Laboratory Validation of a Real-Time RT-PCR Assay for the Detection of Jamestown Canyon Virus
Abstract
:1. Introduction
2. Results
2.1. Evaluation of the JCV Real-Time RT-PCR Primers and Probes
2.2. Analytical Specificity
2.3. Clinical Sensitivity
2.4. Mosquito Pool Testing
3. Discussion
4. Materials and Methods
4.1. Primers and Probes
4.2. Viruses and RNA
4.3. Standardization of JCV Real-Time RT-PCR:
4.4. Standard Preparation for JCV Real-Time RT-PCR Assay
4.5. Determination of Analytical Performance
4.6. Clinical Analysis
4.7. Mosquito Pool Testing
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Pastula, D.M.; Smith, D.E.; Beckham, J.D.; Tyler, K.L. Four emerging arboviral diseases in North America: Jamestown Canyon, Powassan, chikungunya, and Zika virus diseases. J. Neurovirol. 2016, 22, 257–260. [Google Scholar] [CrossRef]
- Campbell, G.L.; Eldridge, B.F.; Reeves, W.C.; Hardy, J.L. Isolation of Jamestown Canyon virus from boreal Aedes mosquitoes from the Sierra Nevada of California. Am. J. Trop. Med. Hyg. 1991, 44, 244–249. [Google Scholar] [CrossRef]
- Andreadis, T.G.; Anderson, J.F.; Armstrong, P.M.; Main, A.J. Isolations of Jamestown Canyon virus (Bunyaviridae: Orthobunyavirus) from field-collected mosquitoes (Diptera: Culicidae) in Connecticut, USA: A ten-year analysis, 1997–2006. Vector Borne Zoonotic Dis. 2008, 8, 175–188. [Google Scholar] [CrossRef] [Green Version]
- Boromisa, R.D.; Grimstad, P.R. Seroconversion rates to Jamestown Canyon virus among six populations of white-tailed deer (Odocoileus virginianus) in Indiana. J. Wildl. Dis. 1987, 23, 23–33. [Google Scholar] [CrossRef] [Green Version]
- Fulhorst, C.F.; Hardy, J.L.; Eldridge, B.F.; Chiles, R.E.; Reeves, W.C. Ecology of Jamestown Canyon virus (Bunyaviridae: California serogroup) in coastal California. Am. J. Trop. Med. Hyg. 1996, 55, 185–189. [Google Scholar] [CrossRef]
- Zarnke, R.L.; Calisher, C.H.; Kerschner, J. Serologic evidence of arbovirus infections in humans and wild animals in Alaska. J. Wildl. Dis. 1983, 19, 175–179. [Google Scholar] [CrossRef]
- Calisher, C.H. The Bunyaviridae; Plenum Press: New York, NY, USA, 1996. [Google Scholar]
- Hughes, H.R.; Adkins, S.; Alkhovskiy, S.; Beer, M.; Blair, C.; Calisher, C.H.; Drebot, M.; Lambert, A.J.; de Souza, W.M.; Marklewitz, M.; et al. ICTV Virus Taxonomy Profile: Peribunyaviridae. J. Gen. Virol. 2020, 101, 1–2. [Google Scholar] [CrossRef]
- Rust, R.S.; Thompson, W.H.; Matthews, C.G.; Beaty, B.J.; Chun, R.W. La Crosse and other forms of California encephalitis. J. Child. Neurol. 1999, 14, 1–14. [Google Scholar] [CrossRef]
- Pastula, D.M.; Hoang Johnson, D.K.; White, J.L.; Dupuis, A.P., 2nd; Fischer, M.; Staples, J.E. Jamestown Canyon Virus Disease in the United States-2000–2013. Am. J. Trop. Med. Hyg. 2015, 93, 384–389. [Google Scholar] [CrossRef] [Green Version]
- Grimstad, P.R.; Shabino, C.L.; Calisher, C.H.; Waldman, R.J. A case of encephalitis in a human associated with a serologic rise to Jamestown Canyon virus. Am. J. Trop. Med. Hyg. 1982, 31, 1238–1244. [Google Scholar] [CrossRef]
- Solomon, I.H.; Ganesh, V.S.; Yu, G.; Deng, X.D.; Wilson, M.R.; Miller, S.; Milligan, T.A.; Mukerji, S.S.; Mathewson, A.; Linxweiler, J.; et al. Fatal Case of Chronic Jamestown Canyon Virus Encephalitis Diagnosed by Metagenomic Sequencing in Patient Receiving Rituximab. Emerg. Infect. Dis. 2021, 27, 238–242. [Google Scholar] [CrossRef]
- Vahey, G.M.; Mathis, S.; Martin, S.W.; Gould, C.V.; Staples, J.E.; Lindsey, N.P. West Nile Virus and Other Domestic Nationally Notifiable Arboviral Diseases—United States, 2019. MMWR Morb. Mortal. Wkly Rep. 2021, 70, 1069–1074. [Google Scholar] [CrossRef]
- Matkovic, E.; Hoang Johnson, D.K.; Staples, J.E.; Mora-Pinzon, M.C.; Elbadawi, L.I.; Osborn, R.A.; Warshauer, D.M.; Wegner, M.V.; Davis, J.P. Enhanced Arboviral Surveillance to Increase Detection of Jamestown Canyon Virus Infections, Wisconsin, 2011–2016. Am. J. Trop. Med. Hyg. 2019, 100, 445–451. [Google Scholar] [CrossRef] [Green Version]
- Curren, E.J.; Lehman, J.; Kolsin, J.; Walker, W.L.; Martin, S.W.; Staples, J.E.; Hills, S.L.; Gould, C.V.; Rabe, I.B.; Fischer, M.; et al. West Nile Virus and Other Nationally Notifiable Arboviral Diseases—United States, 2017. MMWR Morb. Mortal. Wkly Rep. 2018, 67, 1137–1142. [Google Scholar] [CrossRef]
- Mayo, D.; Karabatsos, N.; Scarano, F.J.; Brennan, T.; Buck, D.; Fiorentino, T.; Mennone, J.; Tran, S. Jamestown Canyon virus: Seroprevalence in Connecticut. Emerg. Infect. Dis. 2001, 7, 911–912. [Google Scholar] [CrossRef]
- Kinsella, C.M.; Paras, M.L.; Smole, S.; Mehta, S.; Ganesh, V.; Chen, L.H.; McQuillen, D.P.; Shah, R.; Chan, J.; Osborne, M.; et al. Jamestown Canyon virus in Massachusetts: Clinical case series and vector screening. Emerg. Microbes Infect. 2020, 9, 903–912. [Google Scholar] [CrossRef] [Green Version]
- Solomon, I.H.; Spera, K.M.; Ryan, S.L.; Helgager, J.; Andrici, J.; Zaki, S.R.; Vaitkevicius, H.; Leon, K.E.; Wilson, M.R.; DeRisi, J.L.; et al. Fatal Powassan Encephalitis (Deer Tick Virus, Lineage II) in a Patient with Fever and Orchitis Receiving Rituximab. JAMA Neurol. 2018, 75, 746–750. [Google Scholar] [CrossRef] [Green Version]
- Hughes, H.R.; Velez, J.O.; Davis, E.H.; Laven, J.; Gould, C.V.; Panella, A.J.; Lambert, A.J.; Staples, J.E.; Brault, A.C. Fatal Human Infection with Evidence of Intrahost Variation of Eastern Equine Encephalitis Virus, Alabama, USA, 2019. Emerg. Infect. Dis. 2021, 27, 1886–1892. [Google Scholar] [CrossRef]
- Solomon, I.H.; Ciarlini, P.; Santagata, S.; Ahmed, A.A.; De Girolami, U.; Prasad, S.; Mukerji, S.S. Fatal Eastern Equine Encephalitis in a Patient on Maintenance Rituximab: A Case Report. Open Forum Infect. Dis. 2017, 4, ofx021. [Google Scholar] [CrossRef] [Green Version]
- Armstrong, P.M.; Andreadis, T.G. Genetic relationships of Jamestown Canyon virus strains infecting mosquitoes collected in Connecticut. Am. J. Trop. Med. Hyg. 2007, 77, 1157–1162. [Google Scholar] [CrossRef]
- Gill, C.M.; Beckham, J.D.; Piquet, A.L.; Tyler, K.L.; Pastula, D.M. Five Emerging Neuroinvasive Arboviral Diseases: Cache Valley, Eastern Equine Encephalitis, Jamestown Canyon, Powassan, and Usutu. Semin. Neurol. 2019, 39, 419–427. [Google Scholar] [CrossRef]
- Bowen, M.D.; Jackson, A.O.; Bruns, T.D.; Hacker, D.L.; Hardy, J.L. Determination and comparative analysis of the small RNA genomic sequences of California encephalitis, Jamestown Canyon, Jerry Slough, Melao, Keystone and Trivittatus viruses (Bunyaviridae, genus Bunyavirus, California serogroup). J. Gen. Virol. 1995, 76 Pt 3, 559–572. [Google Scholar] [CrossRef]
- Campbell, W.P.; Huang, C. Sequence comparisons of medium RNA segment among 15 California serogroup viruses. Virus Res. 1999, 61, 137–144. [Google Scholar] [CrossRef]
- Hughes, H.R.; Lanciotti, R.S.; Blair, C.D.; Lambert, A.J. Full genomic characterization of California serogroup viruses, genus Orthobunyavirus, family Peribunyaviridae including phylogenetic relationships. Virology 2017, 512, 201–210. [Google Scholar] [CrossRef]
- Levin, J.G.; Ramseur, J.M.; Grimley, P.M. Host effect on arbovirus replication: Appearance of defective interfering particles in murine cells. J. Virol. 1973, 12, 1401–1406. [Google Scholar] [CrossRef] [Green Version]
- Lednicky, J.A.; White, S.K.; Stephenson, C.J.; Cherabuddi, K.; Loeb, J.C.; Moussatche, N.; Lednicky, A.; Morris, J.G., Jr. Keystone Virus Isolated from a Florida Teenager with Rash and Subjective Fever: Another Endemic Arbovirus in the Southeastern United States? Clin. Infect. Dis. 2019, 68, 143–145. [Google Scholar] [CrossRef]
- Watts, D.M.; Bailey, C.L.; Roberts, N.T.; RF, T.A.; Dalrymple, J.M.; Clark, G.C. Maintenance and transmission of Keystone virus by Aedes atlanticus (Diptera: Culicidae) and the gray squirrel in the Pocomoke Cypress Swamp, Maryland. J. Med. Entomol. 1988, 25, 493–500. [Google Scholar] [CrossRef]
- Evans, A.B.; Peterson, K.E. Throw out the Map: Neuropathogenesis of the Globally Expanding California Serogroup of Orthobunyaviruses. Viruses 2019, 11, 794. [Google Scholar] [CrossRef] [Green Version]
- Bennett, R.S.; Nelson, J.T.; Gresko, A.K.; Murphy, B.R.; Whitehead, S.S. The full genome sequence of three strains of Jamestown Canyon virus and their pathogenesis in mice or monkeys. Virol. J. 2011, 8, 136. [Google Scholar] [CrossRef] [Green Version]
- Harris, M.C.; Yang, F.; Jackson, D.M.; Dotseth, E.J.; Paulson, S.L.; Hawley, D.M. La Crosse Virus Field Detection and Vector Competence of Culex Mosquitoes. Am. J. Trop. Med. Hyg. 2015, 93, 461–467. [Google Scholar] [CrossRef] [Green Version]
- Lambert, A.J.; Lanciotti, R.S. Molecular characterization of medically important viruses of the genus Orthobunyavirus. J. Gen. Virol. 2008, 89 Pt 10, 2580–2585. [Google Scholar] [CrossRef]
- Savage, H.M.; Ledermann, J.P.; Yug, L.; Burkhalter, K.L.; Marfel, M.; Hancock, W.T. Incrimination of Aedes (Stegomyia) hensilli Farner as an epidemic vector of Chikungunya virus on Yap Island, Federated States of Micronesia, 2013. Am. J. Trop. Med. Hyg. 2015, 92, 429–436. [Google Scholar] [CrossRef] [Green Version]
Primer Name 1 | Sequence 5′–3′ | Limit of Detection (95% Confidence) | |
---|---|---|---|
Plaque Forming Units/mL | Genomic Equivalents/µL | ||
JCV174 | CAGTCTGTCAGCCGTTAGGA | 6.5 (7.9–5.2) | ND 2 |
JCV269c | AATTTCCACCTGCCACTCTC | ||
JCV231cFAM | TCCGCTCCGGTTTACGAGCG | ||
JCV102 | ATCCACAGGTGCAAATGGA | 0.8 (1.17–0.51) | 7.19 (7.21–7.17) |
JCV201c | GAAGAAGATCCTAACGGCTGMC | ||
JCV132FAM | TGCAGGGTTTGTGGCATTTATGGC | ||
JCV58 | GCATACTTGGTTGATATGGGAGA | 0.9 (1.2–0.5) | ND |
JCV155c | GCCATAAATGCCACAAACCC | ||
JCV95FAM | ATGTCGCATCCACAGGTGCAAATG |
Virus Species | Virus Name | Isolate | Location | Year | Average Cycle Threshold (Ct) 1 | ||
---|---|---|---|---|---|---|---|
JCV 132FAM | JCV 95FAM | JCV 231cFAM | |||||
Jamestown canyon orthobunyavirus | Jamestown Canyon | 61V2235 | Colorado, USA | 1961 | 18.2 | 20.7 | 23.1 |
L36708 (lineage A) | Connecticut, USA | 1966 | 18.1 | 18.7 | 23.1 | ||
MN256-260 | Manitoba, Canada | 1979 | 17.2 | 17.4 | 18.6 | ||
1262-98 (lineage B1) | Connecticut, USA | 1998 | 20.8 | 23.3 | 26.3 | ||
515-99 (lineage A) | Connecticut, USA | 1999 | 19.2 | 20.9 | 21.4 | ||
4473-00 (lineage B2) | Connecticut, USA | 2000 | 21.2 | 22.5 | 26.4 | ||
1425-02 (lineage B1) | Connecticut, USA | 2002 | 21.1 | 22.3 | 25.1 | ||
4148-03 (lineage B2) | Connecticut, USA | 2003 | 20.2 | 24.0 | 27.1 | ||
11497-03 (lineage A) | Connecticut, USA | 2003 | 19.4 | 22.1 | 22.7 | ||
1441-04 (lineage B1) | Connecticut, USA | 2004 | 20.1 | 21.2 | 24.1 | ||
3836-05 (lineage A) | Connecticut, USA | 2005 | 19.0 | 20.7 | 21.6 | ||
NM5-4BU | New Mexico, USA | 1977 | 21.0 | 23.5 | 25.0 | ||
Jerry Slough | BFS4474 | California, USA | 1963 | 21.0 | 23.3 | 25.8 | |
Inkoo | KN3641 | Jukon, Finland | 1964 | 18.1 | 21.4 | 26.2 | |
South River | NJO-94F | New Jersey, USA | 1960 | 13.4 | 15.2 | 17.8 | |
Keystone orthobunyavirus | Keystone | B64-5587.05 | Florida, USA | 1964 | 23.8 | 35.5 | 27.2 |
Serra do Navio orthobunyavirus | Serra do Navio | BeAr 103645 | Amapa, Brazil | 1966 | 34.5 | 29.0 | Negative |
Melao orthobunyavirus | Melao | TRVL 9375 | Trinidad | 1955 | Negative | 37.03 | Negative |
California encephalitis orthobunyavirus | California encephalitis | BFS 283 | California, USA | 1943 | Negative | Negative | Negative |
La Crosse orthobunyavirus | La Crosse | Original (Human/1960) | Wisconsin, USA | 1960 | Negative | Negative | Negative |
snowshoe hare orthobunyavirus | snowshoe hare | Original (Montana 1959) | Montana, USA | 1959 | Negative | Negative | Negative |
Average Cycle threshold (Ct) 2 | |||
---|---|---|---|
Mosquito Pool 1 | JCV132FAM | JCV95FAM | JCV231cFAM |
6 log10 PFU/mL | 18.4 | 19.2 | 19.9 |
5 log10 PFU/mL | 22.5 | 23.0 | 24.1 |
4 log10 PFU/mL | 24.8 | 25.9 | 26.2 |
Negative pool | Negative | Negative | Negative |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hughes, H.R.; Kenney, J.L.; Russell, B.J.; Lambert, A.J. Laboratory Validation of a Real-Time RT-PCR Assay for the Detection of Jamestown Canyon Virus. Pathogens 2022, 11, 536. https://doi.org/10.3390/pathogens11050536
Hughes HR, Kenney JL, Russell BJ, Lambert AJ. Laboratory Validation of a Real-Time RT-PCR Assay for the Detection of Jamestown Canyon Virus. Pathogens. 2022; 11(5):536. https://doi.org/10.3390/pathogens11050536
Chicago/Turabian StyleHughes, Holly R., Joan L. Kenney, Brandy J. Russell, and Amy J. Lambert. 2022. "Laboratory Validation of a Real-Time RT-PCR Assay for the Detection of Jamestown Canyon Virus" Pathogens 11, no. 5: 536. https://doi.org/10.3390/pathogens11050536
APA StyleHughes, H. R., Kenney, J. L., Russell, B. J., & Lambert, A. J. (2022). Laboratory Validation of a Real-Time RT-PCR Assay for the Detection of Jamestown Canyon Virus. Pathogens, 11(5), 536. https://doi.org/10.3390/pathogens11050536