Detection of Periodontal Pathogens from Dental Plaques of Dogs with and without Periodontal Disease
Abstract
1. Introduction
2. Results
2.1. Study Population
2.2. Molecular Analysis
3. Discussion
4. Materials and Methods
4.1. Animals and Sampling
4.2. DNA Extraction
4.3. PCR Assay
4.4. Sequencing and Data Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Stella, J.L.; Bauer, A.E.; Croney, C.C. A cross-sectional study to estimate prevalence of periodontal disease in a population of dogs (Canis familiaris) in commercial breeding facilities in Indiana and Illinois. PLoS ONE 2018, 13, e0191395. [Google Scholar] [CrossRef]
- Garanayak, N.; Das, M.; Patra, R.C.; Biswal, S.; Panda, S.K. Effect of age on dental plaque deposition and its control by ultrasonic scaling, dental hygiene chew, and chlorhexidine (0.2% w/v) in dogs. Vet. World 2019, 12, 1872–1876. [Google Scholar] [CrossRef] [PubMed]
- Riggio, M.P.; Lennon, A.; Taylor, D.J.; Bennett, D. Molecular identification of bacteria associated with canine periodontal disease. Vet. Microbiol. 2011, 150, 394–400. [Google Scholar] [CrossRef]
- Marshall, M.D.; Wallis, C.V.; Milella, L.; Colyer, A.; Tweedie, A.D.; Harris, S. A longitudinal assessment of periodontal disease in 52 Miniature Schnauzers. BMC Vet. Res. 2014, 10, 166. [Google Scholar] [CrossRef]
- Harvey, C.E.; Laster, L.; Shofer, F.; Miller, B. Scoring the full extent of periodontal disease in the dog: Development of a total mouth periodontal score (TMPS) system. J. Vet. Dent. 2008, 25, 176–180. [Google Scholar] [CrossRef] [PubMed]
- Albuquerque, C.; Morinha, F.; Requicha, J.; Martins, T.; Dias, I.; Guedes-Pinto, H.; Bastos, E.; Viegas, C. Canine periodontitis: The dog as an important model for periodontal studies. Vet. J. 2012, 191, 299–305. [Google Scholar] [CrossRef] [PubMed]
- Shaikh, H.F.M.; Patil, S.H.; Pangam, T.S.; Rathod, K.V. Polymicrobial synergy and dysbiosis: An overview. J. Indian Soc. Periodontol. 2018, 22, 101–106. [Google Scholar] [CrossRef]
- Hajishengallis, G.; Kajikawa, T.; Hajishengallis, E.; Maekawa, T.; Reis, E.S.; Mastellos, D.C.; Yancopoulou, D.; Hasturk, H.; Lambris, J.D. Complement-Dependent Mechanisms and Interventions in Periodontal Disease. Front. Immunol. 2019, 10, 406. [Google Scholar] [CrossRef]
- Mohanty, R.; Asopa, S.J.; Joseph, M.D.; Singh, B.; Rajguru, J.P.; Saidath, K.; Sharma, U. Red complex: Polymicrobial conglomerate in oral flora: A review. J. Family Med. Prim. Care 2019, 8, 3480–3486. [Google Scholar] [CrossRef]
- Lenzo, J.C.; O’Brien-Simpson, N.M.; Orth, R.K.; Mitchell, H.L.; Dashper, S.G.; Reynolds, E.C. Porphyromonas gulae Has Virulence and Immunological Characteristics Similar to Those of the Human Periodontal Pathogen Porphyromonas gingivalis. Infect. Immun. 2016, 84, 2575–2585. [Google Scholar] [CrossRef]
- Nises, J.; Rosander, A.; Pettersson, A.; Backhans, A. The occurrence of Treponema spp. in gingival plaque from dogs with varying degree of periodontal disease. PLoS ONE 2018, 13, e0201888. [Google Scholar] [CrossRef] [PubMed]
- Dashper, S.G.; Seers, C.A.; Tan, K.H.; Reynolds, E.C. Virulence factors of the oral spirochete Treponema denticola. J. Dent. Res. 2011, 90, 691–703. [Google Scholar] [CrossRef] [PubMed]
- Nordhoff, M.; Rühe, B.; Kellermeier, C.; Moter, A.; Schmitz, R.; Brunnberg, L.; Wieler, L.H. Association of Treponema spp. with canine periodontitis. Vet. Microbiol. 2008, 127, 334–342. [Google Scholar] [CrossRef]
- Malinowski, B.; Węsierska, A.; Zalewska, K.; Sokołowska, M.M.; Bursiewicz, W.; Socha, M.; Ozorowski, M.; Pawlak-Osińska, K.; Wiciński, M. The role of Tannerella forsythia and Porphyromonas gingivalis in pathogenesis of esophageal cancer. Infect. Agent. Cancer 2019, 14, 3. [Google Scholar] [CrossRef] [PubMed]
- Kato, Y.; Shirai, M.; Murakami, M.; Mizusawa, T.; Hagimoto, A.; Wada, K.; Nomura, R.; Nakano, K.; Ooshima, T.; Asai, F. Molecular detection of human periodontal pathogens in oral swab specimens from dogs in Japan. J. Vet. Dent. 2011, 28, 84–89. [Google Scholar] [CrossRef] [PubMed]
- Gołyńska, M.; Polkowska, I.; Bartoszcze-Tomaszewska, M.; Sobczyńska-Rak, A.; Matuszewski, Ł. Molecular-level evaluation of selected periodontal pathogens from subgingival regions in canines and humans with periodontal disease. J. Vet. Sci. 2017, 18, 51–58. [Google Scholar] [CrossRef] [PubMed]
- Butera, A.; Gallo, S.; Maiorani, C.; Molino, D.; Chiesa, A.; Preda, C.; Esposito, F.; Scribante, A. Probiotic Alternative to Chlorhexidine in Periodontal Therapy: Evaluation of Clinical and Microbiological Parameters. Microorganisms 2021, 9, 69. [Google Scholar] [CrossRef] [PubMed]
- Niemec, B.A. Periodontal Therapy in Small and Toy Breed Dogs. In Breed Predispositions to Dental and Oral Disease in Dogs; Wiley-Blackwell: San Diego, CA, USA, 2021; pp. 157–178. [Google Scholar]
- Oba, P.M.; Carroll, M.Q.; Alexander, C.; Somrak, A.J.; Keating, S.; Sage, A.M.; Swanson, K.S. Dental chews positively shift the oral microbiota of adult dogs. J. Anim. Sci. 2021, 99, skab100. [Google Scholar] [CrossRef]
- Özavci, V.; Erbas, G.; Parin, U.; Yüksel, H.T.; Kirkan, Ş. Molecular detection of feline and canine periodontal pathogens. Vet. Anim. Sci. 2019, 8, 100069. [Google Scholar] [CrossRef]
- Senhorinho, G.N.; Nakano, V.; Liu, C.; Song, Y.; Finegold, S.M.; Avila-Campos, M.J. Detection of Porphyromonas gulae from subgingival biofilms of dogs with and without periodontitis. Anaerobe 2011, 17, 257–258. [Google Scholar] [CrossRef]
- Yamasaki, Y.; Nomura, R.; Nakano, K.; Naka, S.; Matsumoto-Nakano, M.; Asai, F.; Ooshima, T. Distribution of periodontopathic bacterial species in dogs and their owners. Arch. Oral Biol. 2012, 57, 1183–1188. [Google Scholar] [CrossRef] [PubMed]
- Di Bello, A.; Buonavoglia, A.; Franchini, D.; Valastro, C.; Ventrella, G.; Greco, M.F.; Corrente, M. Periodontal disease associated with red complex bacteria in dogs. J. Small Anim. Pract. 2014, 55, 160–163. [Google Scholar] [CrossRef] [PubMed]
- You, M.; Mo, S.; Leung, W.K.; Watt, R.M. Comparative analysis of oral treponemes associated with periodontal health and disease. BMC Infect. Dis. 2013, 13, 174. [Google Scholar] [CrossRef] [PubMed]
- Valdez, M.; Haines, R.; Riviere, K.H.; Riviere, G.R.; Thomas, D.D. Isolation of oral spirochetes from dogs and cats and provisional identification using polymerase chain reaction (PCR) analysis specific for human plaque Treponema spp. J. Vet. Dent. 2000, 17, 23–26. [Google Scholar] [PubMed]
- Evans, N.J.; Brown, J.M.; Demirkan, I.; Murray, R.D.; Vink, W.D.; Blowey, R.W.; Hart, C.A.; Carter, S.D. Three unique groups of spirochetes isolated from digital dermatitis lesions in UK cattle. Vet. Microbiol. 2008, 130, 141–150. [Google Scholar] [CrossRef]
- Brandt, S.; Apprich, V.; Hackl, V.; Tober, R.; Danzer, M.; Kainzbauer, C.; Gabriel, C.; Stanek, C.; Kofler, J. Prevalence of bovine papillomavirus and Treponema DNA in bovine digital dermatitis lesions. Vet. Microbiol. 2011, 148, 161–167. [Google Scholar] [CrossRef]
- Nishiyama, S.A.B.; Senhorinho, G.N.; Gioso, M.A.; Avila-Campos, M.J. Detection of putative periodontal pathogens in subgingival specimens of dogs. Braz. J. Microbiol. 2007, 38, 23–28. [Google Scholar] [CrossRef][Green Version]
- Lacap-Bugler, D.C.; Jiang, J.; Huo, Y.B.; Chan, Y.; Leung, F.C.; Watt, R.M. Complete Genome Sequence of the Oral Spirochete Bacterium Treponema putidum Strain OMZ 758T (ATCC 700334T). Genome Announc. 2014, 2, e01076-14. [Google Scholar] [CrossRef]
- Wyss, C.; Moter, A.; Choi, B.K.; Dewhirst, F.E.; Xue, Y.; Schüpbach, P.; Göbel, U.B.; Paster, B.J.; Guggenheim, B. Treponema putidum sp. nov., a medium-sized proteolytic spirochaete isolated from lesions of human periodontitis and acute necrotizing ulcerative gingivitis. Int. J. Syst. Evol. Microbiol. 2004, 54, 1117–1122. [Google Scholar] [CrossRef][Green Version]
- Bauer, A.E.; Stella, J.; Lemmons, M.; Croney, C.C. Evaluating the validity and reliability of a visual dental scale for detection of periodontal disease (PD) in non-anesthetized dogs (Canis familiaris). PLoS ONE 2018, 13, e0203930. [Google Scholar] [CrossRef]
- Vesty, A.; Biswas, K.; Taylor, M.W.; Gear, K.; Douglas, R.G. Evaluating the Impact of DNA Extraction Method on the Representation of Human Oral Bacterial and Fungal Communities. PLoS ONE 2017, 12, e0169877. [Google Scholar] [CrossRef] [PubMed]
- Aas, J.A.; Paster, B.J.; Stokes, L.N.; Olsen, I.; Dewhirst, F.E. Defining the normal bacterial flora of the oral cavity. J. Clin. Microbiol. 2005, 43, 5721–5732. [Google Scholar] [CrossRef] [PubMed]
- Huang, Q.; Baum, L.; Fu, W.L. Simple and practical staining of DNA with GelRed in agarose gel electrophoresis. Clin. Lab. 2010, 56, 149–152. [Google Scholar] [PubMed]
- Bankur, P.K.; Nayak, A.; Bhat, K.; Bankur, R.; Naik, R.; Rajpoot, N. Comparison of culture and polymerase chain reaction techniques in the identification of Tannerella forsythia in periodontal health and disease, an in vitro study. J. Indian Soc. Periodontol. 2014, 18, 155–160. [Google Scholar] [CrossRef] [PubMed]
Dog | Breed | Age (Years) | Sex | Periodontal Status |
---|---|---|---|---|
1 | Jack Russell Terrier | 14 | ♂ | Periodontal disease |
2 | Yorkshire Terrier | 6 | ♀ | Periodontal disease |
3 | Maltese | 8 | ♀ | Periodontal disease |
4 | Maltese | 3 | ♀ | Periodontal disease |
5 | Prague Ratter | 11 | ♂ | Periodontal disease |
6 | Chihuahua | 9 | ♂ | Periodontal disease |
7 | Labrador Retriever | 10 | ♀ | Periodontal disease |
8 | German shepherd | 1 | ♀ | Healthy |
9 | German shepherd | 1 | ♀ | Healthy |
10 | German shepherd | 1 | ♀ | Healthy |
11 | German shepherd | 1 | ♀ | Healthy |
12 | German shepherd | 1 | ♀ | Healthy |
13 | German shepherd | 1 | ♂ | Healthy |
14 | German shepherd | 1 | ♂ | Healthy |
Periodontal Disease Group | Healthy Group | ||||||||
---|---|---|---|---|---|---|---|---|---|
Dog | P. g. | T. f. | T. d. | T. p. | Dog | P. g. | T. f. | T. d. | T. p. |
1 | + | + | 8 | + | + | + | |||
2 | + | + | + | 9 | + | ||||
3 | + | + | + | 10 | + | + | + | ||
4 | + | + | 11 | + | + | + | |||
5 | + | + | + | 12 | + | + | + | ||
6 | + | + | + | 13 | + | ||||
7 | + | + | + | 14 | + | + |
Species (Gene) | Primer Sequence (5′ to 3′) | PCR Conditions | Length (bp) | Source |
---|---|---|---|---|
Porphyromonas gulae (fragment of 16S rRNA gene) | TTGGTTGCATGATCGGG | 94 °C 5 min, 35× [94 °C 30 s, 58 °C 1 min, 72 °C 30 s] 72 °C 5 min | 300 | [21] |
GCTTATTCTTACGGTACATTCAYA | ||||
Tannerella forsythia (fragment of 16S rRNA gene) | GCGTATGTAACCTGCCCGCA | 95 °C 2 min, 36× [95 °C 30 s, 60 °C 1 min, 72 °C 1 min] 72 °C 2 min | 641 | [35] |
TGCTTCAGTGTCAGTTATACCT | ||||
Treponema denticola (flaB2 gene) | ACGGYATTTCYTTTATTCAAGTTGC | 94 °C 5 min, 45× [94 °C 30 s, 63 °C 30 s, 72 °C 40 s] 72 °C 5 min | 471 | [27] |
CGAGTCTGTTYTGGTATGCACC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kačírová, J.; Sondorová, M.; Maďari, A.; Styková, E.; Mucha, R.; Nemcová, R.; Marečáková, N.; Farbáková, J.; Maďar, M. Detection of Periodontal Pathogens from Dental Plaques of Dogs with and without Periodontal Disease. Pathogens 2022, 11, 480. https://doi.org/10.3390/pathogens11040480
Kačírová J, Sondorová M, Maďari A, Styková E, Mucha R, Nemcová R, Marečáková N, Farbáková J, Maďar M. Detection of Periodontal Pathogens from Dental Plaques of Dogs with and without Periodontal Disease. Pathogens. 2022; 11(4):480. https://doi.org/10.3390/pathogens11040480
Chicago/Turabian StyleKačírová, Jana, Miriam Sondorová, Aladár Maďari, Eva Styková, Rastislav Mucha, Radomíra Nemcová, Nikola Marečáková, Jana Farbáková, and Marián Maďar. 2022. "Detection of Periodontal Pathogens from Dental Plaques of Dogs with and without Periodontal Disease" Pathogens 11, no. 4: 480. https://doi.org/10.3390/pathogens11040480
APA StyleKačírová, J., Sondorová, M., Maďari, A., Styková, E., Mucha, R., Nemcová, R., Marečáková, N., Farbáková, J., & Maďar, M. (2022). Detection of Periodontal Pathogens from Dental Plaques of Dogs with and without Periodontal Disease. Pathogens, 11(4), 480. https://doi.org/10.3390/pathogens11040480