyang (3; 2016), Weixin (1; 2016), Menghai (1; 2016), Yuanmou (4; 2016), Xiangyun (1; 2017), Yuanjiang (2; 2017), Yuanmou (1; 2017), Nanjian (3; 2017)2/16 (12.5%)
AnourosorexA. squamipesZhaoyang (1; 2016), Weixin (17; 2016), Luxi (12; 2016), Ruili (4; 2017), Luxi (13; 2017), Nanjian (8; 2017)0/55 (0%)
SorexS. araneusLianghe (15; 2016), Xiangyun (2; 2016), Mengla (2; 2016), Menghai (4; 2016), Xiangyun (7; 2017), Ruili (9; 2017)0/39 (0%)
ScandentiaTupaiidaeTupaiaT. belangeriLianghe (1; 2016), Yuanmou (3; 2016), Ruili (1; 2017), Xiangyun (1; 2017), Yuanjiang (1; 2017), Yuanmou (5; 2017)0/12 (0%)
Total 2/1604 (0.12%)
* P/D is the number of positive samples/sample size.
Table 2. The p-distance values of pp 996–1437 and pp 2693–3115 and sequence similarity in the ORF region of Hepacivirus Cf/NJ12 compared with those of other hepaciviruses.
Table 2. The p-distance values of pp 996–1437 and pp 2693–3115 and sequence similarity in the ORF region of Hepacivirus Cf/NJ12 compared with those of other hepaciviruses.
Virus StrainsGenBank No.Sequence Similarity
(nt/aa)		p-Distance Values
pp 996–1437pp 2693–3115
Hepacivirus equi (A)KP325401.10.326/0.2140.5570.568
Hepacivirus platyrrhini (B)U22304.10.357/0.2760.5490.483
Hepatitis hominis (C) AF009606.10.347/0.2060.5770.584
Hepacivirus colobi (D)KC551800.10.303/0.260.5340.511
Hepacivirus peromysci (E)KC815310.10.368/0.3110.5430.451
Hepacivirus myodae (F)KC411784.10.377/0.3090.5480.439
Hepacivirus ratti (G)KJ950938.10.367/0.3020.5180.464
Hepacivirus norvegici (H)KJ950939.10.374/0.3050.5340.474
Hepacivirus rhabdomysis (I)KC411806.10.355/0.2760.5730.479
Hepacivirus glareoli (J)KC411777.10.359/0.2340.5900.546
Hepacivirus macronycteridis (K)KC796074.10.341/0.2210.5680.566
Hepacivirus vittatae (L)KC796077.10.365/0.2870.5240.508
Hepacivirus otomopis (M)KC796078.10.335/0.2280.5450.580
Hepacivirus bovis (N)KP641127.20.353/0.2540.5440.526
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Guo, L.; Li, B.; Han, P.; Dong, N.; Zhu, Y.; Li, F.; Si, H.; Shi, Z.; Wang, B.; Yang, X.; et al. Identification of a Novel Hepacivirus in Southeast Asian Shrew (Crocidura fuliginosa) from Yunnan Province, China. Pathogens 2023, 12, 1400. https://doi.org/10.3390/pathogens12121400

AMA Style

Guo L, Li B, Han P, Dong N, Zhu Y, Li F, Si H, Shi Z, Wang B, Yang X, et al. Identification of a Novel Hepacivirus in Southeast Asian Shrew (Crocidura fuliginosa) from Yunnan Province, China. Pathogens. 2023; 12(12):1400. https://doi.org/10.3390/pathogens12121400

Chicago/Turabian Style

Guo, Ling, Bei Li, Peiyu Han, Na Dong, Yan Zhu, Fuli Li, Haorui Si, Zhengli Shi, Bo Wang, Xinglou Yang, and et al. 2023. "Identification of a Novel Hepacivirus in Southeast Asian Shrew (Crocidura fuliginosa) from Yunnan Province, China" Pathogens 12, no. 12: 1400. https://doi.org/10.3390/pathogens12121400

APA Style

Guo, L., Li, B., Han, P., Dong, N., Zhu, Y., Li, F., Si, H., Shi, Z., Wang, B., Yang, X., & Zhang, Y. (2023). Identification of a Novel Hepacivirus in Southeast Asian Shrew (Crocidura fuliginosa) from Yunnan Province, China. Pathogens, 12(12), 1400. https://doi.org/10.3390/pathogens12121400

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop