Next Article in Journal
Going Viral—RSV as the Neglected Adult Respiratory Virus
Previous Article in Journal
AWA and ASH Homologous Sensing Genes of Meloidogyne incognita Contribute to the Tomato Infection Process
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Bacterial Pathogens in the Food Industry: Antibiotic Resistance and Virulence Factors of Salmonella enterica Strains Isolated from Food Chain Links

by
Michał Wójcicki
1,*,
Agnieszka Chmielarczyk
2,
Olga Świder
3,
Paulina Średnicka
1,
Magdalena Strus
2,
Tomasz Kasperski
2,
Dziyana Shymialevich
4,
Hanna Cieślak
4,
Paulina Emanowicz
1,
Monika Kowalczyk
1,
Barbara Sokołowska
5 and
Edyta Juszczuk-Kubiak
1
1
Laboratory of Biotechnology and Molecular Engineering, Department of Microbiology, Prof. Waclaw Dabrowski Institute of Agricultural and Food Biotechnology—State Research Institute, Rakowiecka 36 Street, 02-532 Warsaw, Poland
2
Department of Microbiology, Faculty of Medicine, Jagiellonian University Medical College, Czysta 18 Street, 31-121 Cracow, Poland
3
Department of Food Safety and Chemical Analysis, Prof. Waclaw Dabrowski Institute of Agricultural and Food Biotechnology—State Research Institute, Rakowiecka 36 Street, 02-532 Warsaw, Poland
4
Culture Collection of Industrial Microorganisms—Microbiological Resources Center, Department of Microbiology, Prof. Waclaw Dabrowski Institute of Agricultural and Food Biotechnology—State Research Institute, Rakowiecka 36 Street, 02-532 Warsaw, Poland
5
Department of Microbiology, Prof. Waclaw Dabrowski Institute of Agricultural and Food Biotechnology—State Research Institute, Rakowiecka 36 Street, 02-532 Warsaw, Poland
*
Author to whom correspondence should be addressed.
Pathogens 2022, 11(11), 1323; https://doi.org/10.3390/pathogens11111323
Submission received: 19 October 2022 / Revised: 7 November 2022 / Accepted: 9 November 2022 / Published: 10 November 2022
(This article belongs to the Section Bacterial Pathogens)

Abstract

Salmonella is one of the most important foodborne pathogens. Fifty-three strains of Salmonella deposited in the Culture Collection of Industrial Microorganisms—Microbiological Resources Center (IAFB) were identified using molecular and proteomic analyses. Moreover, the genetic similarity of the tested strains was determined using the PFGE method. Main virulence genes were identified, and phenotypical antibiotic susceptibility profiles and prevalence of resistance genes were analyzed. Subsequently, the occurrence of the main mechanisms of β-lactam resistance was determined. Virulence genes, invA, fimA, and stn were identified in all tested strains. Phenotypic tests, including 28 antibiotics, showed that 50.9% of the strains were MDR. The tet genes associated with tetracyclines resistance were the most frequently identified genes. Concerning the genes associated with ESBL-producing Salmonella, no resistance to the TEM and CTX-M type was identified, and only two strains (KKP 1597 and KKP 1610) showed resistance to SHV. No strains exhibited AmpC-type resistance but for six Salmonella strains, the efflux-related resistance of PSE-1 was presented. The high number of resistant strains in combination with multiple ARGs in Salmonella indicates the possible overuse of antibiotics. Our results showed that it is necessary to monitor antimicrobial resistance profiles in all food chain links constantly and to implement a policy of proper antibiotic stewardship to contain or at least significantly limit the further acquisition of antibiotic resistance among Salmonella strains.

1. Introduction

Salmonella is a Gram-negative, facultatively anaerobic, non-spore-forming bacteria of the Enterobacteriaceae family [1,2,3], including only two species: Salmonella enterica and Salmonella bongori [2]. Despite reports of the isolation of a third species of Salmonella called S. subterranea [4], newly released analyses have suggested that it is ultimately assigned to a different cluster, and thus, it has been reclassified to the species Atlantibacter subterranea [5].
S. enterica has six subspecies, namely, Salmonella enterica subsp. enterica, Salmonella enterica subsp. salamae, Salmonella enterica subsp. arizone, Salmonella enterica subsp. diarizone, Salmonella enterica subsp. houtenae, and Salmonella enterica subsp. indica [6]. The vast majority (about 99%) of Salmonella strains that cause infections in humans or other warm-blooded animals belong to the species S. enterica [7], which due to the wide variety, has been divided into groups and serological types and currently includes 2659 serovars [8]. The main reservoir of S. enterica subsp. enterica are breeding animals such as poultry, pigs, and cattle [9]. In humans, S. Typhi is responsible for systematic infections and typhoid fever, whereas paratyphoid is caused by the S. enterica of the Paratyphi A, Paratyphi B, or Paratyphi C serovars [10]. Other serovars, such as S. Enteritidis or S. Typhimurium, both in humans and animals, are associated with non-typhoidal salmonellosis [11,12].
Salmonella is one of the main causes of food poisoning resulting from the consumption of contaminated food and water [2,13,14]. It has been estimated that Salmonella causes 115 million human infections and 370,000 deaths per year globally [8]. According to the European Union One Health 2020 Zoonoses Report published in December 2021 by the European Food Safety Authority (EFSA) and European Centre for Disease Prevention and Control (ECDC) [15], salmonellosis is the second most commonly reported foodborne gastrointestinal infection in humans after campylobacteriosis and is an important cause of foodborne outbreaks in European Union Member States (EU MS) and non-MS countries. According to the above report, in 2020, the EU had the lowest number of reported cases of salmonellosis since 2007. It was probably related to both the COVID-19 pandemic and the withdrawal of the United Kingdom from the EU structures. According to ECDC, in 2020, 52,701 cases of salmonellosis were confirmed in the EU Member States, which corresponds to an EU reporting rate of 13.7 per 100,000 popular. A similar trend in the occurrence of salmonellosis was observed in 2016–2020. S. Enteritidis, S. Typhimurium, monophasic S. Typhimurium (1,4,[5],12:i:–), S. Infantis, and S. Derby were the most frequently isolated Salmonella serovars from hospitalized patients. In total, 22 MS reported 694 foodborne outbreaks of Salmonella in 2020, which caused 3686 diseases, 812 hospitalizations, and 7 deaths. Salmonella caused nearly a quarter (22.5%) of all foodborne outbreaks in 2020. The cause of the foodborne salmonellosis epidemic with strong evidence was eggs and egg products, pork and products thereof, and bakery products. In 2021, Poland itself reported to the Rapid Alert System for Food and Feed (RASFF) Systems 176 cases of Salmonella in food and feed (in 2020: 89 notifications). In Poland, 8269 cases were recorded, including 7975 food poisonings caused by Salmonella (in 2020: 5468 cases, including 5300 food poisonings). However, it should be emphasized that in 2021, the number of cases of all infectious diseases, except for COVID-19, was lower than in previous years due to, inter alia, limited social contacts [16,17].
Antibiotic resistance (AR) has rapidly evolved in the last few decades to become one of the greatest public health threats of the XXI century nowadays. The widespread use of antibiotics, especially the broad-spectrum ones, has contributed to the development of specialist drug defense strategies by bacterial pathogens [18,19]. The mechanisms of AR are then disseminated in the environment, for example, through horizontal gene transfer (HGT) between bacteria and by lysogenic bacteriophages (temperate phages) [18,19,20]. The World Health Organization (WHO) notes that Salmonella is one of the microorganisms in which some resistant serovars have emerged, affecting the food chain [21]. According to Commission Implementing Decision, 2013/652/EU, which applied from 1 January 2014 until December 2020, monitoring of AMR in Salmonella was mandatory in the major domestically produced animal populations and their derived meat. Specific monitoring of extended-spectrum β-lactamases (ESBLs-), AmpC- and carbapenemase-producing Salmonella was also required [22]. The analysis of AMR in Salmonella isolates from hospitalized humans included dominant serovars corresponding to those found in animal species [22,23]. WHO is strengthening the capacities of national and regional laboratories in the surveillance of foodborne pathogens as well as promoting the integrated surveillance of antimicrobial resistance (AMR) of bacterial pathogens in the food chain [21].
Thus, considering the above, our research aimed to determine the antibiotic resistance profile of Salmonella strains isolated from different food chain links.

2. Materials and Methods

2.1. Taxonomic Identification of the Salmonella Strains

A total of 53 Salmonella strains used in this study were originally isolated from different food chain links (i.e., animals and animal breeding rooms, food production lines, food products, and hospitalized patients). The strains have been isolated since the 1980s and deposited in the Culture Collection of Industrial Microorganisms—Microbiological Resources Center (IAFB). The belonging of the isolated strains to the Salmonella genus was confirmed by amplification of the 16S rRNA gene region. Bacterial DNA was isolated using a commercial DNeasy PowerFood Microbial Kit (Qiagen, GmbH, Hilden, Germany) and amplified with 16S–F (5′–AGAGTTTGATCCTGGCTCAG–3′) and 16S–R (5′–ACGGCTACCTTGTTACGACT–3′) primers [24]. The PCR conditions for the gene amplification were as follows: 2 min of initial denaturation at 95 °C, followed by 35 amplification cycles of denaturation at 94 °C for 30 s, hybridization at 51 °C for 35 s, and extension step at 72 °C for 1 min, ending with a final extension period of 72 °C for 10 min (SimpliAmp™ Thermal Cycler, Applied Biosystems™, ThermoFisher Scientific, Waltham, MA, USA). The amplicons were separated by electrophoresis on 2% agarose gel containing the SimplySafe™ interfering compound (5 μL/100 mL; EURx, Gdansk, Poland). To estimate the size of the amplicons, 5 μL of a DNA Ladder in the range of 100–3000 bp was used (A&A Biotechnology, Gdansk, Poland). Electrophoresis was carried out at 110 V for 60 min using the Sub-Cell GT Horizontal Electrophoresis System (Bio–Rad, Madrid, Spain). The bands were visualized using the GeneFlash Network Bio Imaging System (Syngene, Wales, UK). Sequencing was outsourced to Genomed S.A. company (Poland). Raw sequences were analyzed using BLASTn (NCBI) and deposited in the GenBank database. Moreover, taxonomic identification of bacterial strains was performed using proteomic profiles generated by MALDI–TOF–MS (Matrix-Assisted Laser Desorption Ionization Time-of-Flight Mass Spectrometry) analysis (Shimadzu Biotech, Manchester, UK).

2.2. Subtyping Salmonella Strains Using Pulsed-Field Gel Electrophoresis (PFGE)

PFGE was performed according to the international PulseNet CDC guidelines [25] and using the XbaI restriction enzyme. PFGE was performed using a CHEF DR–III PFGE system (Bio–Rad Laboratories, Inc., Hercules, CA, USA), and the following parameters were applied: separation on a 1% agarose gel (Pulsed Field Certified Agarose, Bio–Rad) in 0.5 M Tris–Borate–EDTA (TBE) buffer at 14 °C for 20 h (pulse times of 2.2–63.8 s). The gels were stained with 0.5 μg/mL of ethidium bromide for 15 min and photographed under UV transillumination using a QuantityOne (BioRad, Madrid, Spain) software and GelDoc 2000 (BioRad, Madrid, Spain) system. The banding patterns were analyzed with bionumerics Gel Compar II 6.5 software (Applied Maths, Sint–Martens–Latem, Belgium) using the Dice coefficient and the UPGMA (Unweighted Pair-Group Method with Arithmetic mean) algorithm. A position tolerance of 1% was adopted for the generation of a dendrogram. Salmonella strains with more than 95% similarity were clustered together as identical.

2.3. Detection of Virulence Genes in Salmonella Strains

Salmonella strains were tested for six virulent genes (invA, fimA, stn, spvC, spvR, and rck) using PCR with sets of specific primer pairs (Table 1). Detailed parameters of individual PCR reactions are presented in Table S1 (Supplementary Materials). Amplicons were separated by electrophoresis, as described in Section 2.1. To estimate the size of the amplicons, a DNA Ladder in the range of 100–1000 bp was used (A&A Biotechnology, Gdansk, Poland).

2.4. Antimicrobial Sensitivity Testing

Salmonella strains were tested in vitro for their susceptibility to 28 antimicrobial agents (Oxoid, Hampshire, United Kingdom). Antimicrobial susceptibility tests were performed using a Kirby–Bauer disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) [32] and Clinical and Laboratory Standards Institute (CLSI) [33] standards on Mueller–Hinton agar (Merck). The plates were incubated at 37 °C for 18 ± 2 h. The following antimicrobial agents belonging to eight different classes were tested: (1) penicillins: ampicillin (AMP, 10 μg), sulbactam/ampicillin (SAM, 20 μg), amoxicillin/clavulanic acid (AMC, 30 μg), piperacillin (PRL, 30 μg), piperacillin/tazobactam (TZP, 36 μg), ticarcillin/clavulanic acid (TTC, 85 μg); (2) cephalosporins: cefepime (FEP, 30 μg), cefotaxime (CTX, 5 μg), ceftaroline (CPT, 5 μg), ceftazidime (CAZ, 10 μg), ceftazidime/avibactam (CZA, 14 μg), ceftolozane/tazobactam (CT, 40 μg), ceftriaxone (CRO, 30 μg); (3) carbapenems: ertapenem (ETP, 10 μg), imipenem (IMP, 10 μg), meropenem (MEM, 10 μg); (4) monobactams: aztreonam (ATM, 30 μg); (5) fluoroquinolones: ciprofloxacin (CIP, 5 μg), pefloxacin (PEF, 5 μg), levofloxacin (LEV, 5 μg), moxifloxacin (MXF, 5 μg), ofloxacin (OFX, 5 μg), norfloxacin (NOR, 10 μg); (6) aminoglycosides: amikacin (AK, 30 μg), gentamycin (CN, 10 μg), tobramycin (TOB, 10 μg); (7) phenicols: chloramphenicol (C, 30 μg), and (8) sulfonamides: sulphamethoxazole/trimethoprim (SXT, 25 μg). The tests were made in triplicate, and the mean diameter of the inhibitory zones was calculated. Susceptibility of the isolates to antimicrobial agents was categorized (as susceptible or resistant) by measurement of the inhibition zone, according to interpretive criteria that adhered to the EUCAST guidelines. Escherichia coli ATCC 25922 was used as the reference strain. Salmonella strains resistant to three or more different antimicrobial classes were categorized as multidrug-resistant (MDR) isolates.
Multiple antibiotic resistance (MAR) phenotypes were recorded for Salmonella strains showing resistance to more than two antibiotics, and the MAR index [34] was calculated as:
MAR = Number   of   resistance   to   antibiotics Total   number   of   antibiotics   tested

2.5. Determination of Antibiotics Resistance Profile of Salmonella Strains

Mueller–Hinton agar was used to culture the Salmonella strains overnight at 37 °C. Bacterial DNA was isolated using a commercial DNeasy PowerFood Microbial Kit (Qi-agen, GmbH, Hilden, Germany). The presence of twenty-five resistance genes (strA/strB, aadA, aadB, aacC, floF, floR, cat1, cat2, mcr1, mcr2, mcr3, mcr4, mcr5, aphAI-IAB, aphA1, aphA2, tetA, tetB, tetC, sul1, sul2, sul3, dfrA1, dfrA10, and dfrA12) were analyzed using specific primer pairs by conventional PCR reaction. The primer pairs sequences and PCR product size are shown in Table 2. Detailed parameters of individual PCR reactions are presented in Table S1 (Supplementary Materials). Amplicons were separated by electrophoresis, as described in Section 2.1. To estimate the size of the amplicons, a DNA Ladder in the range of 100–1000 bp or 100–3000 bp was used (A&A Biotechnology, Gdansk, Poland). Escherichia coli ATCC 25922 was used as the negative control.

2.6. Screening for Phenotypic and Genotypic Detection of β-lactamases-Producing Salmonella Strains

In the last stage of the research, the phenotypic and genotypic assessment of the ability to produce β-lactamases by Salmonella strains was carried out. Phenotypic detection of ESBL-producing Salmonella was performed by the double-disc synergy test (DDST) on Mueller–Hinton agar (Merck) with amoxicillin/clavulanic acid (AMC, 30 μg), cefepime (FEP, 30 μg), cefotaxime (CTX, 30 μg), and ceftazidime (CAZ, 30 μg) disks (Oxoid, Hampshire, UK). Samples were considered to be ESBL-positive when the inhibition zone around cefotaxime or ceftazidime increased toward the central disk with AMC [42]. Moreover, for the detection of ESBL- and carbapenemases-producing Salmonella, commercial selective media were used: CHROMagar ESBL and CHROMagar mSuperCARBA, respectively (Graso Biotech, Starogard Gdanski, Poland).
The presence of five bla genes (blaTEM, blaCTX-M, blaSHV, blaCMY-2, and blaPSE-1) related to resistance to β-lactams were analyzed using specific primer pairs by conventional PCR reaction. The primer pairs sequences and predicted PCR product size are shown in Table 3. Detailed parameters of individual PCR reactions are presented in Table S1 (Supplementary Materials). Amplicons were separated by electrophoresis, as described in Section 2.1. To estimate the size of the amplicons, a DNA Ladder in the range of 100–1000 bp was used (A&A Biotechnology, Gdansk, Poland). Escherichia coli ATCC 25922 was used as the negative control.

3. Results and Discussion

3.1. Source of Isolation and Taxonomic Identification of the Salmonella Strains

Salmonella strains deposited in the Culture Collection of Industrial Microorganisms—Microbiological Resources Center (IAFB) were used in this study. Strains were classified into the Salmonella genus based on biochemical features. A panel of 53 strains isolated from different food chain links: animals and animal breeding rooms (ABR, n = 9), food production lines (FPL, n = 3), food products (FP, n = 38), and hospitalized patients (HP, n = 3) was analyzed. The taxonomic affiliation of all strains to the genus Salmonella was confirmed either by molecular methods (amplification of the 16S rRNA gene region) or by the analysis of proteomic profiles (using MALDI–TOF–MS). All nucleotide sequences of the strains have been deposited in the GenBank database (Table 4).
Genetic identification (16S rRNA amplification) of most Salmonella strains coincided with proteomic identification. For three strains, the identification with the use of the MALDI–TOF–MS allowed us to obtain the result of belonging to the genus of bacterial isolates. These three Salmonella strains (KKP 1002, KKP 1006, and KKP 1041) were isolated from food products (specific origin unknown). During the heat treatment of food, bacterial cells could be damaged, which could affect the identification result based on protein profiles.

3.2. Subtyping Salmonella Strains Using Pulsed-Field Gel Electrophoresis (PFGE)

Pulsed-field gel electrophoresis (PFGE) was used to assess the genetic similarity of the Salmonella strains. For 7 Salmonella strains, including KKP 996, KKP 1001, KKP 1003, KKP 1004, KKP 1040, KKP 1043, and KKP 1514, the restriction pattern in PFGE was not obtained. Isolates that clustered >95% were considered the same clones (Figure 1). Genotyping of Salmonella strains by PFGE showed a relatively high diversity of isolates. Only a few tested strains had the same restriction pattern. Strains with identical restriction patterns are marked in red boxes (Figure 1).

3.3. Detection of Virulence Genes in Salmonella Strains

Salmonella encodes numerous genes such as invA, fimA, stn, spvC, spvR, and rck involved in bacterial pathogenicity (Table 5) [47]. In our study, the presence of invA gene in all tested Salmonella strains was confirmed. invA located on pathogenicity island 1 (SPI-1, Salmonella Pathogenicity Islands 1) has been extensively studied for its ability to promote the virulence of Salmonella [47,48]. SPI-1 is required to invade host intestinal epithelium cells (the invA gene is involved in this process) [49], induce an inflammatory reaction, and disrupt the host’s epithelial barrier [19,50]. The fimA and stn genes were also present in all tested strains. The fimA gene encodes the FimA protein, which is necessary for the assembly of type I fimbriae in Salmonella [51,52]. The fimbriae are Salmonella filamentous surface structures that contribute to the colonization of the host’s epithelium cells [47]. The stn gene encodes Salmonella enterotoxin, mainly associated with S. Typhi, S. Typhimurium, and S. Enteritidis serovar infections [53]. Clinically, the stn gene is a biomarker differentiating enterotoxic S. enterica strains from most S. bongori strains and other rods from the Enterobacteriaceae family [47,53,54]. In Salmonella strains, the stn gene exhibits high nucleotide sequence homology but limited similarity to its corresponding gene in other closely related enteric bacteria. Detection of the stn gene has been reported to be effective in detecting more than 50 strains of S. enterica and two strains of S. bongori without cross-reactivity to other more common intestinal strains [54]. The presence of the spvC and spvR genes was confirmed in 13 (24.5%) tested Salmonella strains. Moreover, in these strains, sequence of the rck gene was also detected. The spvC gene, present in plasmids and/or chromosomes, enhances the systemic proliferation of the bacterial pathogen and contributes to its replication outside the small intestine. Together with the invA and sseL (located on the SPI-2), spvC facilitates the prediction of the overall pathogenicity, invasiveness, and replication potential of Salmonella [55]. The spvR gene product—SpvR is a regulator of the spvABCD system, which is essential for systemic virulence [47]. The spv gene also encoded resistance to macrophage damage while the plasmid-borne Rck outer membrane protein (product of rck gene) confers resistance to complement killing [56]. In addition, The Rck protein has the ability to promote bacterial invasion of mammalian cells [57]. The expression of the rck gene is regulated by SdiA, a quorum sensing (QS) regulator, which is activated by acyl homoserine lactones (AHL) produced by other bacteria strains [58]. In our study, the presence of the rck gene was found in 20 (37.7%) tested Salmonella strains.
The presence of virulence genes in the Salmonella genome has been studied by many research groups, but the results are inconsistent. The invA gene was present in all tested Salmonella strains, according to some studies [56,59]. Other authors reported that the invA gene was present in 66% [47] and 91% [60] of the tested strains. A Salmonella virulence genes profile similar to the results obtained by our team was reported by Deguenon et al. [61], who confirmed the presence of the invA, fimA, and stn in all Salmonella strains, while the spvC and spvR sequences were found in only 10% and 20% of the tested strains, respectively. In turn, Bolton et al. [56] determined the prevalence of the rck gene in Salmonella at the level of 62.1% (18/29). In other studies [62], including ESBL-producing Salmonella, the presence of the rck gene was not confirmed in any of the strains.

3.4. Antibiotic Resistance Profiles in Salmonella Strains

Antibiotics are usually used in the treatment of infections of bacterial etiology, and their widespread use in recent decades has led to a huge problem related to the antibiotic resistance of bacterial pathogens [63,64,65,66]. β-lactam antibiotics constitute the most numerous and most frequently used group of antibiotics [67,68]. This group includes four main subgroups: penicillins, cephalosporins, carbapenems, and monobactams [69]. The mechanism of action of β-lactams consists in interfering with the synthesis of the cell wall and inhibiting the formation of bridges connecting the peptidoglycan subunits. β-lactam antibiotics block the activity of the enzymes, including transpeptidases and carboxypeptidases, which are involved in the synthesis of peptidoglycan in the bacterial cell wall [68,70,71]. Fluoroquinolones (fluorinated quinolones, FQ) are commonly used in salmonellosis therapy [72,73], and their activity is associated with the inhibition of DNA synthesis by blocking topoisomerases II, DNA gyrase, and topoisomerase IV [74,75,76]. Another group of antibiotics used in the treatment of salmonellosis is aminoglycosides that bind to the 30S ribosome subunit, which leads to a disturbance in the reading of genetic information and inhibition of bacterial protein synthesis [77,78]. The mechanism of phenicol action also consists in inhibiting the synthesis of bacterial proteins but as a result of binding to the large (50S) ribosome subunit [79,80]. The last group of antibiotics tested in our study was sulfonamides. Sulfonamides are structural analogs of para-aminobenzoic acid (PABA) that inhibit the synthesis of folic acid and, indirectly, nucleic acids in bacterial cells [81,82,83].
In our study, Salmonella strains were tested for susceptibility to twenty-eight antimicrobial agents belonging to eight different classes (Table 6). Among the tested strains, seven (13.2%) showed no phenotype resistance to any of the tested antibiotics. All strains were sensitive to meropenem (carbapenem) and levofloxacin (fluoroquinolone). In this study, most of the Salmonella strains showed a MAR (Multiple Antibiotic Resistance) index lower than 0.3, whereas one of the strains (S. enterica strain KKP 998) showed a MAR index above 0.5 (MAR index = 0.61).
Moreover, a high prevalence of MAR was observed amongst the strains; 50.9% (27/53) of the isolates were MDR (Multi-Drug Resistant). Salmonella enterica strain KKP 998 (isolated from food product) exhibited the most extensive resistance profile to 17 antibiotics (AMC-TTC-FEP-CTX-CPT-CAZ-CT-CRO-ETP-IMP-ATM-PEF-MXF-OFX-AK -CN-TOB), belonging to 6 different classes of antibiotics (penicillins, cephalosporins, carbapenems, monobactams, fluoroquinolones, and aminoglycosides). Extensive resistance profiles were also exhibited by S. enterica strains KKP 3821, KKP 1004, KKP 1044, and KKP 3080. S. enterica strain KKP 3281 (isolated from animal breeding rooms) was resistant to 12 antimicrobials (FEP-CTX-CPT-CAZ-CZA-CT-CRO-ETP-ATM-PEF-AK-TOB) from 5 different classes of antibiotics (cephalosporins, carbapenems, monobactams, fluoroquinolones, and aminoglycosides), while the remaining three strains (isolated from food products) showed resistance to the 11 tested antibiotics. Some antibiotics were completely ineffective against tested bacteria (unpublished data). S. enterica strains KKP 1000 and KKP 3820 showed full growth with ampicillin, piperacillin, and chloramphenicol discs. Discs with sulphamethoxazole/trimethoprim (cotrimoxazole) did not inhibit the growth of S. enterica strains KKP 1007 and KKP 1010. In the case of S. enterica strain, KKP 3821 zones of growth inhibition were observed for five antibiotics (cefotaxime, ceftazidime, ceftazidime/avibactam, ceftolozane/tazobactam, and aztreonam). Moreover, as many as 14 strains of Salmonella (26.4%) were resistant to all tested antibiotics from the aminoglycosides class (i.e., amikacin, gentamycin, and tobramycin) (Table 6).
Salmonella strains showed the highest resistance to antibiotics from the aminoglycoside class (Table 7). Against amikacin, gentamicin, and tobramycin, phenotypic resistance was exhibited by 31 (58.5%), 26 (49.1%), and 24 (45.3%) strains, respectively. Ceftaroline, belonging to the class of broad-spectrum cephalosporins, was effective against the smallest number of strains tested. Thirty-two of the tested Salmonella strains (60.4%) were resistant to this antibiotic.
In our studies, we determined the sensitivity profiles of Salmonella strains and found a high percentage of strains exhibiting at least one phenotypic resistance. Some antibiotics from the penicillin class, macrolides or lincosamides were not used in the study due to a natural lack of activity against Salmonella [7]. The obtained results of antibiotic resistance indicate that Salmonella strains, isolated from different links of the food chain, are in a large percentage of MDR strains, i.e., they are insensitive to at least one antibiotic from at least three groups of antibacterial drugs used in the treatment of infections caused by Salmonella [84]. The results of studies published by Pławińska-Czarnak et al. [7] also confirm a high percentage (53.8%) of MDR Salmonella strains that showed resistance to β-lactams, aminoglycosides, cephalosporins, fluoroquinolones, sulfonamides, and tetracyclines. The high resistance to fifth-generation cephalosporins (ceftaroline), which are used in the treatment of severe bacterial infections, seems to be of concern. Among the tested Salmonella strains, as many as 60.4% were resistant to ceftaroline. Compared to the early-generation cephalosporins, ceftaroline has better stability to β-lactamases. However, it is inactivated by several classes of these enzymes and, thus, is not recommended for the treatment of ESBL-positive Gram-negative bacteria infections, as well as infections caused by bacteria producing metallo-β-lactamases or AmpC-type cephalosporinases [85]. The presence of a high percentage of strains resistant to the fifth generation of cephalosporins is an alarming situation, given the risk of transferring resistance genes in the environment. Ceftaroline is the drug of choice among cephalosporins and is active against multidrug-resistant Staphylococcus aureus, including MRSA, VRSA, and VISA [85,86]. Another class of antibiotics used in severe Salmonella infections is the sulfonamides; however, in this case, only 3.8% of the strains showed resistance. There was also no high percentage of strains resistant to carbapenems, which are used if ciprofloxacin and third-generation cephalosporin fail. In the study by Marin et al. [87], all isolated Salmonella strains showed resistance to at least one antibiotic, and 72% were MDR strains, with gentamicin–colistin and gentamicin–colistin–ampicillin being the most frequently observed resistance patterns. In a study conducted in China [88], 50.4% of the Salmonella isolates mostly originated from food products that were MDR. In total, 73% of the MDR Salmonella strains were resistant to tetracycline, 67% to ampicillin, and 59% to doxycycline. Our research shows a similar share of multidrug-resistant Salmonella strains (50.9%); however, significantly fewer of them were resistant to ampicillin (3.8%). Results obtained in another study carried out in Brazil [42] indicated that the highest percentage of Salmonella strains originated from broiler processing plants that were resistant to nalidixic acid and tetracycline. Strains resistant to meropenem, imipenem, and ciprofloxacin were not detected, while resistance to imipenem and ciprofloxacin was observed in 5.7% and 11.3% of Salmonella strains, respectively.
According to the latest report released by EFSA and ECDC [22], in the years 2019–2020 in the UE, there was a high percentage of Salmonella resistant to ampicillin, sulfonamides, and tetracyclines isolated from hospitalized patients. Zoonotic isolates showed moderate to very high resistance to these antibiotics. A very high percentage of FQ-resistant strains was observed in zoonotic isolates. Salmonella isolates from patients showed moderate resistance to ciprofloxacin. High resistance to third-generation cephalosporins has been observed neither for zoonotic strains nor those isolated from patients. In our study, none of the strains originated from hospitalized patients showed resistance to ampicillin and sulfonamides, but S. enterica KKP 996 and KKP 1193 strains (66% of strains isolated from hospitalized patients) showed genotypic resistance to tetracyclines (Table 8). Low percentage of FQ-resistant strains was observed amongst zoonotic isolates. Similar to the data collected in the EFSA/ECDC report, resistance to cefotaxime, ceftriaxone, and ceftazidime did not occur frequently (7.6%, 26.4%, and 5.7%, respectively) (Table 7). According to the EFSA/ECDC report, 25.4% of the strains isolated from patients were multidrug resistant. A significantly higher percentage of MDR strains was observed in Salmonella strains isolated from animals: 53.6% from broiler carcasses, 43.3% from pigs, and 23.1% from calves [22]. The above report [22] indicates the main etiological factors of Salmonella infections and underlines that special caution should be exercised regarding contact with raw materials and food of animal origin. Our outcomes confirmed that food is a common source of multidrug-resistant pathogenic bacteria (47.4% (18/38) MDR strains from food products and 55.6% (5/9) MDR strains from animals or animal breeding rooms).

3.5. Genotypic Resistance Profiles in Salmonella Strains

A genotypic resistance profile was determined for a panel of Salmonella strains using 25 primer pairs. Salmonella strains belonging to one clone in PFGE (Figure 1) did not show the same virulence profiles. The aadB and aacC genes encoding resistance to gentamicin (an aminoglycoside antibiotic) were not identified in any of the strains. There was also no presence of mcr1, mcr2, mcr3, mcr4, and mcr5 genes, encoding resistance to colistin, belonging to peptide antibiotics, and dfrA1, dfrA10 and dfrA12 genes associated with resistance to trimethoprim (dihydrofolic acid reductase inhibitor). Regarding the genes encoding chloramphenicol resistance, cat1 and cat2 were not found in any of the tested strains. However, the presence of the third chloramphenicol resistance gene (floR) was confirmed in 7 (13.2%) of the tested strains. Phenotypic resistance to chloramphenicol was confirmed only in three Salmonella strains—KKP 999, KKP 1000, and KKP 3820 (Table 8). Among the two tested genes of resistance to neomycin (aminoglycoside antibiotic), the aphA1 was present in only one (1.9%) Salmonella strain (KKP 998), whereas aphA2 was not detected in any of the strains. In turn, the genes encoding resistance to sulfamethoxazole were also tested in the Salmonella strains, and out of the three tested genes (sul1, sul2, and sul3), no sul3 gene was found in any of the strains. Moreover, in seven Salmonella strains (i.e., KKP 1003, KKP 1040, KKP 1113, KKP 1611, KKP 1775, KKP 3816, and 3821), none of the tested resistance genes was identified. Importantly, only S. enterica strain KKP 1040 showed phenotypical sensitivity to all tested antibiotics with the simultaneous absence of all tested resistance genes.
The highest percentage of resistant strains was found for tetracycline, where 10 (18.9%), 23 (43.4%), and 31 (58.5%) Salmonella strains contained the tetA, tetB, and tetC genes, respectively (Table 9). A high percentage of Salmonella strains resistant to tetracyclines is consistent with the data from the EFSA and ECDC report [22] from 2022. A relatively high percentage of Salmonella strains (35.8%) contained the sul1 gene, encoding resistance to sulfamethoxazole, although only two (3.8%) Salmonella strains showed phenotypic resistance to sulfamethoxazole with an inhibitor (trimethoprim) (Table 7).

3.6. Screening for Phenotypic and Genotypic Detection of β-lactamases-Producing Salmonella Strains

Since the phenotype sensitivity to antibiotics can be conferred by several different antibiotic resistance genes (ARGs), in the last step of our research, the presence of the main mechanisms of β-lactam resistance (phenotypically and genotypically expressed) in Salmonella was determined. In Salmonella, as in other bacteria from the Enterobacteriaceae family, the main mechanism of resistance to β-lactam antibiotics are β-lactamases encoded by bla genes [7,89,90]. Many different β-lactamases have been described, but β-lactamases of the TEM type (named after the patient Temoneira), CTX-M type (active on cefotaxime, first isolated at Munich), and SHV type (sulfhydryl reagent variable) predominate in Salmonella [89,91,92,93]. They belong to β-lactamases with a broad spectrum of substrate activity (ESBL). ESBL enzymes inactivate cephalosporins and first-, second-, and third-generation penicillins [7,89]. They are not active against carbapenems [94]. ESBL genes of the TEM and CTX-M types were not identified among our strains. CTX-M enzymes are active against cephalosporins and monobactams and are currently of great epidemiological and clinical importance [7]. The SHV-type ESBL gene was identified in two isolates—S. enterica strains KKP 1597 and KKP 1610 isolated from food products (Table 4). The presence of the ESBL mechanism was not confirmed phenotypically; therefore, it is likely that the blaSHV gene associated with SHV-type ESBL resistance in S. enterica KKP 1597 and KKP 1610 strains may be inactive. According to the literature, the presence of blaSHV is often associated with the Enterobacteriaceae family in nosocomial infections [7]. The presence of blaSHV in Salmonella strains isolated from hospitalized patients was not confirmed in our study. Another group of β-lactamases is AmpC, which confers resistance to all β-lactam antibiotics except fourth-generation cephalosporins and carbapenems [95,96]. Contrary to ESBL, the AmpC group is not sensitive to β-lactam inhibitors such as clavulanic acid, sulbactam, and tazobactam [95]. The mechanism of AmpC can be encoded by genes located on chromosomes or plasmids [96]. It has been shown that in Salmonella, resistance to broad-spectrum cephalosporins is often associated with blaCMY2 gene [97]. In our study, none of the strains exhibited a resistance mechanism to AmpC-type β-lactamases. Another gene encoding resistance to β-lactam antibiotics is the blaPSE-1 gene located on the first-class integron [7,89]. Moreover, the presence of the blaPSE1 gene associated with the PSE-1 drug efflux mechanism was identified in six Salmonella strains, including KKP 1000, KKP 1004, KKP 1005, KKP 1007 isolated from food products, and KKP 3819 and KKP 3820 isolated from poultry. Moreover, no carbapenemase-producing Salmonella strains were detected among the tested isolates.
According to the EFSA and ECDC report, the percentage of ESBL and AmpC-producing Salmonella strains ranged from very low to low (animal isolates) and very low among isolates obtained from hospitalized patients. Carbapenemase-producing isolates were not detected in any of the zoonotic Salmonella strains, while in 20192020, among isolates from humans, only three carbapenemase-producing Salmonella strains were detected [22]. The results from the above-mentioned report are comparable to our study and confirm the low percentage of Salmonella strains with resistance mechanisms.

4. Conclusions

Salmonella isolates show phenotypic resistance to many antibiotics and encode numerous genes associated with antimicrobial resistance. The high number of resistant Salmonella strains (isolated both at the end of the 20th century and in recent years) in combination with multiple ARGs indicates the possible irrational/unjustified use of antibiotics for many years. The problem of the development of ESBL or AmpC resistance mechanisms in Salmonella strains resulting from both our research and European reports is not alarming yet; however, it is necessary to constantly monitor antimicrobial resistance profiles in all food chain links and to implement a policy of rational antibiotic stewardship (AMS), which may stop or at least significantly limit the further acquisition of antibiotic resistance among Salmonella strains. A significant reduction in the use of antibiotics in animal husbandry may limit the transfer of antibiotic resistance genes through food. The development of new, alternative antibacterial agents also represents a relevant approach. One concept that recurs due to the growth of MDR strains is the use of strictly lytic bacteriophages. Currently, phage therapy is an experimental treatment aimed at eradicating bacterial strains for which antibiotic therapy does not bring the expected results. The use of specific bacteriophages in the food industry in the EU countries is not approved for use yet, unlike, for example, in the USA or Canada, where commercial preparations based on phage cocktails against foodborne pathogens for food products are applied.

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/pathogens11111323/s1, Table S1: The PCR conditions for amplification of virulence markers, AMR-related and β-lactamases-related genes in Salmonella strains.

Author Contributions

Conceptualization, M.W. and A.C.; methodology, M.W. and A.C.; formal analysis, M.W. and A.C.; investigation, M.W., A.C., O.Ś., P.Ś., M.S., T.K., D.S., H.C., P.E., M.K., B.S. and E.J.-K.; writing—original draft preparation, M.W.; writing—review and editing, M.W., A.C., O.Ś., M.S. and B.S.; visualization, M.W. and A.C.; supervision, E.J.-K. All authors have read and agreed to the published version of the manuscript.

Funding

The research was supported by internal statutory projects at the IAFB: No. 144–01–ZM “Utilization of phages to control Salmonella sp. as an innovative method of ensuring microbiological food safety”.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Heredia, N.; García, S. Animals as sources of food–borne pathogens: A review. Anim. Nutr. 2018, 4, 250–255. [Google Scholar] [CrossRef] [PubMed]
  2. Ferrari, R.G.; Rosario, D.K.A.; Cunha–Neto, A.; Mano, S.B.; Figueiredo, E.E.S.; Conte–Junior, C.A. Worldwide Epidemiology of Salmonella Serovars in Animal–Based Foods: A Meta–analysis. Appl. Environ. Microb. 2019, 85, e00591-19. [Google Scholar] [CrossRef] [PubMed]
  3. Wang, X.; Biswas, S.; Paudyal, N.; Pan, H.; Li, X.; Fang, W.; Yue, M. Antibiotic Resistance in Salmonella Typhimurium Isolates Recovered From the Food Chain Through National Antimicrobial Resistance Monitoring System Between 1996 and 2016. Front. Microbiol. 2019, 10, 985. [Google Scholar] [CrossRef]
  4. Shelobolina, E.S.; Sullivan, S.A.; O’Neill, K.R.; Nevin, K.P.; Lovley, D.R. Isolation, characterization, and U (VI)–reducing potential of a facultatively anaerobic, acid–resistant bacterium from low–pH, nitrate– and U (VI)–contaminated subsurface sediment and description of Salmonella subterranea sp. nov. Appl. Environ. Microb. 2004, 70, 2959–2965. [Google Scholar] [CrossRef] [PubMed]
  5. Hata, H.; Natori, T.; Mizuno, T.; Kanazawa, I.; Eldesouky, I.; Hayashi, M.; Miyata, M.; Fukunaga, H.; Ohji, S.; Hosoyama, A.; et al. Phylogenetics of family Enterobacteriaceae and proposal to reclassify Escherichia hermannii and Salmonella subterranea as Atlantibacter hermannii and Atlantibacter subterranea gen. nov., comb. nov. Microbiol. Immunol. 2016, 60, 303–311. [Google Scholar] [CrossRef]
  6. Hurley, D.; McCusker, M.P.; Fanning, S.; Martins, M. Salmonella—Host interactions—Modulation of the host innate immune system. Front. Immunol. 2014, 5, 481. [Google Scholar] [CrossRef]
  7. Pławińska–Czarnak, J.; Wódz, K.; Kizerwetter–Świda, M.; Bogdan, J.; Kwieciński, P.; Nowak, T.; Strzałkowska, Z.; Anusz, K. Multi–Drug Resistance to Salmonella spp. When Isolated from Raw Meat Products. Antibiotics 2022, 11, 876. [Google Scholar] [CrossRef] [PubMed]
  8. Qin, X.; Yang, M.; Cai, H.; Liu, Y.; Gorris, L.; Aslam, M.Z.; Jia, K.; Sun, T.; Wang, X.; Dong, Q. Antibiotic Resistance of Salmonella Typhimurium Monophasic Variant 1,4,[5],12:i:– in China: A Systematic Review and Meta–Analysis. Antibiotics 2022, 11, 532. [Google Scholar] [CrossRef]
  9. Shaheen, A.; Tariq, A.; Shehzad, A.; Iqbal, M.; Mirza, O.; Maslov, D.A.; Rahman, M. Transcriptional regulation of drug resistance mechanisms in Salmonella: Where we stand and what we need to know. World J. Microbiol. Biotechnol. 2020, 36, 85. [Google Scholar] [CrossRef]
  10. Dos Santos, A.M.P.; Ferrari, R.G.; Conte–Junior, C.A. Virulence Factors in Salmonella Typhimurium: The Sagacity of a Bacterium. Curr. Microbiol. 2018, 76, 762–773. [Google Scholar] [CrossRef]
  11. Luo, Y.; Yi, W.; Yao, Y.; Zhu, N.; Qin, P. Characteristic diversity and antimicrobial resistance of Salmonella from gastroenteritis. J. Infect. Chemother. 2018, 24, 251–255. [Google Scholar] [CrossRef] [PubMed]
  12. Kurtz, J.R.; Goggins, J.A.; McLachlan, J.B. Salmonella infection: Interplay between the bacteria and host immune system. Immunol. Lett. 2017, 190, 42–50. [Google Scholar] [CrossRef] [PubMed]
  13. Eng, S.K.; Pusparajah, P.; Mutalib, N.S.A.; Ser, H.L.; Chan, K.G.; Lee, L.H. Salmonella: A review on pathogenesis epidemiology and antibiotic resistance. Front. Life Sci. 2015, 8, 284–293. [Google Scholar] [CrossRef]
  14. Khan, M.A.S.; Rahman, S.R. Use of Phages to Treat Antimicrobial-Resistant Salmonella Infections in Poultry. Vet. Sci. 2022, 9, 438. [Google Scholar] [CrossRef] [PubMed]
  15. European Food Safety Authority; European Centre for Disease Prevention and Control. The European Union One Health 2020 Zoonoses Report. EFSA J. 2021, 19, e06971. [Google Scholar]
  16. Chief Sanitary Inspectorate. Sanitary Condition of the Country in 2020. Available online: https://www.gov.pl/web/gis/raport---stan-sanitarny-kraju (accessed on 30 September 2022).
  17. Chief Sanitary Inspectorate. Sanitary Condition of the Country in 2021. Available online: https://www.gov.pl/web/gis/raport---stan-sanitarny-kraju (accessed on 30 September 2022).
  18. Połaska, M.; Sokołowska, B. Bacteriophages—A new hope or huge problem in the food industry. AIMS Microbiol. 2019, 5, 324–346. [Google Scholar] [CrossRef]
  19. Wójcicki, M.; Świder, O.; Daniluk, K.J.; Średnicka, P.; Akimowicz, M.; Roszko, M.Ł.; Sokołowska, B.; Juszczuk–Kubiak, E. Transcriptional Regulation of the Multiple Resistance Mechanisms in Salmonella—A Review. Pathogens 2021, 10, 801. [Google Scholar] [CrossRef]
  20. Wójcicki, M.; Błażejak, S.; Gientka, I.; Brzezicka, K. The concept of using bacteriophages to improve the microbiological quality of minimally–processed foods. Acta Sci. Pol. Technol. Aliment. 2019, 18, 373–383. [Google Scholar]
  21. WHO. Salmonella (Non–Typhoidal). Available online: https://www.who.int/news-room/fact-sheets/detail/salmonella-(non-typhoidal) (accessed on 3 October 2022).
  22. European Food Safety Authority; European Centre for Disease Prevention and Control. The European Union Summary Report on Antimicrobial Resistance in zoonotic and indicator bacteria from humans, animals and food in 2019–2020. EFSA J. 2022, 20, 7209. [Google Scholar]
  23. European Food Safety Authority; European Centre for Disease Prevention and Control. The European Union Summary Report on Antimicrobial Resistance in zoonotic and indicator bacteria from humans, animals and food in 2018–2019. EFSA J. 2021, 19, 6490. [Google Scholar]
  24. Tang, H.; Wang, M.J.; Gan, X.F.; Li, Y.Q. Funneling lignin–derived compounds into polyhydroxyalkanoate by Halomonas sp. Y3. Bioresour. Technol. 2022, 362, 127837. [Google Scholar] [CrossRef] [PubMed]
  25. PulseNet. Standard Operating Procedure for PulseNet PFGE of Escherichia coli O157:H7, Escherichia coli Non–O157 (STEC), Salmonella Serotypes, Shigella sonnei and Shigella flexneri. Available online: https://pulsenetinternational.org/protocols/pfge/ (accessed on 15 May 2022).
  26. Nadi, Z.R.; Salehi, T.Z.; Tamai, I.A.; Foroushani, A.R.; Sillanpaa, M.; Dallal, M.M.S. Evaluation of antibiotic resistance and prevalence of common Salmonella enterica serovars isolated from foodborne outbreaks. Microchem. J. 2020, 155, 104660. [Google Scholar] [CrossRef]
  27. Moussa, I.M.; Aleslamboly, Y.S.; Al–Arfaj, A.A.; Hessain, A.M.; Gouda, A.S.; Kamal, R.M. Molecular characterization of Salmonella virulence genes isolated from different sources relevant to human health. J. Food Agric. Environ. 2013, 11, 197–201. [Google Scholar]
  28. Kang, X.; Wang, M.; Meng, C.; Li, A.; Jiao, X.; Pan, Z. Prevalence and whole–genome sequencing analysis of Salmonella reveal its spread along the duck production chain. Poult. Sci. 2022, 101, 101993. [Google Scholar] [CrossRef]
  29. Fardsanei, F.; Dallal, M.M.S.; Douraghi, M.; Salehi, T.Z.; Mahmoodi, M.; Memariani, H.; Nikkhahi, F. Genetic diversity and virulence genes of Salmonella enterica subspecies enterica serotype Enteritidis isolated from meats and eggs. Microb. Pathog. 2017, 107, 451–456. [Google Scholar] [CrossRef]
  30. Pasmans, F.; Van Immerseel, F.; Heyndrickx, M.; Godard, C.; Wildemauwe, C.; Ducatelle, R.; Haesebrouck, F. Host adaptation of pigeon isolates of Salmonella serovar Typhimurium var. Copenhagen PT99 is associated with macrophage cytotoxicity. Infect. Immunol. 2003, 71, 6068–6074. [Google Scholar] [CrossRef]
  31. Haneda, T.; Okada, N.; Nakazawa, N.; Kawakami, T.; Danbara, H. Complete DNA sequence and comparative analysis of the 50–kilobase virulence plasmid of Salmonella enterica serovar Choleraesuis. Infect. Immunol. 2001, 69, 2612–2620. [Google Scholar] [CrossRef]
  32. The European Committee on Antimicrobial Susceptibility Testing. Breakpoint Tables for Interpretation of MICs and Zone Diameters.Version 12.0, 2022. Available online: http://www.eucast.org (accessed on 22 September 2022).
  33. CLSI. Performance Standards for Antimicrobial Disk Susceptibility Tests; CLSI Standard Mo2; Clinical and Laboratory Standards Institute: Wayne, PA, USA, Version 13.0; 2018; Available online: https://clsi.org/standards/products/microbiology/documents/m02/ (accessed on 22 September 2022).
  34. Akinola, S.A.; Mwanza, M.; Ateba, C.N. Occurrence, genetic diversities and antibiotic resistance profiles of Salmonella serovars isolated from chickens. Infect. Drug Resist. 2019, 12, 3327–3342. [Google Scholar] [CrossRef]
  35. Khan, S.B.; Khan, M.A.; Ahmad, I.; ur Rehman, T.; Ullah, S.; Dad, R.; Sultan, A.; Memon, A.M. Phentotypic, gentotypic antimicrobial resistance and pathogenicity of Salmonella enterica serovars Typimurium and Enteriditis in poultry and poultry products. Microb. Pathog. 2019, 129, 118–124. [Google Scholar] [CrossRef]
  36. Vuthy, Y.; Lay, K.S.; Seiha, H.; Kerleguer, A.; Aidara–Kane, A. Antibiotic susceptibility and molecular characterization of resistance genes among Escherichia coli and among Salmonella subsp. in chicken food chains. Asian Pac. J. Trop. Biomed. 2017, 7, 670–674. [Google Scholar] [CrossRef]
  37. Abdeen, E.; Elmonir, W.; Suelam, I.I.A.; Mousa, W.S. Antibiogram and genetic diversity of Salmonella enterica with zoonotic potential isolated from morbid native chickens and pigeons in Egypt. J. Appl. Microbiol. 2018, 124, 1265–1273. [Google Scholar] [CrossRef] [PubMed]
  38. Ćwiek, K.; Korzekwa, K.; Tabiś, A.; Bania, J.; Bugla–Płoskońska, G.; Wieliczko, A. Antimicrobial Resistance and Biofilm Formation Capacity of Salmonella enterica Serovar Enteritidis Strains Isolated from Poultry and Humans in Poland. Pathogens 2020, 9, 643. [Google Scholar] [CrossRef] [PubMed]
  39. Dang, S.T.T.; Truong, D.T.Q.; Olsen, J.E.; Tran, N.T.; Truong, G.T.H.; Vu, H.T.K.; Dalsgaard, A. Research note: Occurrence of mcr–encoded colistin resistance in Escherichia coli from pigs and pig farm workers in Vietnam. FEMS Microbes 2020, 1, xtaa003. [Google Scholar] [CrossRef]
  40. Wajid, M.; Awan, A.B.; Saleemi, M.K.; Weinreich, J.; Schierack, P.; Sarwar, Y.; Ali, A. Multiple drug resistance and virulence profiling of Salmonella enterica serovars Typhimurium and Enteritidis from poultry farms of Faisalabad, Pakistan. Microb. Drug Resist. 2019, 25, 133–142. [Google Scholar] [CrossRef]
  41. Herrera–Sánchez, M.P.; Rodríguez–Hernández, R.; Rondón–Barragán, I.S. Molecular characterization of antimicrobial resistance and enterobacterial repetitive intergenic consensus–PCR as a molecular typing tool for Salmonella spp. isolated from poultry and humans. Vet. World 2020, 13, 1771. [Google Scholar] [CrossRef]
  42. Ziech, R.E.; Lampugnani, C.; Perin, A.P.; Sereno, M.J.; Sfaciotte, R.A.P.; Viana, C.; Soares, V.M.; Pinto, J.P.D.A.N.; Bersot, L.D.S. Multidrug resistance and ESBL–producing Salmonella spp. isolated from broiler processing plants. Braz. J. Microbiol. 2016, 47, 191–195. [Google Scholar] [CrossRef]
  43. Waghamare, R.N.; Paturkar, A.M.; Vaidya, V.M.; Zende, R.J.; Dubal, Z.N.; Dwivedi, A.; Gaikwad, R.V. Phenotypic and genotypic drug resistance profile of Salmonella serovars isolated from poultry farm and processing units located in and around Mumbai city, India. Vet. World 2018, 11, 1682. [Google Scholar] [CrossRef] [PubMed]
  44. Ahmed, A.M.; Nakano, H.; Shimamoto, T. The first characterization of extended–spectrum β–lactamase–producing Salmonella in Japan. J. Antimicrob. Chemoth. 2004, 54, 283–284. [Google Scholar] [CrossRef]
  45. Mazurek, J.; Bok, E.; Pusz, P.; Stosik, M.; Baldy–Chudzik, K. Phenotypic and genotypic characteristics of antibiotic resistance of commensal Escherichia coli isolates from healthy pigs. Bull Vet. Inst. Pulawy 2014, 58, 211–218. [Google Scholar] [CrossRef]
  46. Dawangpa, A.; Lertwatcharasarakul, P.; Ramasoota, P.; Boonsoongnern, A.; Ratanavanichrojn, N.; Sanguankiat, A.; Phatthanakunanan, S.; Tulayakul, P. Genotypic and phenotypic situation of antimicrobial drug resistance of Escherichia coli in water and manure between biogas and non–biogas swine farms in central Thailand. J. Environ. Manag. 2021, 279, 111659. [Google Scholar] [CrossRef]
  47. Nikiema, M.E.M.; Kakou–Ngazoa, S.; Ky/By, A.; Sylla, A.; Bako, E.; Addablah, A.Y.A.; Ouoba, J.B.; Sampo, E.; Gnada, K.; Zongo, O.; et al. Characterization of virulence factors of Salmonella isolated from human stools and street food in urban areas of Burkina Faso. BMC Microbiol. 2021, 21, 1–12. [Google Scholar] [CrossRef] [PubMed]
  48. Li, Q.; Cheng, W.; Zhang, D.; Yu, T.; Yin, Y.; Ju, H.; Ding, S. Rapid and sensitive strategy for Salmonella detection using an InvA gene–based electrochemical DNA sensor. Int. J. Electrochem. Sci. 2012, 7, 844–856. [Google Scholar]
  49. El–Sebay, N.A.; Abu Shady, H.M.; El–Rashed El–Zeedy, S.A.; Samy, A.A. InvA gene sequencing of Salmonella Typhimurium isolated from Egyptian poultry. Asian J. Sci. Res. 2017, 10, 194–202. [Google Scholar] [CrossRef][Green Version]
  50. Song, X.; Zhang, H.; Ma, S.; Song, Y.; Lv, R.; Liu, X.; Yang, B.; Huang, D.; Jiang, L. Transcriptome analysis of virulence gene regulation by the ATP–dependent Lon protease in Salmonella Typhimurium. Future Microbiol. 2019, 14, 1109–1122. [Google Scholar] [CrossRef]
  51. Culler, H.F.; Couto, S.C.F.; Higa, J.S.; Ruiz, R.M.; Yang, M.J.; Bueris, V.; Franzolin, M.R.; Sircili, M.P. Role of SdiA on Biofilm Formation by Atypical Enteropathogenic Escherichia coli. Genes 2018, 9, 253. [Google Scholar] [CrossRef]
  52. Li, J.; Li, N.; Ning, C.; Guo, Y.; Ji, C.; Zhu, X.; Zhang, X.; Meng, Q.; Shang, Y.; Xiao, C.; et al. sRNA STnc150 is involved in virulence regulation of Salmonella Typhimurium by targeting fimA mRNA. FEMS Microbiol. Lett. 2021, 368, fnab124. [Google Scholar] [CrossRef]
  53. Prager, R.; Fruth, A.; Tschäpe, H. Salmonella enterotoxin (stn) gene is prevalent among strains of Salmonella enterica, but not among Salmonella bongori and other Enterobacteriaceae. FEMS Immunol. Med. Mic. 1995, 12, 47–50. [Google Scholar] [CrossRef]
  54. Khalefa, H.S.; Ahmed, Z.S.; Abdel–Kader, F.; Ismail, E.M.; Elshafiee, E.A. Sequencing and phylogenetic analysis of the stn gene of Salmonella species isolated from different environmental sources at Lake Qarun protectorate: The role of migratory birds and public health importance. Vet. World 2021, 14, 2764. [Google Scholar] [CrossRef]
  55. Krzyzanowski, F.; Zappelini, L.; Martone–Rocha, S.; Dropa, M.; Matté, M.H.; Nacache, F.; Razzolini, M.T.P. Quantification and characterization of Salmonella spp. isolates in sewage sludge with potential usage in agriculture. BMC Microbiol. 2014, 14, 1–9. [Google Scholar] [CrossRef]
  56. Bolton, D.J.; Ivory, C.; McDowell, D. A study of Salmonella in pigs from birth to carcass: Serotypes, genotypes, antibiotic resistance and virulence profiles. Int. J. Food Microbiol. 2013, 160, 298–303. [Google Scholar] [CrossRef]
  57. Koczerka, M.; Douarre, P.E.; Kempf, F.; Holbert, S.; Mistou, M.Y.; Grépinet, O.; Virlogeux–Payant, I. The invasin and complement–resistance protein Rck of Salmonella is more widely distributed than previously expected. Microbiol. Spectr. 2021, 9, e01457-21. [Google Scholar] [CrossRef] [PubMed]
  58. Barilleau, E.; Védrine, M.; Koczerka, M.; Burlaud–Gaillard, J.; Kempf, F.; Grépinet, O.; Virlogeux–Payant, I.; Velge, P.; Wiedemann, A. Investigation of the invasion mechanism mediated by the outer membrane protein PagN of Salmonella Typhimurium. BMC Microbiol. 2021, 21, 1–18. [Google Scholar] [CrossRef] [PubMed]
  59. Chaudhary, J.; Nayak, J.; Brahmbhatt, M.; Makwana, P. Virulence genes detection of Salmonella serovars isolated from pork and slaughterhouse environment in Ahmedabad, Gujarat. Vet. World 2015, 8, 121–124. [Google Scholar] [CrossRef] [PubMed]
  60. Somda, N.S.; Bonkoungou, I.J.O.; Sambe–Ba, B.; Drabo, M.S.; Wane, A.A.; Sawadogo–Lingani, H.; Savadogo, A. Diversity and antimicrobial drug resistance of non–typhoid Salmonella serotypes isolated in lettuce, irrigation water and clinical samples in Burkina Faso. J. Agric. Food Res. 2021, 5, 100167. [Google Scholar] [CrossRef]
  61. Deguenon, E.; Dougnon, V.; Lozes, E.; Maman, N.; Agbankpe, J.; Abdel–Massih, R.M.; Djegui, F.; Baba–Moussa, J.; Dougnon, J. Resistance and virulence determinants of faecal Salmonella spp. isolated from slaughter animals in Benin. BMC Res. Notes 2019, 12, 1–7. [Google Scholar] [CrossRef]
  62. Qiao, J.; Alali, W.Q.; Liu, J.; Wang, Y.; Chen, S.; Cui, S.; Yang, B. Prevalence of Virulence Genes in Extended–Spectrum β–lactamases (ESBLs)–Producing Salmonella in Retail Raw Chicken in China. J. Food Sci. 2018, 83, 1048–1052. [Google Scholar] [CrossRef]
  63. Larsson, D.G.; Flach, C.F. Antibiotic resistance in the environment. Nat. Rev. Microbiol. 2022, 20, 257–269. [Google Scholar] [CrossRef]
  64. Zhang, R.; Yang, S.; An, Y.; Wang, Y.; Lei, Y.; Song, L. Antibiotics and antibiotic resistance genes in landfills: A review. Sci. Total Environ. 2022, 806, 150647. [Google Scholar] [CrossRef]
  65. Aslam, B.; Wang, W.; Arshad, M.I.; Khurshid, M.; Muzammil, S.; Rasool, M.H.; Nisar, M.A.; Alvi, R.F.; Aslam, M.A.; Qamar, M.U.; et al. Antibiotic resistance: A rundown of a global crisis. Infect. Drug Resist. 2018, 11, 1645. [Google Scholar] [CrossRef]
  66. Zhang, Z.; Zhang, Q.; Wang, T.; Xu, N.; Lu, T.; Hong, W.; Penuelas, J.; Gillings, M.; Wang, M.; Gao, W.; et al. Assessment of global health risk of antibiotic resistance genes. Nat. Commun. 2022, 13, 1–11. [Google Scholar] [CrossRef]
  67. Mora–Ochomogo, M.; Lohans, C.T. β–Lactam antibiotic targets and resistance mechanisms: From covalent inhibitors to substrates. RSC Med. Chem. 2021, 12, 1623–1639. [Google Scholar] [CrossRef] [PubMed]
  68. Krishnamoorthy, R.; Athinarayanan, J.; Periyasamy, V.S.; Alshuniaber, M.A.; Alshammari, G.; Hakeem, M.J.; Ahmed, M.A.; Alshatwi, A.A. Antibacterial Mechanisms of Zinc Oxide Nanoparticle against Bacterial Food Pathogens Resistant to Beta–Lactam Antibiotics. Molecules 2022, 27, 2489. [Google Scholar] [CrossRef] [PubMed]
  69. De Rosa, M.; Verdino, A.; Soriente, A.; Marabotti, A. The Odd Couple(s): An Overview of Beta–Lactam Antibiotics Bearing More Than One Pharmacophoric Group. Int. J. Mol. Sci. 2021, 22, 617. [Google Scholar] [CrossRef] [PubMed]
  70. Zango, U.U.; Ibrahim, M.; Shawai, S.A.A.; Shamsuddin, I.M. A review on β–lactam antibiotic drug resistance. MOJ Drug Des. Develop. Ther. 2019, 3, 52–58. [Google Scholar]
  71. Behzadi, P.; García–Perdomo, H.A.; Karpiński, T.M.; Issakhanian, L. Metallo–β–lactamases: A review. Mol. Biol. Rep. 2020, 47, 6281–6294. [Google Scholar] [CrossRef]
  72. Nazek, A.G.; Ridha, B.A. Fluoroquinolones Resistance Salmonella: State of Knowledge. Adv. Biotechnol. Microbiol. 2017, 7, 555717. [Google Scholar]
  73. Zhang, C.Z.; Ren, S.Q.; Chang, M.X.; Chen, P.X.; Ding, H.Z.; Jiang, H.X. Resistance mechanisms and fitness of Salmonella Typhimurium and Salmonella Enteritidis mutants evolved under selection with ciprofloxacin in vitro. Sci. Rep. 2017, 7, 9113. [Google Scholar] [CrossRef]
  74. Velhner, M. Mechanisms of Resistance to Quinolones and Epidemiological Significance of Salmonella spp. Acta Vet. 2016, 66, 147–159. [Google Scholar] [CrossRef]
  75. Zhang, C.Z.; Zhang, Y.; Ding, X.M.; Lin, X.L.; Lian, X.L.; Trampari, E.; Thomson, N.M.; Ding, H.Z.; Webber, M.A.; Jiang, H.X. Emergence of ciprofloxacin heteroresistance in foodborne Salmonella enterica serovar Agona. J. Antimicrob. Chemother. 2020, 75, 2773–2779. [Google Scholar] [CrossRef]
  76. Cuypers, W.L.; Jacobs, J.; Wong, V.; Klemm, E.J.; Deborggraeve, S.; Puyvelde, S.V. Fluoroquinolone resistance in Salmonella: Insights by whole–genome sequencing. Microb. Genom. 2018, 4, e000195. [Google Scholar] [CrossRef]
  77. Fu, X.; Wan, P.; Li, P.; Wang, J.; Guo, S.; Zhang, Y.; An, Y.; Ye, C.; Liu, Z.; Gao, J.; et al. Mechanism and prevention of ototoxicity induced by aminoglycosides. Front. Cell. Neurosci. 2021, 15, 692762. [Google Scholar] [CrossRef] [PubMed]
  78. Van Duijkeren, E.; Schwarz, C.; Bouchard, D.; Catry, B.; Pomba, C.; Baptiste, K.E.; Moreno, M.A.; Rantala, M.; Ružauskas, M.; Sandres, P.; et al. The use of aminoglycosides in animals within the EU: Development of resistance in animals and possible impact on human and animal health: A review. J. Antimicrob. Chemother. 2019, 74, 2480–2496. [Google Scholar] [CrossRef] [PubMed]
  79. Basant, B.N.; Kumar, S.; Gorachiya, P.R.; Panwar, R. Antimicrobial resistance profile of Escherichia coli isolates from mastitic milk samples. Pharma Innov. J. 2022, 11, 1328–1331. [Google Scholar]
  80. Urban–Chmiel, R.; Marek, A.; Stępień–Pyśniak, D.; Wieczorek, K.; Dec, M.; Nowaczek, A.; Osek, J. Antibiotic Resistance in Bacteria–A Review. Antibiotics 2022, 11, 1079. [Google Scholar] [CrossRef]
  81. Meşeli, T.; Doğan, Ş.D.; Gündüz, M.G.; Kökbudak, Z.; Bogojevic, S.S.; Noonan, T.; Vojnovic, S.; Wolber, G.; Nikodinovic–Runic, J. Design, synthesis, antibacterial activity evaluation and molecular modeling studies of new sulfonamides containing a sulfathiazole moiety. New J. Chem. 2021, 45, 8166–8177. [Google Scholar] [CrossRef]
  82. Fernández–Villa, D.; Aguilar, M.R.; Rojo, L. Folic Acid Antagonists: Antimicrobial and Immunomodulating Mechanisms and Applications. Int. J. Mol. Sci. 2019, 20, 4996. [Google Scholar] [CrossRef]
  83. Shahzad, S.; Qadir, M.A.; Ahmed, M.; Ahmad, S.; Khan, M.J.; Gulzar, A.; Muddassar, M. Folic acid–sulfonamide conjugates as antibacterial agents: Design, synthesis and molecular docking studies. RSC Adv. 2020, 10, 42983–42992. [Google Scholar] [CrossRef]
  84. Alam, S.B.; Mahmud, M.; Akter, R.; Hasan, M.; Sobur, A.; Nazir, K.N.H.; Noreddin, A.; Rahman, T.; El Zowalaty, M.E.; Rahman, M. Molecular Detection of Multidrug Resistant Salmonella Species Isolated from Broiler Farm in Bangladesh. Pathogens 2020, 9, 201. [Google Scholar] [CrossRef]
  85. Hughes, D.L. Patent review of manufacturing routes to fifth–generation cephalosporin drugs. Part 2, ceftaroline fosamil and ceftobiprole medocaril. Org. Process. Res. Dev. 2017, 21, 800–815. [Google Scholar] [CrossRef]
  86. Mehta, D.; Sharma, A.K. Cephalosporins: A review on imperative class of antibiotics. Inventi Rapid Mol. Pharmacol. 2016, 1, 1–6. [Google Scholar]
  87. Marin, C.; Lorenzo–Rebenaque, L.; Laso, O.; Villora–Gonzalez, J.; Vega, S. Pet reptiles: A potential source of transmission of multidrug–resistant Salmonella. Front. Vet. Sci. 2021, 7, 613718. [Google Scholar] [CrossRef] [PubMed]
  88. Chen, T.; Jiang, J.; Ye, C.; Xie, J.; Chen, X.; Xu, D.; Zeng, Z.; Peng, Y.; Hu, D.–L.; Fang, R. Genotypic characterization and antimicrobial resistance profile of Salmonella isolated from chicken, pork and the environment at abattoirs and supermarkets in Chongqing, China. BMC Vet. Res. 2019, 15, 1–8. [Google Scholar] [CrossRef] [PubMed]
  89. Maka, L.; Popowska, M. Antimicrobial resistance of Salmonella spp. isolated from food. Rocz. Państwowego Zakładu Hig. 2016, 67, 343–358. [Google Scholar]
  90. Iredell, J.; Brown, J.; Tagg, K. Antibiotic resistance in Enterobacteriaceae: Mechanisms and clinical implications. BMJ 2016, 352, h6420. [Google Scholar] [CrossRef]
  91. Meshref, A.–M.E.; Eldesoukey, I.E.; Alouffi, A.S.; Alrashedi, S.A.; Osman, S.A.; Ahmed, A.M. Molecular Analysis of Antimicrobial Resistance among Enterobacteriaceae Isolated from Diarrhoeic Calves in Egypt. Animals 2021, 11, 1712. [Google Scholar] [CrossRef]
  92. Philippon, A.; Slama, P.; Dény, P.; Labia, R. A structure–based classification of class A β–lactamases, a broadly diverse family of enzymes. Clin. Microbiol. Rev. 2016, 29, 29–57. [Google Scholar] [CrossRef]
  93. Sabry, M.A.; Abdel–Moein, K.A.; Abdel–Kader, F.; Hamza, E. Extended–spectrum β–lactamase–producing Salmonella serovars among healthy and diseased chickens and their public health implication. J. Glob. Antimicrob. Resist. 2020, 22, 742–748. [Google Scholar] [CrossRef]
  94. Ali, T.; Ali, I.; Khan, N.A.; Han, B.; Gao, J. The growing genetic and functional diversity of extended spectrum beta–lactamases. BioMed Res. Int. 2018, 2018, 9519718. [Google Scholar]
  95. Meini, S.; Tascini, C.; Cei, M.; Sozio, E.; Rossolini, G.M. AmpC β–lactamase–producing Enterobacterales: What a clinician should know. Infection 2019, 47, 363–375. [Google Scholar] [CrossRef]
  96. Rensing, K.L.; Abdallah, H.M.; Koek, A.; Elmowalid, G.A.; Vandenbroucke–Grauls, C.M.; Al Naiemi, N.; van Dijk, K. Prevalence of plasmid–mediated AmpC in Enterobacteriaceae isolated from humans and from retail meat in Zagazig, Egypt. Antimicrob. Resist. Infect. Control. 2019, 8, 1–8. [Google Scholar] [CrossRef]
  97. Jeon, H.Y.; Kim, Y.B.; Lim, S.K.; Lee, Y.J.; Seo, K.W. Characteristics of cephalosporin–resistant Salmonella isolates from poultry in Korea, 2010–2017. Poult. Sci. 2019, 98, 957–965. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Dendrogram displaying PFGE profiles of Salmonella strains.
Figure 1. Dendrogram displaying PFGE profiles of Salmonella strains.
Pathogens 11 01323 g001
Table 1. The primer pairs used for detection of virulence factors in Salmonella strains.
Table 1. The primer pairs used for detection of virulence factors in Salmonella strains.
Target GenePrimer Sequences 5′–3′Annealing
Temperature
Product SizeReference
invAF–GTGAAATTATCGCCACGTTCGGGCAA
R–TCATCGCACCGTCAAAGGAACC
63 °C284 bp[26]
fimAF–CCTTTCTCCATCGTCCTGAA
R–TGGTGTTATCTGCCTGACCA
56 °C85 bp[27]
stnF–CTTTGGTCGTAAAATAAGGCG
R–TGCCCAAAGCAGAGAGATTC
56 °C260 bp[28]
spvCF–ACTCCTTGCACAACCAAATGCGGA
R–TGTCTTCTGCATTTCGCCACCATCA
63 °C571 bp[29]
spvRF–CAGGTTCCTTCAGTATCGCA
R–TTTGGCCGGAAATGGTCAGT
56 °C310 bp[30]
rckF–CTGACCACCCATTCCGTGT
R–GTAACCGACACCAACGTT
56 °C479 bp[31]
Table 2. The primer pairs and gene targets used for the detection of antimicrobial resistance in Salmonella strains.
Table 2. The primer pairs and gene targets used for the detection of antimicrobial resistance in Salmonella strains.
Target Gene/
Antibiotic
Resistance MechanismPrimer Sequences 5′-3′Annealing
Temperature
Product SizeReference
strA/strB
streptomycin
Aminoglicoside phosphotransferaseF–ATGGTGGACCCTAAAACTCT
R–CGTCTAGGATCGAGACAAAG
63 °C891 bp[35]
aadA
streptomycin
Streptomycin adenyltransferaseF–GTGGATGGCGGCCTGAAGCC
R–AATGCCCAGTCGGCAGCG
63 °C525 bp[36]
aadB
gentamicin
Aminoglycoside transferaseF–GAGGAGTTGGACTATGGATT
R–CTTCATCGGCATAGTAAAAG
60 °C208 bp[35]
aacC
gentamicin
Aminoglycoside acetyltransferaseF–GGCGCGATCAACGAATTTATCCGA
R–CCATTCGATGCCGAAGGAAACGAT
58 °C448 bp[37]
floF
florfenicol
EffluxF–CACGTTGAGCCTCTATATGG
R–ATGCAGAAGTAGAACGCGAC
61 °C888 bp[7]
floR
chloramphenicol
EffluxF–AACCCGCCCTCTGGATCAAGTCAA
R–CAAATCACGGGCCACGCTGTATC
60 °C548 bp[38]
cat1
chloramphenicol
Chloramphenicol acetyltransferaseF–CCTATAACCAGACCGTTCAG
R–TCACAGACGGCATGATGAAC
56 °C491 bp[38]
cat2
chloramphenicol
Chloramphenicol acetyltransferaseF–CCGGATTGACCTGAATACCT
R–TCACATACTGCATGATGAAC
56 °C456 bp[38]
mcr1
colistin
Phosphoetanolamine transferaseF–AGTCCGTTTGTTCTTGTGGC
R–AGATCCTTGGTCTCGGCTTG
58 °C320 bp[39]
mcr2
colistin
Phosphoetanolamine transferaseF–CAAGTGTGTTGGTCGCAGTT
R–TCTAGCCCGACAAGCATACC
58 °C715 bp[39]
mcr3
colistin
Phosphoetanolamine transferaseF–AAATAAAAATTGTTCCGCTTATG
R–AATGGAGATCCCCGTTTTT
58 °C929 bp[39]
mcr4
colistin
Phosphoetanolamine transferaseF–TCACTTTCATCACTGCGTTG
R–TTGGTCCATGACTACCAATG
58 °C1116 bp[39]
mcr5
colistin
Phosphoetanolamine transferaseF–ATGCGGTTGTCTGCATTTATC
R–TCATTGTGGTTGTCCTTTTCTG
58 °C1644 bp[39]
aphAI-IAB
kanamycin
Aminoglycoside phosphoryltranferaseF–AAACGTCTTGCTCGAGGC
R–CAAACCGTTATTCATTCGTGA
55 °C461 bp[40]
aphA1
neomycin
Aminoglicoside phosphotransferaseF–ATGGGCTCGCGATAATGTC
R–CTCACCGAGGCAGTTCCAT
60 °C634 bp[7]
aphA2
neomycin
Aminoglicoside phosphotransferaseF–GATTGAACAAGATGGATTGC
R–CCATGATGGATACTTTCTCG
60 °C347 bp[7]
tetA
tetracycline
EffluxF–GCTACATCCTGCTTGCCTTC
R–CATAGATCGCCGTGAAGAGG
56 °C210 bp[38]
tetB
tetracycline
EffluxF–TTGGTTAGGGGCAAGTTTTG
R–GTAATGGGCCAATAACACCG
53 °C659 bp[38]
tetC
tetracycline
EffluxF–CTTGAGAGCCTTCAACCCAG
R–ATGGTCGTCATCTACCTGCC
56 °C417 bp[38]
sul1
sulfamethoxazole
Dihydropteroate synthase inhibitorF–CGGCGTGGGCTACCTGAACG
R–GCCGATCGCGTGAAGTTCCG
66 °C433 bp[35]
sul2
sulfamethoxazole
Dihydropteroate synthase inhibitorF–CGGCATCGTCAACATAACCT
R–TGTGCGGATGAAGTCAGCTC
66 °C721 bp[35]
sul3
sulfamethoxazole
Dihydropteroate synthase inhibitorF–GGGAGCCGCTTCCAGTAAT
R–TCCGTGACACTGCAATCATTA
57 °C500 bp[7]
dfrA1
trimethoprim
Dihydrofolate reductaseF–CAATGGCTGTTGGTTGGAC
R–CCGGCTCGATGTCTATTGT
62 °C253 bp[41]
dfrA10
trimethoprim
Dihydrofolate reductaseF–TCAAGGCAAATTACCTTGGC
R–ATCTATTGGATCACCTACCC
59 °C433 bp[41]
dfrA12
trimethoprim
Dihydrofolate reductaseF–TTCGCAGACTCACTGAGGG
R–CGGTTGAGACAAGCTCGAAT
63 °C330 bp[41]
Table 3. Primers used for detection of target β-lactamases-related genes in Salmonella strains.
Table 3. Primers used for detection of target β-lactamases-related genes in Salmonella strains.
Target GeneResistance MechanismPrimer Sequences 5′-3′Annealing
Temperature
Product SizeReference
blaTEMTEM-type ESBLF–ATGAGTATTCAACATTTCCG
R–CTGACAGTTACCAATGCTTA
55 °C867 bp[43]
blaCTX-MCTX-type ESBLF–CGCTTTGCGATGTGCAG
R–ACCGCGATATCGTTGGT
60 °C585 bp[44]
blaSHVSHV-type ESBLF–AGGATTGACTGCCTTTTTG
R–ATTTGCTGATTTCGCTCG
55 °C393 bp[45]
blaCMY-2AmpCF–GACAGCCTCTTTCTCCACA
R–TGGACACGAAGGCTACGTA
55 °C1000 bp[45]
blaPSE-1EffluxF–GCAAGTAGGGCAGGCAATCA
R–GAGCTAGATAGATGCTCACAA
60 °C422 bp[46]
Table 4. Source of isolation and taxonomic identification of the Salmonella strains.
Table 4. Source of isolation and taxonomic identification of the Salmonella strains.
Bacterial Strain NumberYear
of Isolation
Source of IsolationBacteria Identification Acc.
to MALDI–TOF MS
Bacteria Identification Acc.
to 16S rRNA Sequencing
GenBank Accession Number
KKP 9961981HP/fecal sampleSalmonella enterica subsp. entericaSalmonella enterica subsp. entericaON627842
KKP 9971981FPSalmonella enterica subsp. entericaSalmonella enterica subsp. entericaMW046052
KKP 9981991FPSalmonella enterica subsp. entericaSalmonella enterica subsp. entericaON764274
KKP 9991991FPSalmonella enterica subsp. entericaSalmonella enterica subsp. entericaON627845
KKP 10002005FPSalmonella enterica subsp. entericaSalmonella enterica subsp. entericaON312999
KKP 10012005FPSalmonella enterica subsp. entericaSalmonella enterica subsp. entericaMW332255
KKP 10022005FPSalmonella sp.Salmonella enterica subsp. entericaON340716
KKP 10032005FPSalmonella enterica subsp. entericaSalmonella enterica subsp. entericaON756138
KKP 10042005FPSalmonella enterica subsp. entericaSalmonella enterica subsp. entericaON627844
KKP 10052005FPSalmonella enterica subsp. entericaSalmonella enterica subsp. entericaON627847
KKP 10062005FPSalmonella sp.Salmonella enterica subsp. entericaON764251
KKP 10072005FPSalmonella enterica subsp. entericaSalmonella enterica subsp. entericaON627846
KKP 10082005FPSalmonella enterica subsp. entericaSalmonella enterica subsp. entericaON340717
KKP 10092005FPSalmonella enterica subsp. entericaSalmonella enterica subsp. entericaON764277
KKP 10102005FPSalmonella enterica subsp. entericaSalmonella enterica subsp. entericaON764279
KKP 10392005FPSalmonella enterica subsp. entericaSalmonella enterica subsp. entericaON764252
KKP 10402005FPSalmonella enterica subsp. entericaSalmonella enterica subsp. entericaON764280
KKP 10412005FPSalmonella sp.Salmonella enterica subsp. entericaON764253
KKP 10422005FPSalmonella enterica subsp. entericaSalmonella enterica subsp. entericaON798424
KKP 10432005FPSalmonella enterica subsp. entericaSalmonella enterica subsp. entericaON764281
KKP 10442005FPSalmonella enterica subsp. entericaSalmonella enterica subsp. entericaON764287
KKP 10452005FPSalmonella enterica subsp. entericaSalmonella enterica subsp. entericaON764254
KKP 11132005FP/halvahSalmonella enterica subsp. entericaSalmonella enterica subsp. entericaON775567
KKP 11692006FP/sesame seedsSalmonella enterica subsp. entericaSalmonella enterica subsp. entericaON764259
KKP 11931987HP/fecal sampleSalmonella enterica subsp. entericaSalmonella enterica subsp. entericaON764258
KKP 12132009FP/caraway seedsSalmonella enterica subsp. entericaSalmonella enterica subsp. entericaON764805
KKP 12172009FP/corianderSalmonella enterica subsp. entericaSalmonella enterica subsp. entericaON764807
KKP 15142009FPL/pump filterSalmonella enterica subsp. entericaSalmonella enterica subsp. entericaON756136
KKP 15972009FPSalmonella enterica subsp. entericaSalmonella enterica subsp. entericaON461374
KKP 16082009FPSalmonella enterica subsp. entericaSalmonella enterica subsp. entericaON312943
KKP 16102006FPSalmonella enterica subsp. entericaSalmonella enterica subsp. entericaON313000
KKP 16112009FPSalmonella enterica subsp. entericaSalmonella enterica subsp. entericaON764857
KKP 16122009FPSalmonella enterica subsp. entericaSalmonella enterica subsp. entericaON764858
KKP 16132009FPSalmonella enterica subsp. entericaSalmonella enterica subsp. entericaON766359
KKP 16142009FPSalmonella enterica subsp. entericaSalmonella enterica subsp. entericaON312941
KKP 16362010FPSalmonella enterica subsp. entericaSalmonella enterica subsp. entericaON773156
KKP 17612010FPSalmonella enterica subsp. entericaSalmonella enterica subsp. entericaON798425
KKP 17622010FPSalmonella enterica subsp. entericaSalmonella enterica subsp. entericaON340720
KKP 17632010FPSalmonella enterica subsp. entericaSalmonella enterica subsp. entericaON773159
KKP 17751997HP/fecal sampleSalmonella enterica subsp. entericaSalmonella enterica subsp. entericaON832663
KKP 17761995ABR/poultrySalmonella enterica subsp. entericaSalmonella enterica subsp. entericaON461376
KKP 30782019FP/confectionery industrySalmonella enterica subsp. entericaSalmonella enterica subsp. entericaMW034593
KKP 30792019FPL/conveyor beltSalmonella enterica subsp. entericaSalmonella enterica subsp. entericaMW033548
KKP 30802019FP/confectionery industrySalmonella enterica subsp. entericaSalmonella enterica subsp. entericaMW033536
KKP 30812019FPL/production tankSalmonella enterica subsp. entericaSalmonella enterica subsp. entericaMW033602
KKP 38142016ABR/henhouseSalmonella enterica subsp. entericaSalmonella enterica subsp. entericaON732733
KKP 38152016ABR/henhouseSalmonella enterica subsp. entericaSalmonella enterica subsp. entericaON732742
KKP 38162016ABR/henhouseSalmonella enterica subsp. entericaSalmonella enterica subsp. entericaON756119
KKP 38172016ABR/henhouseSalmonella enterica subsp. entericaSalmonella enterica subsp. entericaON756120
KKP 38182016ABR/henhouseSalmonella enterica subsp. entericaSalmonella enterica subsp. entericaON756135
KKP 38192018ABR/poultrySalmonella enterica subsp. entericaSalmonella enterica subsp. entericaON732745
KKP 38202018ABR/poultrySalmonella enterica subsp. entericaSalmonella enterica subsp. entericaON732744
KKP 38212018ABR/poultrySalmonella enterica subsp. entericaSalmonella enterica subsp. entericaON732827
Abbreviations: ABR—animals and animal breeding rooms; FPL—food production lines; FP—food products; HP—hospitalized patients.
Table 5. Detection of virulence markers in Salmonella strains.
Table 5. Detection of virulence markers in Salmonella strains.
Salmonella Strain NumberVirulence Genes
invAfimAstnspvCspvRrck
KKP 996++++++
KKP 997+++-
KKP 998++++
KKP 999+++--+
KKP 1000++++++
KKP 1001++++
KKP 1002+++
KKP 1003+++
KKP 1004+++
KKP 1005++++
KKP 1006+++
KKP 1007+++
KKP 1008+++
KKP 1009+++
KKP 1010+++
KKP 1039+++
KKP 1040+++
KKP 1041+++
KKP 1042+++
KKP 1043+++
KKP 1044+++
KKP 1045+++
KKP 1113+++
KKP 1169+++
KKP 1193+++
KKP 1213++++
KKP 1217+++
KKP 1514++++
KKP 1597+++
KKP 1608+++
KKP 1610+++
KKP 1611+++
KKP 1612+++
KKP 1613+++
KKP 1614+++
KKP 1636++++++
KKP 1761++++
KKP 1762+++
KKP 1763+++
KKP 1775++++++
KKP 1776++++++
KKP 3078++++++
KKP 3079+++
KKP 3080+++
KKP 3081+++
KKP 3814++++++
KKP 3815++++++
KKP 3816++++++
KKP 3817++++++
KKP 3818++++++
KKP 3819++++++
KKP 3820++++++
KKP 3821+++
Table 6. Phenotype resistance of Salmonella strains.
Table 6. Phenotype resistance of Salmonella strains.
Salmonella Strain NumberAntibiotic Resistance PatternMAR IndexMDR
KKP 996no resistance *-
KKP 997no resistance *-
KKP 998AMC-TTC-FEP-CTX-CPT-CAZ-CT-CRO-ETP-IMP-ATM-PEF-MXF-OFX-AK-CN-TOB0.61+
KKP 999PRL-CPT-CAZ-CRO-PEF-MXF-C0.25+
KKP 1000AMP-SAM-AMC-PRL-TTC-CPT-CN-TOB-C0.32+
KKP 1001CPT-CT-AK-CN-TOB0.18
KKP 1002PRL-CPT-ATM-CIP-PEF-MXF-NOR-CN0.29+
KKP 1003CN-TOB0.07
KKP 1004AMC-TZP-TTC-FEP-CTX-CPT-CT-MXF-OFX-AK-TOB0.39+
KKP 1005CPT-AK0.07
KKP 1006CPT-AK0.07
KKP 1007AMC-TTC-CPT-CT-CRO-MXF-AK-CN-TOB-SXT0.36+
KKP 1008no resistance *-
KKP 1009CPT-CIP-MXF-CN0.14+
KKP 1010CPT-PEF-OFX-AK-SXT0.18+
KKP 1039MXF-AK-TOB0.11
KKP 1040no resistance *-
KKP 1041CPT-AK0.07
KKP 1042CPT-
KKP 1043CPT-ETP-CN-TOB0.14+
KKP 1044AMC-PRL-TZP-TTC-CPT-CRO-IMP-MXF-AK-CN-TOB0.39+
KKP 1045CPT-MXF0.07
KKP 1113AK-
KKP 1169no resistance *-
KKP 1193CT-CN-TOB0.11
KKP 1213PRL-TZP-CPT-CT-CRO-ETP-OFX-AK-CN-TOB0.36+
KKP 1217CPF-CN-TOB0.11
KKP 1514CPT-CT-CRO-ETP-ATM-CIP-MXF-AK-CN-TOB0.36+
KKP 1597CPT-ETP-CIP-MXF-AK-CN-TOB0.25+
KKP 1608no resistance *-
KKP 1610FEP-AK0.07
KKP 1611CPT-AK-TOB0.11
KKP 1612AMC-TTC-CPT-CRO-IMP-PEF-MXF-AK-CN-TOB0.36+
KKP 1613AK-
KKP 1614no resistance *-
KKP 1636PRL-CRO-PEF-MXF-AK-CN-TOB0.25+
KKP 1761CT-CRO-PEF-MXF-NOR-AK-CN-TOB0.29+
KKP 1762AMC-CPT-CT-CRO-MXF-AK-CN-TOB0.29+
KKP 1763CN-
KKP 1775PRL-TZP-FEP-CPT-CT-MXF-CN0.25+
KKP 1776TTC-FEP-AK-TOB0.14+
KKP 3078CPT-MXF-CN0.11+
KKP 3079PRL-CPT-CT-CRO-AK-CN-TOB0.25+
KKP 3080AMC-FEP-CTX-CPT-CT-CRO-MXF-OFX-AK-CN-TOB0.39+
KKP 3081TZP-TTC-FEP-PEF-MXF-AK-CN-TOB0.29+
KKP 3814AK-
KKP 3815AMC-CPT-CT-CRO-CIP-PEF-MXF-AK-CN0.32+
KKP 3816CPT-AK0.07
KKP 3817CPT-ETP-ATM-CIP-MXF-CN0.21+
KKP 3818AK-
KKP 3819PEF-
KKP 3820AMP-SAM-PRL-TTC-CPT-AK-C0.25+
KKP 3821FEP-CTX-CPT-CAZ-CZA-CT-CRO-ETP-ATM-PEF-AK-TOB0.43+
* means no resistance to the tested antibiotics. Notes: AMP—ampicillin; SAM—sulbactam/ampicillin; AMC—amoxicillin/clavulanic acid; PRL—piperacillin; TZP—piperacillin/tazobactam; TTC—ticarcillin/clavulanic acid; FEP—cefepime; CTX—cefotaxime; CPT—ceftaroline; CAZ—ceftazidime; CZA—ceftazidime/avibactam; CT—ceftolozane/tazobactam; CRO—ceftriaxone; ETP—ertapenem; IMP—imipenem; ATM—aztreonam; CIP—ciprofloxacin; PEF—pefloxacin; MXF—moxifloxacin; OFX—ofloxacin; NOR—norfloxacin; AK—amikacin; CN—gentamycin; TOB—tobramycin; C—chloramphenicol; SXT—sulphamethoxazole/trimethoprim. Abbreviations: MAR—Multiple Antibiotic Resistance; MDR—Multi-Drug Resistant strain.
Table 7. Prevalence of phenotypic antibiotic resistance in Salmonella strains.
Table 7. Prevalence of phenotypic antibiotic resistance in Salmonella strains.
Antimicrobial Class
(n = 7)
Antimicrobial Agent
(n = 28)
Number
of Resistant Strains (n = 53)
Percentage
of Resistant
Strains (%)
β–lactam AntibioticsPenicillinsampicillin23.8
sulbactam/ampicillin23.8
amoxicillin/clavulanic acid917.0
piperacillin917.0
piperacillin/tazobactam59.4
ticarcillin/clavulanic acid917.0
Cephalosporinscefepime815.1
cefotaxime47.6
ceftaroline3260.4
ceftazidime35.7
ceftazidime/avibactam11.9
ceftolozane/tazobactam1426.4
ceftriaxone1426.4
Carbapenemsertapenem713.2
imipenem35.7
meropenem00.0
Monobactamsaztreonam59.4
Fluoroquinolonesciprofloxacin611.3
pefloxacin1120.8
levofloxacin00.0
moxifloxacin2037.7
ofloxacin611.3
norfloxacin23.8
Aminoglycosidesamikacin3158.5
gentamycin2649.1
tobramycin2445.3
Phenicolschloramphenicol35.7
Sulfonamidessulphamethoxazole/trimethoprim23.8
Table 8. Distribution of AMR-related genes in relation to antibiotic resistance patterns in Salmonella strains.
Table 8. Distribution of AMR-related genes in relation to antibiotic resistance patterns in Salmonella strains.
Salmonella Strain NumberPhenotypic Antibiotic Resistance PatternGenotypic Antibiotic Resistance Profile
KKP 996no resistance *floF, tetC
KKP 997no resistance *tetC
KKP 998AMC-TTC-FEP-CTX-CPT-CAZ-CT-CRO-ETP-IMP-ATM-
PEF-MXF-OFX-AK-CN-TOB
strA/strB, floF, aphA1, tetC, sul1
KKP 999PRL-CPT-CAZ-CRO-PEF-MXF-CaadA, floR, sul1
KKP 1000AMP-SAM-AMC-PRL-TTC-CPT-CN-TOB-CaadA, floF, floR, tetA, tetC, sul1
KKP 1001CPT-CT-AK-CN-TOBfloF, tetA
KKP 1002PRL-CPT-ATM-CIP-PEF-MXF-NOR-CNtetA, tetC
KKP 1003CN-TOBND**
KKP 1004AMC-TZP-TTC-FEP-CTX-CPT-CT-MXF-OFX-AK-TOBaadA, floR, tetA, tetB, tetC, sul1
KKP 1005CPT-AKfloR, tetB, tetC, sul1
KKP 1006CPT-AKtetC, sul1
KKP 1007AMC-TTC-CPT-CT-CRO-MXF-AK-CN-TOB-SXTaadA, floR, tetB, sul1
KKP 1008no resistance *tetB, tetC
KKP 1009CPT-CIP-MXF-CNtetB, tetC, sul1
KKP 1010CPT-PEF-OFX-AK-SXTstrA/strB, aadA, tetA, tetC, sul1
KKP 1039MXF-AK-TOBtetB, tetC
KKP 1040no resistance *ND**
KKP 1041CPT-AKaadA, tetB, tetC, sul1
KKP 1042CPTstrA/strB, tetB, tetC, sul1
KKP 1043CPT-ETP-CN-TOBtetC, sul1
KKP 1044AMC-PRL-TZP-TTC-CPT-CRO-IMP-MXF-AK-CN-TOBfloF, tetC
KKP 1045CPT-MXFtetB, tetC, sul1
KKP 1113AKND**
KKP 1169no resistance *strA/strB, tetC, sul1, sul2
KKP 1193CT-CN-TOBtetC, sul1
KKP 1213PRL-TZP-CPT-CT-CRO-ETP-OFX-AK-CN-TOBtetB
KKP 1217CPF-CN-TOBtetB, sul1
KKP 1514CPT-CT-CRO-ETP-ATM-CIP-MXF-AK-CN-TOBtetB, tetC
KKP 1597CPT-ETP-CIP-MXF-AK-CN-TOBtetA, tetB
KKP 1608no resistance *floF
KKP 1610FEP-AKsul1
KKP 1611CPT-AK-TOBND**
KKP 1612AMC-TTC-CPT-CRO-IMP-PEF-MXF-AK-CN-TOBtetC
KKP 1613AKtetC
KKP 1614no resistance *tetC
KKP 1636PRL-CRO-PEF-MXF-AK-CN-TOBtetA, tetB, tetC
KKP 1761CT-CRO-PEF-MXF-NOR-AK-CN-TOBtetB, tetC
KKP 1762AMC-CPT-CT-CRO-MXF-AK-CN-TOBtetB
KKP 1763CNtetB, tetC
KKP 1775PRL-TZP-FEP-CPT-CT-MXF-CNND**
KKP 1776TTC-FEP-AK-TOBtetC
KKP 3078CPT-MXF-CNtetB
KKP 3079PRL-CPT-CT-CRO-AK-CN-TOBtetA, tetC
KKP 3080AMC-FEP-CTX-CPT-CT-CRO-MXF-OFX-AK-CN-TOBfloF, tetA, tetC
KKP 3081TZP-TTC-FEP-PEF-MXF-AK-CN-TOBtetA, tetB, tetC
KKP 3814AKtetB
KKP 3815AMC-CPT-CT-CRO-CIP-PEF-MXF-AK-CNtetB
KKP 3816CPT-AKND**
KKP 3817CPT-ETP-ATM-CIP-MXF-CNtetB
KKP 3818AKtetB
KKP 3819PEFfloR, tetC, sul1
KKP 3820AMP-SAM-PRL-TTC-CPT-AK-CaadA, floR, aphAI-IAB, sul1
KKP 3821FEP-CTX-CPT-CAZ-CZA-CT-CRO-ETP-ATM-PEF-AK-TOBND **
* means no resistance to the tested antibiotics | ** ND means: no resistance genes were detected. Notes: AMP—ampicillin; SAM—sulbactam/ampicillin; AMC—amoxicillin/clavulanic acid; PRL—piperacillin; TZP—piperacillin/tazobactam; TTC—ticarcillin/clavulanic acid; FEP—cefepime; CTX—cefotaxime; CPT—ceftaroline; CAZ—ceftazidime; CZA—ceftazidime/avibactam; CT—ceftolozane/tazobactam; CRO—ceftriaxone; ETP—ertapenem; IMP—imipenem; ATM—aztreonam; CIP–ciprofloxacin; PEF—pefloxacin; MXF—moxifloxacin; OFX—ofloxacin; NOR—norfloxacin; AK—amikacin; CN—gentamycin; TOB—tobramycin; C—chloramphenicol; SXT—sulphamethoxazole/trimethoprim
Table 9. Prevalence of genotypic antibiotic resistance in Salmonella strains.
Table 9. Prevalence of genotypic antibiotic resistance in Salmonella strains.
AntibioticTarget GeneNumber of
Resistant Strains
(n = 53)
Percentage
of Resistant
Strains (%)
streptomycinstrA/strB47.6
aadA713.2
florfenicolfloF713.2
chloramphenicolfloR713.2
kanamycinaphAI-IAB11.9
neomycinaphA111.9
tetracyclinetetA1018.9
tetB2343.4
tetC3158.5
sulfamethoxazolesul11935.8
sul211.9
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Wójcicki, M.; Chmielarczyk, A.; Świder, O.; Średnicka, P.; Strus, M.; Kasperski, T.; Shymialevich, D.; Cieślak, H.; Emanowicz, P.; Kowalczyk, M.; et al. Bacterial Pathogens in the Food Industry: Antibiotic Resistance and Virulence Factors of Salmonella enterica Strains Isolated from Food Chain Links. Pathogens 2022, 11, 1323. https://doi.org/10.3390/pathogens11111323

AMA Style

Wójcicki M, Chmielarczyk A, Świder O, Średnicka P, Strus M, Kasperski T, Shymialevich D, Cieślak H, Emanowicz P, Kowalczyk M, et al. Bacterial Pathogens in the Food Industry: Antibiotic Resistance and Virulence Factors of Salmonella enterica Strains Isolated from Food Chain Links. Pathogens. 2022; 11(11):1323. https://doi.org/10.3390/pathogens11111323

Chicago/Turabian Style

Wójcicki, Michał, Agnieszka Chmielarczyk, Olga Świder, Paulina Średnicka, Magdalena Strus, Tomasz Kasperski, Dziyana Shymialevich, Hanna Cieślak, Paulina Emanowicz, Monika Kowalczyk, and et al. 2022. "Bacterial Pathogens in the Food Industry: Antibiotic Resistance and Virulence Factors of Salmonella enterica Strains Isolated from Food Chain Links" Pathogens 11, no. 11: 1323. https://doi.org/10.3390/pathogens11111323

APA Style

Wójcicki, M., Chmielarczyk, A., Świder, O., Średnicka, P., Strus, M., Kasperski, T., Shymialevich, D., Cieślak, H., Emanowicz, P., Kowalczyk, M., Sokołowska, B., & Juszczuk-Kubiak, E. (2022). Bacterial Pathogens in the Food Industry: Antibiotic Resistance and Virulence Factors of Salmonella enterica Strains Isolated from Food Chain Links. Pathogens, 11(11), 1323. https://doi.org/10.3390/pathogens11111323

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop